A hairpin probe for detecting DNA polymerase exonuclease activity and preparation method and application thereof

Abstract

The application discloses a hairpin probe for detecting DNA polymerase exonuclease activity and a preparation method and application thereof. The hairpin probe comprises a region a, a region b, a region c, a region d, a region e, a region f and a region g from the 5' end in sequence, wherein the region a and the region c are reversely complementary to each other, the 5' end of the region a is marked with a first fluorescent group, and the 3' end of the region a is marked with a first quenching group; the region e and the region g are reversely complementary to each other, the 5' end of the region g is marked with a second quenching group, and the 3' end of the region g is marked with a second fluorescent group; the first fluorescent group and the second fluorescent group are different from each other. The hairpin probe can be used for detecting the 3'-5' and 5'-3' exonuclease activity of the DNA polymerase separately or simultaneously in a single system, and has the advantages of simple operation steps, high throughput, good specificity, avoidance of radioactive pollution and excellent application prospect.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a hairpin probe for detecting DNA polymerase exonuclease activity, its preparation method, and its application. Background Technology

[0002] PCR technology, as a rapid, efficient, and specific DNA amplification technique, has been widely used in scientific research and medical diagnostics, becoming an important tool in contemporary molecular biology and medicine. As the core of the PCR reaction, DNA polymerases face increasingly stringent requirements regarding fidelity, stability, specificity, and sensitivity. Currently used DNA polymerases for PCR amplification, such as Taq DNA polymerase and KOD DNA polymerase, possess both 3'-5' and 5'-3' exonuclease activities in addition to their DNA polymerase activity. This exonuclease activity may lead to mismatched probes or primer digestion before the PCR reaction, resulting in nonspecific signals or poor amplification efficiency. Therefore, rapidly screening monoclonal antibodies with blocking exonuclease activity and DNA polymerases with exonuclease-blocking antibodies have become major research focuses.

[0003] Among related technologies, a relatively mature system exists for detecting DNA polymerase activity, but there are fewer methods for detecting its exonuclease activity. These mainly include the radioisotope method and the method using mismatched primers (see CN 104293930A). The radioisotope method involves first synthesizing a single-stranded oligonucleotide with the radioactive isotope dATP at the end, then using the exonuclease activity to cleave it, and finally performing TCA precipitation and filtration. The exonuclease activity is calculated by measuring the radioactivity content in the acid-soluble substance. Although this detection method has good accuracy, it is time-consuming, prone to contamination, and difficult to achieve high throughput and automation. Therefore, it cannot meet the requirements for rapid high-throughput screening of exonuclease activity blocking antibodies. The mismatch primer inference method first synthesizes mismatched primers based on a single-stranded template, mixes the primers with the single-stranded template and anneals them, then adds exonuclease activity to the reaction solution to perform end exonucleation, and then adds sufficient polymerase without the exonuclease activity to extend the primers until double-stranded DNA is obtained. Subsequently, the relative amount of double-stranded DNA in the reaction system is detected, and the exonuclease activity level is deduced from the detection results. This method requires PCR amplification and indirectly infers the exonuclease activity level from the relative amount of double-stranded DNA, so its accuracy is relatively low. In addition, this method can only detect the exonuclease activity at one end (such as 3'-5' or 5'-3') in a single detection.

[0004] Therefore, there is an urgent need to find a detection method that is simple and quick to operate, highly sensitive and accurate, and can simultaneously detect 3'-5' exonuclease activity and 5'-3' exonuclease activity. Summary of the Invention

[0005] This invention aims to at least solve one of the technical problems existing in the prior art. To this end, this invention proposes a hairpin probe for detecting exonuclease activity. This hairpin probe is ingeniously designed with two stem-loop structures, and different fluorescent groups are designed at its 3' and 5' ends, respectively. Using this hairpin probe, the activity of 3'-5' and / or 5'-3' exonucleases can be detected in a single reaction system.

[0006] The present invention also proposes a method for preparing the hairpin probe described above for detecting exonuclease activity.

[0007] The present invention also proposes the application of the hairpin probe described above for detecting exonuclease activity in screening or identifying DNA polymerases with exonuclease activity, detecting DNA polymerase exonuclease activity, screening antibodies with exonuclease blocking function, and preparing exonuclease activity detection reagents or kits.

[0008] This invention also proposes a method for detecting exonuclease activity.

[0009] A first aspect of the present invention provides a hairpin probe for detecting exonuclease activity, wherein the hairpin probe comprises, starting from the 5' end, regions a, b, c, d, e, f, and g, in sequence, wherein:

[0010] The a region and the c region are in reverse complementary pairing. The 5' end of the a region is labeled with a first fluorescent group, and the 3' end of the a region is labeled with a first quenching group.

[0011] The e region and the g region are in reverse complementary pairing, the 5' end of the g region is labeled with a second quenching group, and the 3' end of the g region is labeled with a second fluorescent group;

[0012] The first fluorescent group and the second fluorescent group are different from each other.

[0013] The hairpin probe according to embodiments of the present invention has at least the following beneficial effects:

[0014] The hairpin probe of this invention is ingeniously designed with two stem-loop structures, each with a different fluorescent group at its 3' and 5' ends, enabling simultaneous detection of 3'-5' and / or 5'-3' exonuclease activities in a single reaction system. Furthermore, when combined with a multi-channel real-time fluorescence instrument, the hairpin probe of this invention allows for rapid and high-throughput analysis of low levels of exonuclease activity in samples, simplifying operation and helping to reduce detection costs.

[0015] In some embodiments of the present invention, the nucleotide length of the a region is 10 nt to 16 nt.

[0016] Setting an appropriate nucleotide length in region a helps improve fluorescence quenching, reduce detection background, and also improve DNA polymerase binding efficiency, thereby increasing detection sensitivity.

[0017] In some embodiments of the present invention, the nucleotide length of the c region is 10 nt to 16 nt.

[0018] In some embodiments of the present invention, the nucleotide length of region a is the same as that of region c.

[0019] In some embodiments of the present invention, the nucleotide length of the e region is 10 nt to 16 nt.

[0020] In some embodiments of the present invention, the nucleotide length of the g region is 10 nt to 16 nt.

[0021] In some embodiments of the present invention, the nucleotide length of the e region is the same as the nucleotide length of the g region.

[0022] In some embodiments of the present invention, region b connects region a and region c to form a ring.

[0023] In some embodiments of the present invention, the f region connects the e region and the g region to form a loop.

[0024] In some embodiments of the present invention, the lengths of region b and region f are independently 10 nt to 16 nt.

[0025] In some embodiments of the present invention, the first fluorescent group and / or the second fluorescent group are selected from any one of FAM, HEX, TRAMA, VIC, CY5 or JOE.

[0026] In some embodiments of the present invention, the first quenching group may be the same as or different from the second quenching group.

[0027] In some embodiments of the present invention, the first quenching group and the second quenching group are independently selected from any one of BHQ1, BHQ2, TAMRA, and MGB.

[0028] In some embodiments of the present invention, the nucleotide sequence of the hairpin probe is shown in SEQ ID NO:8, wherein:

[0029] The first fluorescent group is modified at the first base, and the first quenching group is modified at the 13th base;

[0030] The second fluorescent group is modified at the 99th base, and the second quenching group is modified at the 86th base.

[0031] In some embodiments of the present invention, the sequence information of the hairpin probe is as follows:

[0032] 5'-(VIC)TACTACTGGGAAT(BHQ1)AAGTTAAGACCTATGATTCCCAGTAGTAGAGACGGGGGAGACGACTACGGGGGTACAGTATCCAGAATTGAA(BHQ1)TGTACCCCCGTAGT(FAM)-3' (SEQ ID NO:8).

[0033] A second aspect of the present invention provides a method for preparing a hairpin probe for detecting exonuclease activity as described in any one of the first aspects, comprising:

[0034] The nucleotide sequence of the hairpin probe is obtained and the corresponding oligonucleotide single strand containing the first fluorescent group, the first quenching group, the second fluorescent group and the second quenching group is synthesized. Then, the result is obtained after annealing and cooling.

[0035] The preparation method according to the embodiments of the present invention has at least the following beneficial effects: the probe preparation method of the present invention is simple, and only temperature control is required to form a stable hairpin structure through self-hybridization.

[0036] In some embodiments of the present invention, the annealing reaction system comprises 8-12 mM Tris-HCl, 40-60 mM NaCl and 0.8-1.2 mM DTT.

[0037] In some embodiments of the present invention, the annealing reaction system comprises 10 mM Tris-HCl, 50 mM NaCl and 1.0 mM DTT.

[0038] In some embodiments of the present invention, the pH value of the annealing reaction system is 7.5 to 8.5. Preferably, the pH value of the annealing reaction system is 7.8 to 8.2.

[0039] In some embodiments of the present invention, the annealing temperature is 90~98°C.

[0040] In some preferred embodiments of the present invention, the annealing temperature is 94~96°C.

[0041] In some embodiments of the present invention, the cooling rate is 2~5°C / min.

[0042] A third aspect of the invention provides the use of the hairpin probe for detecting exonuclease activity as described in any one of the first aspects in any one of A) to D):

[0043] A) Screening or identifying DNA polymerases with exonuclease activity;

[0044] B) Detect DNA polymerase exonuclease activity;

[0045] C) Screening for antibodies that block exonuclease activity;

[0046] D) Prepare exonuclease activity detection reagents or kits.

[0047] A fourth aspect of the present invention provides a method for detecting exonuclease activity, comprising: contacting a hairpin probe for detecting exonuclease activity as described in any one of the first aspects with the enzyme to be detected, performing a hydrolysis reaction, and then performing fluorescence quantitative or qualitative analysis.

[0048] The method according to embodiments of the present invention has at least the following beneficial effects: the exonuclease detection method of the present invention is simple, and the detection of 3'-5' and / or 5'-3' exonuclease activity can be achieved in a single reaction system in only one step.

[0049] It is understood that the hydrolysis reaction refers to the process of sequentially hydrolyzing phosphodiester bonds from the ends of nucleic acid molecular chains to generate mononucleotides.

[0050] In some embodiments of the present invention, the hydrolysis reaction system includes 20-40 mmol / L Tris-HCl and 100-120 mmol / L K + 5~8 mmol / L Mg 2+ 50-80 μg / mL BSA, 300-500 μmol / L dNTPs. For example, the hydrolysis reaction system may include 25 mmol / L Tris-HCl, 100 mmol / L K +5 mmol / L Mg 2+ , 50ug / mL BSA, 300 μmol / L dNTPs.

[0051] In some embodiments of the present invention, the pH of the hydrolysis reaction system is 7.2 to 9.2.

[0052] In some embodiments of the present invention, the enzyme to be detected includes, but is not limited to, enzymes with exonuclease activity such as DNA polymerase and exonuclease.

[0053] In some preferred embodiments of the present invention, the DNA polymerase includes Taq DNA polymerase and high-fidelity DNA polymerase.

[0054] Other features and advantages of the present invention will be set forth in the following description. Attached Figure Description

[0055] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0056] Figure 1 This is a schematic diagram of the hairpin probe structure of the present invention for detecting the activity of 3' and / or 5' exonucleases;

[0057] Figure 2 This is a schematic diagram of the hairpin probe structure used in this invention for detecting 5' exonuclease activity;

[0058] Figure 3 This is a schematic diagram of the hairpin probe structure used in this invention for detecting 3' exonuclease activity;

[0059] Figure 4 The fluorescence detection results of the hairpin probe Probe 1 of this invention for detecting Taq DNA polymerase alone are shown, where blue corresponds to 5'-3' exonuclease activity and red corresponds to 3'-5' exonuclease activity.

[0060] Figure 5 The fluorescence detection results of the hairpin probe Probe 1 of this invention for detecting HF DNA polymerase alone are shown, where blue corresponds to 5'-3' exonuclease activity and red corresponds to 3'-5' exonuclease activity.

[0061] Figure 6 The fluorescence detection results of the hairpin probe Probe 1 of this invention for detecting eTaq DNA polymerase alone are shown, where blue corresponds to 5'-3' exonuclease activity and red corresponds to 3'-5' exonuclease activity.

[0062] Figure 7 This is the blank control fluorescence detection result based on the hairpin probe Probe 1 of this invention;

[0063] Figure 8 The fluorescence detection results of the hairpin probe Probe 1 of this invention for simultaneously detecting Taq DNA polymerase and HF DNA polymerase are shown, where blue corresponds to 5'-3' exonuclease activity and red corresponds to 3'-5' exonuclease activity.

[0064] Figure 9 The fluorescence detection results of the hairpin probe Probe 2 of this invention for detecting three DNA polymerases individually;

[0065] Figure 10 The results of fluorescence detection of three DNA polymerases using the hairpin probe Probe 3 of this invention are shown. Detailed Implementation

[0066] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0067] The terms "preferred," "more preferably," etc., used in this invention refer to embodiments of the invention that provide certain beneficial effects under certain circumstances. However, other embodiments may also be preferred under the same or other circumstances. Furthermore, the description of one or more preferred embodiments does not imply that other embodiments are unavailable, nor is it intended to exclude other embodiments from the scope of this invention.

[0068] When a numerical range is disclosed herein, the range is considered continuous and includes the minimum and maximum values ​​of the range, as well as every value between the minimum and maximum values. Furthermore, when the range refers to integers, it includes every integer between the minimum and maximum values ​​of the range. Additionally, when multiple ranges are provided to describe a feature or characteristic, the ranges may be combined. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges to which they are incorporated.

[0069] In the description of this invention, the reference term "and / or" includes all and any combination of one or more of the associated listed items.

[0070] In the description of this invention, the terms "one embodiment," "some embodiments," "illustrative embodiment," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0071] Unless otherwise specified, room temperature in the description of this invention refers to 25±5 ℃.

[0072] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0073] Inventive concept:

[0074] This invention designs a hairpin probe for detecting the activity of 3' and / or 5' DNA polymerase exonuclease, the schematic diagram of which is shown below. Figure 1 As shown, this hairpin probe is composed of an oligonucleotide single strand, which, starting from the 5' end, sequentially contains regions a, b, c, d, e, f, and g, wherein:

[0075] The a region and the c region are inversely complementary to each other, forming the stem of the first stem-loop structure. The nucleotide lengths of the a region and the c region are 10 nt to 16 nt. The 5' end of the a region is labeled with a fluorescent group, and the 3' end of the a region is labeled with a quenching group.

[0076] Region b connects region a and region c, and independently forms the ring portion of the first stem-ring structure;

[0077] Region d connects region c and region e;

[0078] The e region and g region are anticomplementary, forming the stem of the second stem-loop structure. The nucleotide lengths of the e region and g region are 10 nt to 16 nt. The 5' end of the g region is labeled with a quenching group, and the 3' end of the g region is labeled with a fluorescent group.

[0079] The f region connects the e region and the g region, independently forming the ring portion of the second stem-ring structure.

[0080] This invention utilizes a hairpin probe with two stem-loop structures, each with different fluorescent groups at its 3' and 5' ends, to detect the activity of 3'-5' and / or 5'-3' exonucleases in a single reaction system. The signal generation of the hairpin probe relies on fluorescence resonance energy transfer (FRET) between the fluorescent and quenching groups. In the absence of the target enzyme, the fluorescent and quenching groups are close together, resulting in quenched fluorescence. When the target enzyme reacts with the fluorescent probe, the probe structure changes, causing the two groups to separate and fluorescence to recover. Based on this principle, the activity of 3' and / or 5' exonucleases can be detected.

[0081] In some specific embodiments, considering the binding interaction between the enzyme to be detected and the hairpin probe, the nucleotide lengths of regions a and c in this invention are preferably 10 nt to 16 nt, and the nucleotide lengths of regions e and g are preferably 10 nt to 16 nt. If the distance between them is too short, it may create a barrier, affecting the binding efficiency between the enzyme to be detected and the hairpin probe, thus affecting the detection sensitivity; conversely, if the distance is too long, it may not achieve a good quenching effect, and the blank fluorescence intensity may be too high, also affecting the detection sensitivity. Therefore, when designing the probe, it is preferable to design a distance of 10 to 16 bases between the fluorescent group and the quenching group.

[0082] In some specific embodiments, the nucleotide lengths of regions b and f are preferably 10 nt to 16 nt. Regions b and f constitute the loop portion of the first stem-loop structure and the loop portion of the second stem-loop structure, respectively. Considering the preparation cost and difficulty, the nucleotide lengths of regions b and f are preferably 10 nt to 16 nt. If the loop structure is too short, the pre-designed hairpin structure may not be formed well after annealing; if the loop structure is too long, it will increase the difficulty of probe synthesis, resulting in the inability to synthesize the preset stem-loop structure.

[0083] In some specific embodiments, the nucleotide length of the d-region is preferably 10 nt to 18 nt, more preferably 10 nt to 15 nt. If the d-region is too short, it may affect the binding of the enzyme to the probe, thus affecting subsequent reactions; while if it is too long, it is not conducive to probe synthesis.

[0084] In some specific embodiments, the fluorescent group can be a common detectable luminescent group, including but not limited to FAM, HEX, TRAMA, VIC, CY5 and JOE, etc., and the quenching group can also be a common group that can quench the corresponding fluorescent group, including but not limited to BHQ1, BHQ2, TAMRA and MGB, etc.

[0085] Example 1: Preparation of a hairpin probe for detecting DNA polymerase exonuclease activity

[0086] This embodiment provides a method for designing, synthesizing, and preparing hairpin probes for detecting 3'-5' exonuclease activity and / or 5'-3' exonuclease activity, specifically including the following:

[0087] 1. Preparation of hairpin probes for detecting 3' and / or 5' exonuclease activity

[0088] The hairpin probe of this embodiment is composed of an oligonucleotide single strand, which, starting from the 5' end, sequentially includes regions a, b, c, d, e, f, and g, wherein:

[0089] Region a and region c are inversely complementary, forming the stem of the first stem-loop structure. The nucleotide length of regions a and c is 13 nt. The nucleotide sequence of region a is 5'-TACTACTGGGAAT-3' (SEQ ID NO:1), with the fluorescent group VIC labeled on the 5' end of the thymine and the quenching group BHQ1 labeled on the 3' end of the thymine. The nucleotide sequence of region c is 5'-TTCCCAGTAGTA-3' (SEQ ID NO:2).

[0090] Region b connects regions a and c above, and independently forms the loop portion of the first stem-loop structure. Region b consists of 16 bases, and the nucleotide sequence is 5'-AAGTTAAGACCTATGA-3' (SEQ ID NO:3).

[0091] Region d connects region c and region e, and consists of 15 bases with the nucleotide sequence: 5'-GAGACGGGGGAGACG-3' (SEQ ID NO:4).

[0092] The e and g regions are anticomplementary, forming the stem of the second stem-loop structure. The nucleotide lengths of the e and g regions are 14 nt. The nucleotide sequence of the e region is 5'-ACTACGGGGGTACT-3' (SEQ ID NO:5), and the nucleotide sequence of the g region is 5'-TGTACCCCCGTAGT-3' (SEQ ID NO:6). The 3' end of the thymine is labeled with the fluorescent group FAM, and the 5' end of the thymine is labeled with the quenching group BHQ1.

[0093] Region f connects region e and region g, independently forming the loop portion of the second stem-loop structure. Region f consists of 16 bases and has the nucleotide sequence 5'-AGTATCCAGAATTGAA-3' (SEQ ID NO:7).

[0094] The nucleotide sequences of the hairpin probes used to detect 3' and / or 5' exonuclease activity are as follows:

[0095] 5'-(VIC)TACTACTGGGAAT(BHQ1)AAGTTAAGACCTATGATTCCCAGTAGTAGAGACGGGGGAGACGACTACGGGGGTACAGTATCCAGAATTGAA(BHQ1)TGTACCCCCGTAGT(FAM)-3' (SEQ ID NO: 8).

[0096] Based on the above nucleotide sequence information, the corresponding oligonucleotide single strands are synthesized. Then, in annealing buffer (containing 10 mM Tris-HCl, 50 mM NaCl and 1 mM DTT, pH 8.0), the mixture is heated at 90°C for 5 min and then slowly cooled to room temperature at a rate of 2°C / min to obtain the hairpin probe (hereinafter referred to as Probe 1) for detecting the activity of 3' and / or 5' exonucleases, which is then ready for use.

[0097] 2. Preparation of fluorescent probes for detecting 5' exonuclease activity

[0098] As a control group, this embodiment also prepared a fluorescent probe for detecting 5' exonuclease activity, the schematic diagram of which is shown below. Figure 2 As shown, the main difference between this fluorescent probe and the hairpin probes used to detect 3' and / or 5' exonuclease activity described above is that it contains only one stem-loop structure. This fluorescent probe consists of a single oligonucleotide chain, containing, starting from the 5' end, a', b', c', and d' regions sequentially. Regions a' and c' are anticomplementary, forming the stem of the stem-loop structure. The adenine at the 5' end of region a' is labeled with the fluorescent group FAM, and the thymine at the 3' end is labeled with the quenching group BHQ1.

[0099] Region b' connects regions a' and c' to form the ring portion of the stem-ring structure, and region d' is an extended sequence of region c'.

[0100] The nucleotide sequence of the fluorescent probe used to detect 5' exonuclease activity is as follows:

[0101] 5'-(FAM)ACTACTGGGAAAACCGAGT (BHQ1)AAGTTAAGACCTATGACTCGGTTTTCCCAGTAGTAGAGACGGGGGAGACG-3' (SEQ ID NO:9).

[0102] Based on the above nucleotide sequence information, the corresponding oligonucleotide single strands are synthesized. Then, in annealing buffer (containing 10 mM Tris-HCl, 50 mM NaCl and 1 mM DTT, pH 8.0), the mixture is heated at 90°C for 5 min and then slowly cooled to room temperature to obtain the hairpin probe (hereinafter referred to as Probe 2) for detecting 5' exonuclease activity, which is then ready for use.

[0103] 3. Preparation of fluorescent probes for detecting 3' exonuclease activity

[0104] As a control group, this embodiment also prepared a fluorescent probe for detecting 3' exonuclease activity, the schematic diagram of which is shown below. Figure 3 As shown, the main difference between this fluorescent probe and the hairpin probes used to detect 3' and / or 5' exonuclease activity described above is that it contains only one stem-loop structure. This fluorescent probe consists of a single oligonucleotide strand, containing, starting from the 5' end, a d' region, an e' region, an f' region, and a g' region. The e' region is anticomplementary to the g' region, forming the stem of the stem-loop structure. The 5' end of the g' region is labeled with a quenching group BHQ1 on the thymine, and the 3' end is labeled with a fluorescent group FAM on the thymine.

[0105] Region f' connects region e' and region g' to form the ring portion of the stem-ring structure, and region d' connects to region e'.

[0106] The nucleotide sequence of the fluorescent probe used to detect 3' exonuclease activity is as follows:

[0107] 5'-TAGAGACGGGGGAGACGACTACGGGGGTACAAGCAAGTATCCAGAATTGAA (BHQ1)TTGCTTGTACCCCCGTAGT (FAM)-3' (SEQ ID NO: 10).

[0108] Based on the above nucleotide sequence information, the corresponding oligonucleotide single strands are synthesized. Then, in annealing buffer (containing 10 mM Tris-HCl, 50 mM NaCl and 1 mM DTT, pH 8.0), the mixture is heated at 90°C for 5 min and then slowly cooled to room temperature to obtain the hairpin probe (hereinafter referred to as Probe 3) for detecting 3' exonuclease activity, which is then ready for use.

[0109] Example 2: Detection of exonuclease activity

[0110] In this embodiment, Accurate Taq HS DNA polymerase, ApexHF HS DNA polymerase-FS, and Accurate Taq HS DNA polymerase were used as the analytes. The exonuclease activities were detected using the hairpin probes Probe 1, Probe 2, and Probe 3 prepared above, respectively. The specific related experiments are as follows:

[0111] (1) Experimental materials

[0112] ①Reaction substrates: the hairpin probes Probe 1, Probe 2 and Probe 3 prepared above.

[0113] ② DNA polymerase: Three different DNA polymerases were selected, namely Accurate Taq HS DNA polymerase (hereinafter referred to as Taq), ApexHF HS DNA polymerase-FS (hereinafter referred to as HF), and Accurate Taq HS DNA polymerase (hereinafter referred to as eTaq). The enzyme digestion activities of the above DNA polymerases are shown in Table 1.

[0114] Table 1: DNA polymerase exonuclease activity

[0115]

[0116] In the table, "+" indicates the presence of the corresponding exonuclease activity, and "-" indicates the absence of the corresponding exonuclease activity.

[0117] (2) Experimental methods

[0118] Construction of the reaction system: The system used to detect exonuclease activity in this embodiment is a 25 μL reaction system, which contains: 25 mmol / L Tris-HCl, 100 mmol / L KCl, 5 mmol / L MgCl2, 50 ug / mL BSA, 0.2 μmol / L hairpin probe and 1 U of the enzyme to be detected, with pH 7.5 and deionized water as the solvent.

[0119] The reaction program was set to 72℃ for 30 seconds per cycle, for a total of 50 cycles.

[0120] The above experimental method was used for sample addition and detection. Each sample was tested in 4 replicates. After the reaction was completed, the fluorescence detection results were analyzed.

[0121] (3) Experimental results

[0122] The results of detecting Taq DNA polymerase exonuclease activity using the hairpin probe Probe 1 of this invention are as follows: Figure 4As shown, the results of detecting HF DNA polymerase–FS exonuclease activity alone are as follows: Figure 5 As shown, the results of detecting eTaq DNA polymerase exonuclease activity alone are as follows: Figure 6 As shown, when Taq DNA polymerase or HF DNA polymerase is added alone, the fluorescence intensity increases only in the VIC detection channel (corresponding to 5'-3' exonuclease activity) or the FAM detection channel (corresponding to 3'-5' exonuclease activity), respectively. This indicates that Taq DNA polymerase only has 5'-3' exonuclease activity and no 3'-5' exonuclease activity, while HF DNA polymerase only has 3'-5' exonuclease activity and no 5'-3' exonuclease activity, consistent with the expected results. However, when eTaq DNA polymerase is added alone, no relevant signal is detected in either the VIC or FAM detection channels, and the fluorescence intensity is similar to that of the blank control without enzyme (e.g., ...). Figure 7 The results are consistent with those shown, indicating that eTaq DNA polymerase has no exonuclease activity, which is consistent with expectations. This demonstrates that the hairpin probe Probe 1 of this invention can be used to accurately distinguish the exonuclease activity of DNA polymerase.

[0123] Furthermore, the hairpin probe Probe 1 of this invention was used to simultaneously detect the activities of Taq DNA polymerase and HF DNA polymerase-FS exonuclease, and the results are as follows: Figure 8 As shown, the fluorescence intensity increased in both the VIC and FAM detection channels. These results demonstrate that the hairpin probe Probe 1 of this invention can detect enzymes containing both 3'-5' and 5'-3' exonuclease activities, either alone or simultaneously, with good specificity.

[0124] Compare the results detected using fluorescent probes Probe 2 or Probe 3 (e.g.) Figure 9 and Figure 10 As shown in the diagram, analysis reveals that in the same reaction system, fluorescent probe Probe 2 can only be used to detect the 5'-3' exonuclease activity of DNA polymerase, while fluorescent probe Probe 3 can only be used to detect the 3'-5' exonuclease activity of DNA polymerase. Furthermore, when fluorescent probes Probe 2 and Probe 3 are mixed and added to the reaction system simultaneously for detection, the presence of both probes at their 5' and 3' ends will cause a deviation between the detection results and the actual results, making effective detection impossible.

[0125] In summary, this invention provides a hairpin probe for detecting DNA polymerase exonuclease activity, its preparation method, and its application. This hairpin probe has two stem-loop structures, cleverly utilizing these structures to design different fluorescent groups at the 3' and 5' ends of the stem, achieving the detection of 3'-5' and / or 5'-3' exonuclease activity in a single reaction system. Furthermore, the hairpin probe of this invention employs a self-hybridizing hairpin structure, which brings the fluorescent group and the quenching group very close together, improving fluorescence quenching efficiency and helping to reduce detection background.

[0126] The embodiments of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A hairpin probe for detecting exonuclease activity, characterized in that, The hairpin probe, starting from the 5' end, sequentially includes regions a, b, c, d, e, f, and g, wherein: The a region and the c region are inversely complementary, the 5' end of the a region is labeled with a first fluorescent group, the 3' end of the a region is labeled with a first quenching group, wherein the nucleotide length of the a region is 10 nt to 16 nt, and the nucleotide length of the c region is 10 nt to 16 nt; The e region and the g region are inversely complementary, the 5' end of the g region is labeled with a second quenching group, and the 3' end of the g region is labeled with a second fluorescent group, wherein the nucleotide length of the e region is 10 nt to 16 nt, and the nucleotide length of the g region is 10 nt to 16 nt; Region b connects region a and region c to form a loop, and region f connects region e and region g to form a loop, wherein the lengths of region b and region f are independently 10 nt to 16 nt; The first fluorescent group and the second fluorescent group are different from each other.

2. The hairpin probe according to claim 1, characterized in that, The first fluorescent group and / or the second fluorescent group are selected from any one of FAM, HEX, TRAMA, VIC, CY5 or JOE.

3. The hairpin probe according to claim 2, characterized in that, The first quenching group may be the same as or different from the second quenching group; And / or, the first quenching group and the second quenching group are independently selected from any one of BHQ1, BHQ2, TAMRA, and MGB.

4. The hairpin probe according to claim 3, characterized in that, The nucleotide sequence of the hairpin probe is shown in SEQ ID NO:8, wherein: The first fluorescent group is modified at the 1st base, and the first quenching group is modified at the 13th base; The second fluorescent group is modified at the 99th base, and the second quenching group is modified at the 86th base.

5. A method for preparing a hairpin probe for detecting exonuclease activity as described in any one of claims 1 to 4, characterized in that, include: The nucleotide sequence of the hairpin probe is obtained and the corresponding oligonucleotide single strand containing the first fluorescent group, the first quencher group, the second fluorescent group and the second quencher group is synthesized. Then, the result is obtained after annealing and cooling.

6. The use of the hairpin probe for detecting exonuclease activity as described in any one of claims 1 to 4 in any one of claims A) to D): A) Screening or identifying DNA polymerases with exonuclease activity; B) Detection of DNA polymerase exonuclease activity; C) Screening for antibodies that block exonuclease activity; D) Prepare exonuclease activity detection reagents or kits.

7. A method for detecting exonuclease activity, characterized in that, include: The hairpin probe for detecting exonuclease activity as described in any one of claims 1 to 4 is contacted with the enzyme to be detected to carry out a hydrolysis reaction, and then fluorescence quantitative or qualitative analysis is performed.

Images