Coix lacryma-jobi salt stress related gene clwri1-20 and application thereof

By cloning and overexpressing the coix seed salt-stress-resistant gene ClWRI1-20, the problem of insufficient research on coix seed salt-stress resistance was solved, the salt-stress resistance of yeast was enhanced, and genetic resources were provided for salt-tolerant breeding of coix seed.

CN119913165BActive Publication Date: 2025-11-18ZHEJIANG SCI-TECH UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510033150.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-09
Publication Date
2025-11-18
Estimated Expiration
2045-01-09

AI Technical Summary

Technical Problem

Current research on genes related to salt stress resistance in Job's tears is insufficient, affecting the yield and quality of Job's tears. The lack of effective gene function research limits salt-tolerant breeding and sustainable production of Job's tears.

Method used

The salt stress resistance-related gene ClWRI1-20 of Coix lacryma-jobi was cloned and validated. The gene was overexpressed in yeast, and the overexpression vector was constructed and heterologously transformed into yeast. Yeast strains with salt stress resistance were screened out.

Benefits of technology

It improved the yeast's resistance to salt stress, verified the biological function of the ClWRI1-20 gene, and enhanced the yeast's survival ability under adversity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119913165B_ABST
    Figure CN119913165B_ABST
Patent Text Reader

Abstract

The application discloses a coix salt stress resistance related gene ClWRI1-20 and application thereof, and belongs to the technical field of molecular biology.The application provides the coix salt stress resistance related gene ClWRI1-20 and the coding protein thereof, and provides the use of the coix salt stress resistance related gene ClWRI1-20.The application provides an important and possibly universal gene resource for regulating coix salt stress resistance, and provides an excellent candidate gene for cultivating plant varieties with stress resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a coix seed salt stress resistance-related gene ClWRI1-20 and its application. Background Technology

[0002] Job's tears (Coix lacryma-jobi L.) is a traditional Chinese cereal crop used for both medicinal and culinary purposes. Its kernel oil has been proven in modern clinical medical research to possess analgesic, anti-tumor, antioxidant, osteoporosis prevention, and immunity-enhancing effects, showing broad development prospects. With industrialization, Job's tears production is facing various abiotic stresses, with salt stress becoming one of the most significant factors affecting the yield and quality of Job's tears kernels. High-concentration saline-alkali soil cultivation also leads to significant yield losses. In recent years, with the development of molecular biology, a series of stress-resistance-related genes have been identified in Job's tears. However, data on the function of genes related to salt stress resistance in Job's tears remains scarce, warranting further in-depth exploration. Identification of salt stress resistance genes in Job's tears will contribute to tolerance breeding and the sustainable production of Job's tears.

[0003] AP2 / EREBP are a class of transcription factors widely distributed in plants, playing important roles in plant growth, development, and responses to environmental stress. WRI1 is a plant-specific transcription factor, belonging to the AP2 subfamily within the AP2 / EREBP superfamily, and contains two highly conserved AP2 domains. Previous studies have shown that different transcription factors in plants exhibit varying degrees of environmental tolerance, and the WRI1 transcription factor in plants responds to different environmental stresses.

[0004] In conclusion, research on WRI1-related genes involved in the stress resistance of Coix lacryma-jobi helps to understand the stress resistance of Coix lacryma-jobi, lays a good foundation for subsequent genetic breeding to construct Coix lacryma-jobi with superior traits, and thus has important practical significance and application prospects for increasing Coix lacryma-jobi biomass and promoting the economic prosperity and development of the Coix lacryma-jobi industry. Summary of the Invention

[0005] In view of the problems existing in the prior art, the purpose of this invention is to design and provide a technical solution for the coix seed salt stress resistance-related gene ClWRI1-20 and its application.

[0006] This invention is achieved through the following technical solution:

[0007] The first aspect of this invention provides a coix seed salt stress resistance-related gene ClWRI1-20, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] A second aspect of the present invention provides a protein encoded by the above-mentioned gene, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] The third aspect of this invention provides the application of the above-mentioned coix seed salt stress resistance-related gene ClWRI1-20 in regulating yeast salt stress resistance.

[0010] The fourth aspect of this invention provides an expression vector containing the coix seed salt stress resistance-related gene ClWRI1-20.

[0011] The fifth aspect of this invention provides yeast containing the coix seed salt stress resistance-related gene ClWRI1-20.

[0012] Furthermore, the application is to make yeast contain the gene ClWRI1-20 or to make yeast overexpress the gene ClWRI1-20.

[0013] Furthermore, the application involves constructing a yeast overexpression vector containing the gene ClWRI1-20, heterologously transforming it into INVSC1 yeast, and screening to obtain positive yeast strains, which are yeast strains with salt stress resistance.

[0014] Furthermore, the application specifically includes the following steps:

[0015] 1) Collect Job's tears seeds, extract RNA, reverse transcribe it into cDNA, clone the CDS sequence of ClWRI1-20, ligate it into the pYES2.0 vector for sequencing, and after confirmation, construct an overexpression vector and heterologously transform it into yeast;

[0016] 2) Positive screening of yeast heterologously transformed with the ClWRI1-20 gene was performed using Ura-deficient yeast culture plates and PCR technology. Positive yeast was obtained, and its activity and growth curve were statistically analyzed to verify that the yeast's salt stress resistance was increased, thus obtaining yeast with improved salt stress resistance.

[0017] The present invention has the following beneficial effects:

[0018] 1. This invention is the first to obtain the ClWRI1-20 gene and its encoded protein from Coix lacryma-jobi, and verifies its biological function in regulating yeast stress.

[0019] 2. This invention is the first to overexpress the coix seed gene ClWRI1-20 in yeast, and uses PCR to prove that the gene has been successfully integrated into the yeast genome, i.e., positive yeast.

[0020] 3. The present invention conducted phenotypic observation and cell viability statistics on transgenic yeast and blank yeast. The results showed that the survival rate of transgenic yeast under stress was higher than that of blank yeast, indicating that the overexpression of the ClWRI1-20 gene improved the resistance of transgenic yeast to stress. Attached Figure Description

[0021] Figure 1 Detection of positive yeast strain ClWRI1-20 transgenic yeast;

[0022] Figure 2 transgenic yeast activity on day 3 after overexpression;

[0023] Figure 3 Live images of transgenic yeast cells at 3, 6, 9, 12, and 24 hours after overexpression;

[0024] Figure 4 Colony survival curves under salt stress with different salt concentrations. Detailed Implementation

[0025] The present invention will be further described in detail below with reference to specific examples. These descriptions are for explanation purposes only and are not intended to limit the scope of the invention.

[0026] Example 1: Cloning of the Coix lacryma-jobi ClWRI1-20 gene

[0027] 1. Material preparation: The coix seeds were collected from the experimental field of the School of Life Sciences and Medicine, Zhejiang University of Science and Technology, Hangzhou, Zhejiang Province, and stored at -80℃ for subsequent experiments.

[0028] 2. RNA extraction

[0029] Referring to the Takara RNAiso plus reagent instructions, the specific steps are as follows:

[0030] (1) After sterilizing the mortar, tweezers and other utensils used in the experiment at high temperature, pre-cool them with liquid nitrogen. Take the coix seed sample stored at -80℃ into the mortar, add liquid nitrogen, and quickly grind it into powder.

[0031] (2) Take about 100 mg of sample powder into a 2 ml RNA-free centrifuge tube, add 1 ml RNAiso plus reagent, shake well to mix, let stand for 5 min, and then centrifuge the sample at 12000 g for 5 min at 4℃.

[0032] (3) Take 800 μl of the supernatant from step 2 into a 1.5 ml RNA-free centrifuge tube, add 200 μl of chloroform, shake vigorously to mix for 15 s, let stand for 5 min, and then centrifuge at 12000 g for 15 min at 4 °C.

[0033] (4) Take 400 μl of the supernatant from step 3 into a new 1.5 ml RNA-free centrifuge tube, add 400 μl of isopropanol pre-cooled at -20℃, mix by inverting, let stand for 10 min, and then centrifuge at 12000g for 10 min at 4℃.

[0034] (5) Discard the supernatant, add 1 ml of anhydrous ethanol to resuspend and wash the precipitate, and centrifuge at 7500g for 5 min at 4℃.

[0035] (6) Discard the supernatant, centrifuge at 7500g for 5 min at 4℃, remove the remaining alcohol from the centrifuge tube, air dry in a clean bench for 5 min, and then add 40 μl of RNA-free water to dissolve the precipitate.

[0036] 3. RNA reverse transcription

[0037] Following the guidelines of the PrimerScript RT reagent Kit with gDNA Eraser (Takara), all experimental consumables were RNA-free, and all reactions were performed on ice.

[0038] (1) Genomic DNA removal. All reagents were prepared on ice, centrifuged and mixed, and reacted at 42°C for 2 min.

[0039]

[0040] (2) RNA reverse transcription to cDNA. Add the following reaction mixture to the PCR tube in step one, mix thoroughly, centrifuge, react at 37°C for 15 min, react at 85°C for 5 s, and then cool on ice.

[0041]

[0042] (3) The cDNA obtained after reverse transcription can be diluted 10 times and used for gene cloning and quantitative PCR and other related experiments.

[0043] 4. Gene cloning

[0044] (1) The cDNA sequence of the ClWRI1-20 gene was extracted from the Coix lacryma-jobi database, and primers were designed. The sequences are as follows:

[0045] ClWRI1-20-cds-F: GGGAATATTAAGCTTGGTACCATGTGGGACCTGAAC GATTCAC (as shown in SEQ IDNO.3)

[0046] ClWRI1-20-cds-R: GCGGCCGTTACTAGTGGATCCCTAGGTTGGCCGGGC CAG (as shown in SEQ IDNO.4)

[0047] (2) PCR amplification

[0048] Using coix seed cDNA as a template, PCR amplification was performed using appropriate primers. The reaction program was: 95℃ for 5 min; 95℃ for 5 s, 62℃ for 30 s, 72℃ for 60 s, 30 cycles; 72℃ for 10 min. The amplification instrument was a CFX96. TM

[0049] The amplification system for a real-time PCR instrument is shown below:

[0050]

[0051] (3) Use 1% agarose gel electrophoresis to check whether the band size meets the expectations, and then proceed to the next step of rubber tapping and recycling verification.

[0052] (4) Gel extraction and purification: The gel extraction product was purified using the Gel Extraction Kit column DNA gel extraction kit from Guangzhou Omega Company.

[0053] (5) Connection reaction

[0054] Reference Hangzhou Qingke Biotechnology Co., Ltd. The Seamless Cloning Kit instruction manual outlines the connection system as follows:

[0055]

[0056] (6) Transformation of ligation products into competent E. coli DH5α cells

[0057] Referring to the instructions for transformation of E. coli competent cells DH5α by Shanghai Weidi Biotechnology Co., Ltd., the specific steps are as follows:

[0058] ① Freeze-thaw the purchased competent E. coli DH5α cells on ice, add 10 μl of ligation product, gently tap the bottom of the tube to mix, and let stand on ice for 30 min.

[0059] ② After 42℃ for 90s, let it stand on ice for 2min.

[0060] ③ Add 300 μl of antibiotic-free LB medium, and incubate at 220 rpm and 37°C for 1 h with shaking.

[0061] ④ Take about 100 μl of culture medium and spread it evenly on Luria-Bertani (LB) medium (containing ampicillin), and incubate at 37°C for 12 h.

[0062] ⑤ Select single colonies and place them in centrifuge tubes containing 1 ml of liquid culture medium with the corresponding antibiotic. Incubate at 37°C and 220 rpm for 4-5 hours until the bacterial culture becomes turbid. Then send the culture to Shanghai Sangon Biotech Co., Ltd. for sequencing. Select more than 3 single colonies for each sequence to reduce the impact of mispairing gene sequence confirmation during PCR.

[0063] The nucleotide sequence of the coix seed salt stress resistance-related gene ClWRI1-20, which was finally cloned, is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the coix seed salt stress resistance-related gene ClWRI1-20 is shown in SEQ ID NO.2.

[0064] Example 2: Application of ClWRI1-20 gene heterologous transformation of yeast to improve its salt tolerance

[0065] 1. Screening and cultivation of transgenic yeast

[0066] (1) Plasmid extraction: Plasmids were extracted using the FastPure Plasmid Mini Kit from Nanjing Novizan Pharmaceutical Co., Ltd.

[0067] (2) Plasmid transformation of competent yeast cells INVSC1

[0068] ① Insert the carrier DNA into a 95°C metal bath for 5 minutes or into a float in a 95°C water bath for 3 minutes. After heating, quickly insert it into ice.

[0069] ② Take 100 μl of INVSC1 competent cells thawed on ice, add 2-5 μg of pre-cooled target plasmid, 10 μl of pretreated carrier DNA, and 500 μl of PEG / LiAc, and mix by pipetting several times. Incubate at 30°C for 30 min (invert 6-8 times at 15 min to mix).

[0070] ③ Place the tube in a 42℃ water bath for 15 minutes (invert the tube 6-8 times every 5 minutes to mix it thoroughly).

[0071] ④ Centrifuge at 5000 rpm for 40 seconds, discard the supernatant, resuspend in 400 μl of ddH2O, centrifuge for 30 seconds, discard the supernatant, resuspend in 50 μl of ddH2O, spread all the mixture onto a plate (using SD-Ura solid plate for screening), invert the plate, and incubate at 27-30℃ for 48-96 h.

[0072] ⑤ Select single colonies and place them in a centrifuge tube containing 1 ml of liquid culture medium with the corresponding antibiotic. Incubate at 30°C and 220 rpm for 24 hours with shaking until the bacterial solution becomes turbid. Perform bacterial PCR identification and select positive colonies (such as...). Figure 1 ).

[0073] (3) Transgenic yeast culture

[0074] ① Take 5 μl of yeast culture solution and spot it onto a solid culture medium. Incubate the medium upside down for 3 days, observe its growth and take photos to record the results.

[0075] ② For further quantitative analysis, 1 ml of the above-treated OD was... 600The bacterial cell mass of 1 was resuspended in 1 ml of culture medium, and NaCl was added to SD-U liquid medium at final concentrations of 0 mM, 0.5 M, and 1 M, respectively. The cells were shaken for 3, 6, 9, 12, and 24 hours, and the OD values ​​were measured. 600 This is used to characterize the colony survival rate.

[0076] 2. Functional verification

[0077] (1) Phenotypic Statistics: Each transgenic yeast was diluted more than 3 times and spotted onto a plate, while a blank yeast was set up as a control. The yeast was incubated upside down at 30℃ for 3 days, and its growth was observed and photographed. The results showed that the control yeast and recombinant yeast exhibited similar growth under no stress. Under different concentrations of NaCl (0.5M, 1M) abiotic stress, pYES2-ClWRI1-20 showed stronger resistance compared to the control. Notably, the colony count of the recombinant yeast was higher than that of the control group (e.g., ...). Figure 2 ).

[0078] (2) Colony survival curve measurement: To more intuitively demonstrate the overexpression function of the ClWRI1 gene in yeast, the OD under different stress durations was further measured. 600 Values. Under no stress conditions, the control group and recombinant yeast showed similar OD values. 600 Value (e.g.) Figure 3 This is consistent with the results of spot plate analysis under different stress conditions. Under salt stress, the colony survival rate decreased with increasing salt concentration, and pYES2-ClWRI1-20 performed better than the control group (e.g., ...). Figure 4 ).

[0079] The above results indicate that the transgenic yeast exhibits significantly higher stress resistance than the blank yeast.

Claims

1. A gene related to salt stress resistance in Job's tears ClWRI1-20 Its characteristics are, The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The protein encoded by the gene as described in claim 1, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. A Job's tears salt stress resistance-related gene as described in claim 1 ClWRI1-20 Application in enhancing yeast's resistance to salt stress.

4. The application as described in claim 3, characterized in that, Overexpressing genes in yeast ClWRI1-20 .

5. The application as described in claim 3, characterized in that, Constructing a gene ClWRI1-20 The yeast overexpression vector was heterologously transformed into INVSC1 yeast, and positive yeast strains were obtained by screening, which are yeast strains with salt stress resistance.

6. The application as described in claim 3, characterized in that, Specifically, the steps include: 1) Collect Job's tears seeds, extract RNA, reverse transcribe it into cDNA, and clone it. ClWRI1-20 The CDS sequence was obtained, then ligated into the pYES2.0 vector and sequenced. After confirmation that it was correct, an overexpression vector was constructed and heterologously transformed into yeast. 2) Using Ura-deficient yeast culture plates and PCR technology to... ClWRI1-20 The yeast was transformed by gene heterologous transformation and positive screening was performed to obtain positive yeast. The activity and growth curve of the yeast were statistically analyzed to verify that the yeast's salt stress resistance was increased, and yeast with improved salt stress resistance was obtained.

7. An expression vector containing the gene as described in claim 1.

8. Yeast containing the gene as described in claim 1.

Citation Information

Patent Citations

  • Abiotic stress responsive polynucleotides and polypeptides

    EP1925672A1

  • Genetically modified plants comprising drought stress tolerance genes

    WO2017214502A1