Nucleic acid aptamer and detection kit for detecting Trichophyton rubrum and Microsporum canis

Abstract

The present invention discloses a nucleic acid aptamer and a detection kit for detecting Trichophyton rubrum and Microsporum canis, wherein the nucleic acid aptamer includes a nucleic acid aptamer Seq1-LR, and the nucleotide sequence of the nucleic acid aptamer Seq1-LR is a DNA fragment shown in SEQ ID NO.1. The detection kit is a kit comprising nucleic acid aptamers for detecting Trichophyton rubrum and Microsporum canis. The nucleic acid aptamer and the detection kit of the present invention can sensitively, simply, efficiently, specifically and broadly identify and detect Trichophyton rubrum and Microsporum canis, and the nucleic acid aptamer has the advantages of higher affinity and specificity than protein antibodies, no immunogenicity, chemical synthesis, small molecular weight, stability, easy storage and labeling. The nucleic acid aptamer provides a new idea and method for the detection of skin fungal infections, and is expected to achieve rapid and accurate detection of skin fungal infections in the original site clinically.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a nucleic acid aptamer and a detection kit, and in particular to a nucleic acid aptamer and a detection kit for detecting Trichophyton rubrum and Microsporum canis. Background Art

[0002] Aptamers are single-stranded oligonucleotides (single-stranded DNA or RNA) that specifically bind to target substances, obtained through systematic evolution of ligands by exponential enrichment (SELEX). Aptamers possess affinity and specificity comparable to antibodies, and offer several advantages over antibodies, including small molecular weight and lack of immunogenicity; ease of chemical synthesis and low cost; ease of modification, with the ability to modify and replace different sites; and stability and ease of storage. Aptamers target a wider range of molecules, including metal ions, amino acids, nucleic acids, peptides, and proteins, extending beyond single targets to complex targets such as intact viral particles and cells. Therefore, aptamers hold broad application prospects.

[0003] Trichophyton rubrum and Microsporum canis are two of the most common fungal infections in the skin. Clinical detection of fungal infections is primarily based on direct microscopy and fungal isolation and culture. These methods have drawbacks such as low positive detection rates and long culture cycles. Similar clinical symptoms between some species can easily lead to misdiagnosis. Therefore, developing novel detection technologies to assist in the clinical identification of skin pathogens and to provide timely and accurate broad-spectrum detection of fungal species in skin infections is crucial. This can better guide patients in medication use and improve efficiency and accuracy. Aptamers hold great promise for microbial detection, as they eliminate the need for large-scale fungal culture or DNA lysis, potentially enabling in situ, online detection. However, current aptamers for fungal detection often exhibit low affinity, with dissociation constants in the micromolar range. Therefore, the development of an aptamer that can sensitively, simply, efficiently, and broadly identify Trichophyton rubrum and Microsporum canis, while also detecting infection with either T. rubrum or M. canis, offers a novel approach to the detection of fungal infections. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the shortcomings of the existing technology and provide a nucleic acid aptamer and detection kit for detecting Trichophyton rubrum and Microsporum canis that can simultaneously and broadly detect Trichophyton rubrum and Microsporum canis, has higher affinity and specificity than protein antibodies, is stable and easy to store and label.

[0005] In order to solve the above technical problems, the present invention adopts the following technical solutions.

[0006] A nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis. The nucleic acid aptamer comprises a nucleic acid aptamer Seq1-LR, and the nucleotide sequence of the nucleic acid aptamer Seq1-LR is a DNA fragment shown in SEQ ID NO.1.

[0007] The nucleotide sequence of the nucleic acid aptamer Seq1-LR is:

[0008] 5'-ATCATTGCCACTGACTACCCCGCCGGTTCACTTTAGCTGGAGGCCACTCGTCT CCCCTG-3'

[0009] The above-mentioned nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis, preferably, the nucleic acid aptamer also includes a nucleic acid aptamer in which a certain position on the nucleotide sequence of the nucleic acid aptamer Seq1-LR is methylated, aminoated, phosphorylated, sulfhydrylated or isotopized, under the premise that the overall structure of the nucleic acid aptamer Seq1-LR remains unchanged.

[0010] For the aforementioned nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis, preferably, the amination is to label the 5' end of the nucleotide sequence of the nucleic acid aptamer Seq1-LR with an amino group -NH2.

[0011] For the aforementioned nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis, preferably, the thiolation is to label the 5' end of the nucleotide sequence of the nucleic acid aptamer Seq1-LR with a thiol group -SH.

[0012] The above-mentioned nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis, preferably, the nucleic acid aptamer also includes a nucleic acid aptamer labeled with biotin, fluorescent substance, digoxin, nanoluminescent material or enzyme (even connected to radioactive and therapeutic substances, etc.) on the nucleotide sequence of the nucleic acid aptamer Seq1-LR.

[0013] In the above-mentioned nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis, preferably, the fluorescent substance is a Cy5 fluorescent group or a FAM fluorescent group; the nanoluminescent material is quantum dots or upconversion nanoparticles; and the enzyme marker is horseradish peroxidase or sucrase.

[0014] The above-mentioned nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis, preferably, the nucleotide sequence of the nucleic acid aptamer includes any one of the following three sequences:

[0015] (1) having a nucleotide sequence homology of more than 60% with the nucleic acid aptamer Seq1-LR and having the function of detecting Trichophyton rubrum and Microsporum canis;

[0016] (2) a sequence that hybridizes with the nucleotide sequence of the nucleic acid aptamer Seq1-LR;

[0017] (3) The RNA sequence transcribed from the nucleotide sequence of the nucleic acid aptamer Seq1-LR.

[0018] The above-mentioned nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis preferably further includes a derivative of the nucleic acid aptamer Seq1-LR, and the derivative is a phosphorothioate backbone derived from the backbone of the nucleotide sequence of the nucleic acid aptamer Seq1-LR.

[0019] The above-mentioned nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis preferably further includes a derivative of the nucleic acid aptamer Seq1-LR, and the derivative is a corresponding peptide nucleic acid modified from the nucleic acid aptamer Seq1-LR.

[0020] As a general technical concept, the present invention also provides a detection kit for detecting Trichophyton rubrum and Microsporum canis, comprising the aforementioned nucleic acid aptamer. Specifically, the aforementioned nucleic acid aptamer is used to identify Trichophyton rubrum and Microsporum canis, or to prepare a detection kit for detecting Trichophyton rubrum and Microsporum canis.

[0021] Compared with the prior art, the advantages of the present invention are:

[0022] (1) The present invention provides a nucleic acid aptamer Seq1-LR for identifying or detecting Trichophyton rubrum and Microsporum canis, the sequence of which is a DNA fragment shown in SEQ ID NO. 1. Compared with protein antibodies, this nucleic acid aptamer has better affinity and specificity, low immunogenicity, can be chemically synthesized in vitro, has a small molecular weight, can be modified and substituted at different sites, and has stable chemical properties, is easy to store, and is convenient for labeling. It fills the current gap in the lack of broad-spectrum nucleic acid aptamers for detection of Trichophyton rubrum and Microsporum canis, can simultaneously identify Trichophyton rubrum and Microsporum canis, improve the efficiency and accuracy of single detection of bacterial species, and is expected to achieve simultaneous detection of common skin infection fungi, providing a new idea and method for rapid and accurate in situ detection of skin fungi in clinical practice, and assisting doctors in correctly using drugs for infectious bacterial species.

[0023] (2) The nucleic acid aptamers of the present invention can be various similar sequences with high homology or derivatives obtained from the sequences of the present invention. The screening method for the nucleic acid aptamers is to first synthesize a random single-stranded DNA library and primers, then screen through SELEX, amplify the library by PCR, prepare DNA single strands as the next round of screening library, and obtain nucleic acid aptamers through repeated screening, negative screening, and multiple rounds of screening. The nucleic acid aptamers and their derivatives of the present invention can be used in identifying Trichophyton rubrum and Microsporum canis or in preparing kits for detecting Trichophyton rubrum and Microsporum canis.

[0024] (3) The present invention provides a detection kit containing a nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis. Since the synthesis cost of nucleic acid aptamers is lower than that of antibody preparation, and the cycle is short and the reproducibility is good, the operation is simpler and faster when the nucleic acid aptamer of the present invention is used to detect Trichophyton rubrum and Microsporum canis. The nucleic acid aptamer of the present invention that can identify Trichophyton rubrum and Microsporum canis has a strong binding ability, and the dissociation constant is within the nanomolar range. The nucleic acid aptamer of the present invention is used to fish out the target molecule to which it binds, and its molecular marker can be obtained. This is of great significance for the rapid detection of common fungal infections of the skin, and has good application prospects in the clinical detection of common fungal infections of the skin. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a schematic diagram of the structure obtained by performing secondary structure simulation on the nucleic acid aptamer Seq1-LR sequence using the Mfold service in Example 1 of the present invention.

[0026] Figure 2 This is a flow cytometric characterization diagram of the binding effect of the nucleic acid aptamers Cy5-Seq1-LR and Cy5-Random on Trichophyton rubrum in Example 1 of the present invention.

[0027] Figure 3 A curve graph is drawn for the dissociation constant of the nucleic acid aptamer Cy5-Seq1-LR and Trichophyton rubrum determined by flow cytometry in Example 1 of the present invention.

[0028] Figure 4 This is a laser confocal microscopy characterization of the binding effect of the nucleic acid aptamers Cy5-Seq1-LR and Cy5-Random on Microsporum canis in Example 1 of the present invention.

[0029] Figure 5 A graph is drawn for the dissociation constant between the nucleic acid aptamer Cy5-Seq1-LR and Microsporum canis measured using a laser confocal scanning microscope in Example 1 of the present invention.

[0030] Figure 6This is a flow cytometry characterization diagram of the binding effect of the nucleic acid aptamers Cy5-Seq1-LR and Cy5-Random on the interfering strains red yeast and Malassezia in Example 1 of the present invention. DETAILED DESCRIPTION

[0031] The present invention is further described below with reference to the accompanying drawings and specific preferred embodiments, but the scope of protection of the present invention is not limited thereby. The materials and instruments used in the following examples are all commercially available, wherein Trichophyton rubrum was provided by the Department of Dermatology of Xiangya Second Hospital, Central South University, and Microsporum canis was purchased from Beijing Beina Chuanglian Biotechnology Research Institute, but the present invention is not limited thereto.

[0032] Example 1

[0033] A nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis, the nucleic acid aptamer being nucleic acid aptamer Seq1-LR. The nucleotide sequence of nucleic acid aptamer Seq1-LR is the DNA fragment shown in SEQ ID NO.1, specifically as follows:

[0034] 5'-ATCATTGCCACTGACTACCCCGCCGGTTCACTTTAGCTGGAGGCCACTCGTCT CCCCTG-3'

[0035] The screening method of the nucleic acid aptamer Seq1-LR comprises the following steps:

[0036] (1) Synthesize the random single-stranded DNA library and primers shown in the following sequence

[0037] Random DNA single-strand library: 5'-ATCCATTGCCACTGACTACC-N40-GAAGTCAGTCGGTCGTT AGT-3'

[0038] Forward primer: 5'-Cy5-ATCCATTGCCACTGACTACC-3'

[0039] Reverse primer: 5'-Biotin-ACTAACGACCGACTGACTTC-3'

[0040] Where N represents any base among A, T, G, and C.

[0041] (2) Screening of broad-spectrum nucleic acid aptamers for Trichophyton rubrum and Microsporum canis using SELEX technology

[0042] (2.1) Strain pretreatment: Take a bacterial suspension that has been cultured on a shaker at 28°C and 180 rpm for approximately 18 h. After removing the culture medium, wash three times with wash buffer (1.2370 g glucose, 0.2540 g MgCl2·H2O dissolved in 250 mL PBS buffer, sterilized by filtration through a 0.22 μM filter). Resuspend in binding buffer (1.2370 g glucose, 0.2540 g MgCl2·H2O, 0.2500 g BS A, 0.0250 g yeast tRNA dissolved in 250 mL PBS buffer, sterilized by filtration through a 0.22 μM filter) and adjust the OD 600 =1.0 for subsequent experiments.

[0043] (2.2) Library pretreatment: The synthesized random single-stranded DNA library was centrifuged at 12,000 rpm for 5 min, and binding buffer was added to prepare a 100 μM stock solution. The stock solution was heated at 95°C for 8 min to destroy the secondary structure of the random library. The library was then immediately transferred to an ice bath for 30 min. A portion was added to the precooled binding buffer to dilute the concentration to 10 μM to obtain the pretreated library solution.

[0044] (2.3) Positive Screening: For the first three rounds, the pretreated library was added to a 1:1 mixture of Trichophyton rubrum and Microsporum canis. The library was incubated on a 37°C shaker to pre-enrich the library, and manually shaken every 10 minutes. After the third round, the library was incubated with Trichophyton rubrum and Microsporum canis solutions sequentially to improve screening specificity. After incubation, the supernatant was discarded and the cells were washed three times with wash buffer for 30 seconds each to elute nonspecifically bound and weakly bound ssDNA.

[0045] (2.4) Counter-screening: Starting from the fourth round, counter-screening was added. The library obtained in the previous round was first incubated with red yeast and Malassezia, and the DNA library that did not bind to them, i.e., the supernatant, was collected and added to Trichophyton rubrum and Microsporum canis for positive screening.

[0046] (2.5) Collection of the library after incubation: Resuspend the centrifuged product from the positive screening step in 500 μL of sterile water, heat denature in a 95°C water bath, and then quickly transfer to ice to cool to release the ssDNA bound to the target. Subsequently, centrifuge at 12,000 rpm for 5 minutes and collect the supernatant, which is the ssDNA solution containing the target sequence.

[0047] (2.6) PCR Amplification: 100 μL of the ssDNA solution obtained in the above step was subjected to PCR amplification to obtain the amplified product. Amplification conditions were: 94°C for 3 min, 94°C for 30 sec, 63.7°C for 30 sec, 72°C for 30 sec, after an appropriate number of cycles (the number of PCR amplification cycles in each screening round must be optimized to ensure sufficient PCR amplification product for the next round of screening while preventing nonspecific amplification), and 72°C for 3 min.

[0048] (2.7) Preparation of ssDNA library: The amplified product was incubated with streptavidin-modified agarose microbeads at room temperature for 30 minutes. The double-stranded DNA of the amplified product labeled with biotin was captured on the surface of the streptavidin-modified agarose microbeads by the specific binding ability between biotin and streptavidin, resulting in agarose microspheres modified with the amplified product. The agarose microspheres modified with the amplified product were then centrifuged at 5000 rpm to discard the supernatant and washed twice with PBS solution. The washed precipitate was added with 500 μL of 200 mM NaOH solution and reacted at room temperature for 15 minutes. The supernatant was then collected by centrifugation and transferred to an EP tube. The desalting column was washed with 10 mL of sterile water, and the supernatant in the EP tube was added. After the supernatant naturally dripped away, 1 mL of sterile water was added to the desalting column. The dripping liquid was collected at this time, which was the aqueous solution of the single-stranded DNA library. The UV absorption curve of the single-stranded DNA library solution was measured using a UV spectrophotometer, and the ssDNA was quantified based on its absorbance at 260 nm. The single-stranded DNA library solution was then placed in a freeze-concentrated centrifugal dryer and dried at 68°C for 2.5 hours. The dried ssDNA powder was finally stored at -20°C and used as the next round of screening library.

[0049] (2.8) Cyclic Screening: Repeat the above screening steps (starting with the fourth round of screening, each round of screening begins with a reverse screening followed by a forward screening) for multiple rounds until the binding affinity of the resulting DNA library to Trichophyton rubrum and Microsporum canis reaches saturation, at which point the screening is terminated. The purpose of applying different screening pressures in different rounds of screening is to increase the specificity and affinity of the screening sequence. The resulting library was sequenced and analyzed, ultimately yielding the nucleic acid aptamer Seq1 for detecting Trichophyton rubrum and Microsporum canis.

[0050] (2.9) Sequence Optimization: By tailoring the primers before and after Seq1 and the hairpin structures at different positions, a sequence Seq1-LR was obtained that has a higher affinity for Trichophyton rubrum and Microsporum canis. The nucleotide sequence of the aptamer Seq1-LR is the DNA fragment shown in SEQ ID NO. 1. The 5' end of the aptamer Seq1-LR was labeled with Cy5, and the aptamer Cy5-Seq1-LR is represented by the following DNA fragment:

[0051] 5'-Cy5-ATCATTGCCACTGACTACCCCGCCGGTTCACTTTAGCTGGAGGCCACTCGTCTCCCCTG-3'.

[0052] In the present invention, the nucleotide sequence of the nucleic acid aptamer Seq1-LR is combined with biotin, digoxigenin, a fluorescent substance, a nanoluminescent material or an enzyme label, which can achieve the same or similar technical effects as Example 1.

[0053] Comparative Example 1

[0054] Negative probe, whose nucleotide sequence is:

[0055] Cy5-Random:

[0056] 5'-Cy5-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNN-3'

[0057] N represents any base among A, T, G, and C.

[0058] Investigation 1: Use the Mfold service to perform secondary structure simulation on the nucleic acid aptamer sequence of this example.

[0059] The schematic diagram of the structure after the secondary structure simulation of the nucleic acid aptamer sequence of this embodiment using the Mfold service is shown in the following figure: Figure 1 As shown, the Seq1-LR sequence structure mainly includes a large loop structure and two hairpin regions.

[0060] Investigation 2: Flow cytometry was used to detect the binding effect of nucleic acid aptamers Cy5-Seq1-LR and Cy5-Random on Trichophyton rubrum.

[0061] The synthesized Cy5-Seq1-LR sequence and the random sequence Cy5-Random were centrifuged at 12,000 rpm for 5 minutes and buffer was added to a 10 μM solution. 4 μL of the 10 μM DNA sequence was dissolved in 196 μL of binding buffer and 500 μL of the prepared Trichophyton rubrum suspension was added to a final volume of 700 μL. The suspension was incubated at 37°C for 45 minutes. After incubation, the suspension was centrifuged at 6,000 rpm at 4°C for 5 minutes, and the supernatant was discarded. The suspension was washed with 500 μL of wash buffer and centrifuged again, and the supernatant was discarded. Finally, 200 μL of binding buffer was added to resuspend the suspension. Binding of the DNA sequence to Trichophyton rubrum was analyzed by flow cytometry.

[0062] from Figure 2The detection results showed that the nucleic acid aptamer Cy5-Seq1-LR can bind to Trichophyton rubrum, and its binding strength is significantly higher than that of Cy5-Random.

[0063] Investigation 3: Flow cytometry was used to determine the dissociation constant between the nucleic acid aptamer Cy5-Seq1-LR and Trichophyton rubrum.

[0064] Probe solutions of nucleic acid aptamers Cy5-Seq1-LR with different concentrations (0-500nM) were prepared in parallel. Trichophyton rubrum grown to the logarithmic growth phase was resuspended in binding buffer, and the treated ssDNA of different concentrations was incubated with Trichophyton rubrum at 37°C for 45 minutes. After washing with washing buffer, 200μL binding buffer was added and resuspended, and the signal was collected by flow cytometry. Three parallel samples were set for each concentration in the experiment, and the signal of FL6 channel was collected. Using Origin software, the values ​​of nucleic acid aptamer concentration and average fluorescence intensity were substituted into the single-point adsorption model and the dissociation constant Kd value of the nucleic acid aptamer was simulated by Y=Bmax×X / (Kd+X). The dissociation constant curve is shown in the figure below. Figure 3 As shown, y = 6652.5509x / (68.3441+x), from which the dissociation constant Kd can be obtained as shown in the following Table 1.

[0065] Table 1 Dissociation constant results

[0066] sequence name Kd(nM) Seq1-LR 68.3±12.1

[0067] Figure 3 The test results in Table 1 show that the nucleic acid aptamer Seq1-LR of this embodiment has a strong binding ability to Trichophyton rubrum, with a dissociation constant at the nanomolar level, which is better than the micromolar dissociation constant of nucleic acid aptamers for most fungi and has a higher affinity.

[0068] Investigation 4: Laser confocal scanning microscopy was used to detect the binding effect of nucleic acid aptamers Cy5-Seq1-LR and Cy5-Random on Microsporum canis.

[0069] The synthesized Cy5-Seq1-LR sequence and the random sequence Cy5-Random were centrifuged at 12,000 rpm for 5 minutes and buffer was added to a 10 μM solution. 4 μL of the 10 μM DNA sequence was dissolved in 196 μL of binding buffer and 500 μL of the prepared M. canis suspension was added to a final volume of 700 μL. The suspension was then incubated at 37°C for 45 minutes. After incubation, the suspension was centrifuged at 6,000 rpm at 4°C for 5 minutes, the supernatant discarded, and the suspension was washed with 500 μL of wash buffer, centrifuged again, and the supernatant discarded. Finally, 200 μL of binding buffer was added to the suspension and resuspended. The suspension was added to a confocal laser microscope. A 633 nm laser was used for excitation, and Cy5 fluorescence above 660 nm was collected for imaging using a confocal laser microscope to analyze the binding of the DNA sequence to M. canis.

[0070] from Figure 4 The detection results showed that the nucleic acid aptamer Cy5-Seq1-LR can bind to Microsporum canis, and its binding strength was significantly higher than that of Cy5-Random.

[0071] Investigation 5: The dissociation constant of the nucleic acid aptamer Cy5-Seq1-LR and Microsporum canis was determined by laser confocal scanning microscopy.

[0072] Different concentrations (0-500nM) of nucleic acid aptamer Cy5-Seq1-LR probe solutions were prepared in parallel. Microsporum canis grown to the logarithmic growth phase was resuspended in binding buffer, and the treated ssDNA of different concentrations was incubated with Microsporum canis at 37°C for 45 minutes. After washing with washing buffer, 200μL binding buffer was added for resuspending, and the signal was collected using a laser confocal scanning microscope. Three parallel samples were set up for each concentration in the experiment, and the signal of the FL6 channel was collected. Using Origin software, the values ​​of nucleic acid aptamer concentration and average fluorescence intensity were substituted into the single-point adsorption model and the dissociation constant Kd value of the nucleic acid aptamer was simulated by Y=Bmax×X / (Kd+X). The dissociation constant curve is shown in the figure below. Figure 5 As shown, y = 10836.9837x / (82.3295+x), from which the dissociation constant Kd can be obtained as shown in the following Table 2.

[0073] Table 2 Dissociation constant results

[0074] sequence name Kd(nM) Seq1-LR 82.3±44.0

[0075] Figure 5 The detection results in Table 2 show that the nucleic acid aptamer Seq1-LR of this embodiment has a strong binding ability to Microsporum canis, and the dissociation constant is at the nanomolar level.

[0076] Investigation 6: Flow cytometry was used to detect the binding effect of nucleic acid aptamers Cy5-Seq1-LR and Cy5-Random on the interfering strains red yeast and Malassezia.

[0077] The synthesized Cy5-Seq1-LR sequence and the random sequence Cy5-Random were centrifuged at 12,000 rpm for 5 minutes and buffer was added to a 10 μM solution. 4 μL and 10 μM of the DNA sequence were dissolved in 196 μL of binding buffer. 500 μL of the prepared red yeast and Malassezia cultures, respectively, were added to a final volume of 700 μL. The mixture was incubated at 37°C for 45 minutes. After incubation, the solution was centrifuged at 6,000 rpm at 4°C for 5 minutes, and the supernatant was discarded. The solution was washed with 500 μL of wash buffer and centrifuged again, and the supernatant was discarded. Finally, the solution was resuspended in 200 μL of binding buffer. The binding of the DNA sequence to red yeast and Malassezia was analyzed by flow cytometry.

[0078] from Figure 6 The detection results showed that the nucleic acid aptamer Cy5-Seq1-LR could not bind to the interfering strains red yeast and Malassezia.

[0079] From the above content, it can be seen that the nucleic acid aptamer Seq1-LR of the present invention can achieve broad-spectrum detection of Trichophyton rubrum and Microsporum canis, improve the efficiency and accuracy of detecting single bacterial species one by one, and has good affinity and specificity.

[0080] The nucleic acid aptamer Seq1-LR of this embodiment can be used to prepare a detection kit to obtain a detection kit containing the nucleic acid aptamer Seq1-LR. The detection kit can be used to detect Trichophyton rubrum and Microsporum canis.

[0081] The above description is only a preferred embodiment of the present invention and does not constitute any formal limitation to the present invention. Although the present invention has been disclosed as above in terms of a preferred embodiment, it is not intended to limit the present invention. Any person skilled in the art can, without departing from the spirit and technical solution of the present invention, use the methods and technical contents disclosed above to make many possible changes and modifications to the technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention, still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis, characterized in that: The nucleic acid aptamer includes the nucleic acid aptamer Seq1-LR, and the nucleotide sequence of the nucleic acid aptamer Seq1-LR is the DNA fragment shown in SEQ ID NO.

1.

2. The nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis according to claim 1, characterized in that The nucleic acid aptamer also includes a nucleic acid aptamer in which a certain position on the nucleotide sequence of the nucleic acid aptamer Seq1-LR is methylated, aminated, phosphorylated, sulfhydrylated or isotopized, under the premise that the overall structure of the nucleic acid aptamer Seq1-LR remains unchanged.

3. The nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis according to claim 2, characterized in that The amination is to label the 5' end of the nucleotide sequence of the nucleic acid aptamer Seq1-LR with an amino group -NH2.

4. The nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis according to claim 2, characterized in that The thiolation is to label the 5' end of the nucleotide sequence of the nucleic acid aptamer Seq1-LR with a thiol group -SH.

5. The nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis according to claim 1, characterized in that The nucleic acid aptamer also includes a nucleic acid aptamer that is bound to biotin, a fluorescent substance, digoxigenin, a nanoluminescent material or an enzyme label on the nucleotide sequence of the nucleic acid aptamer Seq1-LR.

6. The nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis according to claim 5, characterized in that The fluorescent substance is a Cy5 fluorescent group or a FAM fluorescent group; the nano luminescent material is a quantum dot or an up-conversion nanoparticle; and the enzyme marker is horseradish peroxidase or sucrase.

7. The nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis according to any one of claims 1 to 6, characterized in that: Also included are derivatives of the nucleic acid aptamer Seq1-LR, wherein the derivatives are phosphorothioate backbones derived from the backbone of the nucleotide sequence of the nucleic acid aptamer Seq1-LR.

8. The nucleic acid aptamer for detecting Trichophyton rubrum and Microsporum canis according to any one of claims 1 to 6, characterized in that: Also included are derivatives of the nucleic acid aptamer Seq1-LR, which are corresponding peptide nucleic acids transformed from the nucleic acid aptamer Seq1-LR.

9. A detection kit for detecting Trichophyton rubrum and Microsporum canis, characterized in that: The invention comprises the nucleic acid aptamer according to any one of claims 1 to 8.

Images