An indel molecular marker for identifying old crow petal of wanyu and application thereof
By using high-throughput sequencing and Indel molecular marker technology, the problem of identifying *Lao Ya Bian* species in Anhui and Henan provinces has been solved, enabling rapid and accurate species identification. This supports applications such as planting and breeding, and breaks through the limitations of traditional identification methods that rely on experience.
Patent Information
- Application Number
- CN202510107342.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-23
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2045-01-23
AI Technical Summary
Existing technologies make it difficult to accurately identify the *Lao Ya Ban* species from Anhui and Henan provinces and its closely related species, especially under conditions of overlapping habitats and environmental influences. Even professionals find it difficult to distinguish them by phenotypic differences, leading to difficulties in identification.
The whole genome sequence of *Lao Ya Ban* from Anhui and Henan provinces was assembled using high-throughput sequencing. Specific Indel molecular markers were discovered and designed. Combined with primer sets and PCR amplification technology, species identification was achieved through sequencing read alignment or electrophoresis analysis.
It has achieved rapid and accurate identification of *Lao Ya Bian* species from Anhui and Henan provinces, breaking through the reliance on experience. It can automatically and systematically identify *Lao Ya Bian* species from Anhui and Henan provinces in a short time, distinguishing them from closely related species and supporting planting, breeding and resource utilization.
Smart Images

Figure CN120026125B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to Indel molecular markers in plants of the genus *Lactuca* and their applications. Specifically, it relates to DNA barcodes used to identify *Lactuca* species from Anhui and Henan provinces. Background Technology
[0002] *Amana wanyuensis* BXHan, SYYi et XWSong, mainly produced in the Dabie Mountains area of Anhui and Henan provinces, is a recently identified new species of the genus *Amana*. It grows along forest edges, ditches, and roadsides at altitudes above 600m. This species is similar to *Amana edulis* (Miq.) Honda, but differs in that *Amana edulis* has bulbs densely covered with downy hairs, while this species has smooth bulbs without downy hairs; *Amana edulis* has narrower leaves during flowering and fruiting, while this species has narrower leaves during flowering, and leaves during fruiting are twice as wide as those during flowering; *Amana edulis* has slightly wider red tepals, while this species has slightly narrower white tepals. Although there are some phenotypic differences, due to overlapping habitats and environmental influences, their phenotypes often converge, and they are often confused and used medicinally as *Amana edulis* in the Dabie Mountains, making phenotypic identification difficult even for professionals. In addition, other species of the genus *Lactuca*, such as *Lactuca dabieensis*, *Lactuca tianmuensis*, and *Lactuca huianensis*, are also distributed in this area. Some of these species have similar phenotypes to *Lactuca huianensis*, which affects the identification of *Lactuca huianensis*. Summary of the Invention
[0003] This invention addresses the aforementioned technical problems by providing a simple molecular marker method for the identification of *Lao Ya Ban* (a type of herb) from Anhui and Henan provinces. Specifically, it provides an Indel molecular marker for identifying *Lao Ya Ban* from Anhui and Henan provinces and its application.
[0004] Specifically, the present invention provides the following technical solution:
[0005] In a first aspect, the present invention provides an Indel molecular marker for *Lao Ya Ban* (a type of herb) from Anhui and Henan provinces, the sequence of which is shown in SEQ ID NO.1 to SEQ ID NO.3.
[0006] This invention utilizes high-throughput sequencing to assemble contig sequences from the whole genome sequence of *Polygonatum sibiricum* from Anhui and Henan provinces. The sequences were then compared with those of *Polygonatum* species published on NCBI, revealing three sequences containing Indel variant sites, which are suitable as Indel molecular markers for identifying *Polygonatum sibiricum* from Anhui and Henan provinces.
[0007] On the other hand, the present invention provides a primer set for amplifying the above-mentioned molecular markers, the primer set being shown in the table below:
[0008]
[0009]
[0010] On the other hand, the present invention provides a method for identifying *Lao Ya Ban* (a type of Chinese herbal medicine) from Anhui and Henan provinces, comprising:
[0011] (1) Extract DNA from the plant to be identified;
[0012] (2) Sequencing of the total DNA obtained above yielded sequencing reads;
[0013] (3) Align the reads described in step 2) to the Indel molecular marker described in claim 1;
[0014] (4) The species of the sample to be tested is determined based on the coverage of the sequencing reads on the Indel molecular marker. If the SEQ ID NO:1 is completely covered and there is no gap, the species of the sample to be tested is determined to include Wan Yu Lao Ya Ban. Otherwise, the sample to be tested is determined not to include Wan Yu Lao Ya Ban.
[0015] On the other hand, the present invention provides another method for identifying *Lao Ya Ban* (a type of herb) from Anhui and Henan provinces, comprising:
[0016] (1) Extract DNA from the plant to be identified;
[0017] (2) Sequencing of the total DNA obtained above yielded sequencing reads;
[0018] (3) The reads in step 2 are assembled. If any of the aforementioned Indel molecular markers are present in the assembled contigs, it is determined that the species of the sample to be tested includes *Laoyabania wanyuensis*. Otherwise, it is determined that the sample to be tested does not contain *Laoyabania wanyuensis*.
[0019] On the other hand, the present invention provides another method for identifying *Lao Ya Ban* (a type of herb) from Anhui and Henan provinces, comprising:
[0020] (1) Extract DNA from the plant to be identified;
[0021] (2) PCR amplification using any of the primer pairs described in claim 2 or 3;
[0022] (3) Sequencing the PCR product in step 2) If the sequencing result is consistent with any of the aforementioned Indel molecular marker sequences, it is determined that the species of the sample to be tested contains Wanyu Laoyaban; otherwise, it is determined that the sample to be tested does not contain Wanyu Laoyaban.
[0023] Preferably, the sequencing in the aforementioned method is first-generation sequencing, second-generation sequencing, or third-generation sequencing.
[0024] Preferably, one of the following software programs, Geneious, Bowtie, Tophat, bwa, or HISAT, is used for read comparison.
[0025] On the other hand, the present invention provides another method for identifying Tulipa anhuiensis, including:
[0026] (1) Extracting the DNA of the plant to be identified;
[0027] (2) Performing PCR amplification using the SEQ ID NO.4 - SEQ ID NO.5 and / or SEQ ID NO.8 - SEQ ID NO.9 described in claim 2 or 3;
[0028] (3) Electrophoresing the amplification product together with the aforementioned Indel molecular markers SEQ ID NO.1 and / or SEQ ID NO.2, and judging the sample species according to the electrophoresis results;
[0029] (4) If the sample has a band with the same length as the Indel molecular marker, it is judged that the species of the sample to be tested contains Tulipa anhuiensis, otherwise it is judged that the sample to be tested does not contain Tulipa anhuiensis.
[0030] Preferably, in the aforementioned method, if the sample to be tested is a single sample, it is directly judged that the sample to be tested is Tulipa anhuiensis.
[0031] On the other hand, another object of the present invention is to provide any one of the following applications of the above molecular markers, primers or methods:
[0032] (1) Application in identifying Tulipa anhuiensis;
[0033] (2) Application in the identification, improvement or molecular marker-assisted breeding of germplasm resources of the genus Tulipa;
[0034] (3) Application in the screening of cross-breeding of the genus Tulipa or the creation of different Tulipa varieties;
[0035] (4) Application in the DNA fingerprint database of the genus Tulipa;
[0036] (5) Application in the quality detection of seedlings of the genus Tulipa.
[0037] Using the single molecular marker of the present invention can effectively distinguish whether the variety to be tested is Tulipa anhuiensis, providing guarantee for the identification, cultivation, resource utilization and breeding of Tulipa anhuiensis. It is also of great significance for the research on the species classification, phylogeny, phylogeography of the genus Tulipa, as well as the protection and utilization of Tulipa resources. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] The following combines the drawings and specific embodiments to elaborate on the method of the present invention and its beneficial effects in detail.
[0039] Figure 1This is a comparison of the INDEL molecular marker sequence SEQ ID NO.1 of *Lao Ya Ban* from Anhui and Henan provinces with homologous sequences of 13 other *Lao Ya Ban* species.
[0040] Figure 2 This is a comparison of the INDEL molecular marker sequence SEQ ID NO.2 of *Lao Ya Ban* from Anhui and Henan provinces with homologous sequences of 11 other *Lao Ya Ban* species.
[0041] Figure 3 This is a comparison of the INDEL molecular marker sequence SEQ ID NO.3 of *Lao Ya Ban* from Anhui and Henan provinces with homologous sequences of 13 other *Lao Ya Ban* species.
[0042] Figure 4 This is the alignment result of the INDEL molecular marker sequence SEQ ID NO.1 of the Anhui-Henan Laoyaban (a type of Chinese herbal medicine) in the nr / nt database.
[0043] Figure 5 This is the alignment result of the INDEL molecular marker sequence SEQ ID NO.2 of the Anhui-Henan Laoyaban (a type of Chinese herbal medicine) in the nr / nt database.
[0044] Figure 6 This is the alignment result of the INDEL molecular marker sequence SEQ ID NO.3 of the Anhui-Henan Laoyaban (a type of Chinese herbal medicine) in the nr / nt database.
[0045] Figure 7 This is a simulated electrophoresis diagram of SEQ ID NO.1 and 13 homologous sequences of Lao Ya Pi, where M is the marker, 15 is SEQ ID NO.1, 14 is the PCR sequence of Wan Yu Lao Ya Pi, and 1-13 are other Lao Ya Pi.
[0046] Figure 8 This is a simulated electrophoresis diagram of SEQ ID NO.2 and 11 homologous sequences of Lao Ya Pi, where M is the marker, 13 is SEQ ID NO.2, 12 is the PCR sequence of Wan Yu Lao Ya Pi, 11 is Yun Ju Lao Ya Pi, and 1-10 are other Lao Ya Pi.
[0047] Figure 9 This is a simulated electrophoresis diagram of SEQ ID NO.3 and homologous sequences of 13 species of Lao Ya Pi, where M is the marker, 1 is SEQ ID NO.3, 2 is the PCR sequence of Lao Ya Pi from Anhui and Henan, and 3-15 are other Lao Ya Pi species.
[0048] Figure 10 This is the alignment result of DNA sequencing reads containing *Laoyaban* from Anhui and Henan provinces on SEQ ID NO.1.
[0049] Figure 11 The results are the alignment of DNA sequencing reads excluding those from Anhui and Henan provinces onto SEQ ID NO.1, where A is the full-view image and B is the gap site image.
[0050] Figure 12 DNA sequencing reads that do not contain *Laoyaban* from Anhui and Henan provinces are in SEQ ID NO. 2 ( Figure 12 A) SEQ ID NO.3 ( Figure 12 B) and ITS sequence ( Figure 12 The comparison results on C). Detailed Implementation
[0051] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0052] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. The *Corydalis* plant samples used in the following examples are commercially available or collected from the wild.
[0053] Example 1: Development of specific molecular markers for *Laoyaban* (a type of herb) from Anhui and Henan provinces.
[0054] *Amana wanyuensis* BXHan, SYYi et XWSong is mainly produced in the Dabie Mountains area of Anhui and Henan provinces, growing on forest edges, ditches, and roadsides at altitudes above 600m. This species is similar to *Amana edulis* (Miq.) Honda. Other *Amana* species also distributed in this region include *Amana dabieensis*, *Amana tianmuensis*, and *Amana huianensis*. The *Amana wanyuensis* species in this invention were all collected from the Dabie Mountains area of Anhui province.
[0055] The following steps were used to obtain the specific indel molecular markers, i.e., DNA barcodes, for Lao Ya Ban (a type of herb) from Anhui and Henan provinces:
[0056] 1) Collect leaves of *Laoyabania* from Anhui and Henan provinces;
[0057] 2) Extract total DNA from leaves of *Laoyabania spp.* from Anhui and Henan provinces;
[0058] 3) Perform next-generation high-throughput sequencing on the total DNA to obtain sequencing reads;
[0059] 4) Assemble the sequencing reads into contigs.
[0060] 5) Compare the nucleotide sequences with those of species in the genus *Corydalis* in Genbank to screen for specific marker sites containing indels.
[0061] The results yielded three fragments as shown in SEQ ID NO.1 to SEQ ID NO., and all three sequences had multiple polymorphic sites on their homologous nucleotide sequences with known species of the genus *Corydalis*.
[0062] SEQ ID NO.1:
[0063] 5'-CTCCTGCAAGAGAAGCGGATATAGGAAGTGTTGTTGCGGAGATCTAGCTTTTTTGAAATACCCTTGTAATTCTTCCATTTAAATTTTTGACTTGAAACAGAGACATAGGACAAGAGGCATTTTTGGGGTTATAAAAT AATACATAGTGCAATATGGTCCGAACAGGGTATATAATTATGTATATAATTATGTAGATATAATACTTACAGTATATATAGTAAACAGTATATATAGTAAGAATAGTAAGAACCTATACCCCGGAGACCTAGAATCC-3'
[0064] SEQ ID NO.2:
[0065] 5'-ATCTGGGTGTCGCCTGATTGACAAAATGGTGGACCCACCGTACCAATCCAATAGGATGAAGTGAAGGTTGCTGCACTTATTAATTATTAATTTAATAATGGGTTCGGTTCATTTATTTAATTCTTTAATTCATTCATTGAATCAAATA AATTAGGAAATGGAGGTTTTATTAAGATAGTTATCTGTCTTTAGTTATCTGTCTTTAGTATAGAGATTTTTTATATCTTTTATATCTATATATATAATTTATCTCTTTTGCTTATACAAAAGGTAACAAAAGAAACAATAGGTCT-3'
[0066] SEQ ID NO.3:
[0067] 5'-CTCCCTTCTTCCACTCCGTCCCGAAGAGTAACTAAGACCAATTCAGTCACGTTTTCATGTTCCAATTGAACACTTTCCATTTATGATCAAAGAAGAAGATTTTTTTTACCAAACCATATACAGATCAAATCACAATATTATAATAAG AATCAGAAAGATCCCTTTTGATTTTGAATTTGTTCATTTGGAATATGGGCTCTTCTATCTTGTACTTATTTTTGTTTTATTCTTTATTTATTTCATTTCGATTTTCTTTCCCTCTCTTTTTTCCCTTCCATCATTCCTTAAGTCCCA-3'
[0068] Further primers were designed to amplify homologous sequences of *Lactuca indica* from Anhui and Henan provinces and 13 other closely related species in the *Lactuca* genus. Multiple sequence alignment revealed that three of the amplified sequences showed significant differences from the homologous sequences of the other 13 *Lactuca* species. Figures 1-3 Thirteen closely related species of *Lactuca indica* were identified as *Lactuca biloba*, *Lactuca yunjuensis*, *Lactuca yunmengensis*, *Lactuca nanyueensis*, *Lactuca polymorpha*, *Lactuca dabieensis*, *Lactuca tianmuensis*, *Lactuca huianensis*, *Lactuca baohuaensis* (SEQ ID.2 not amplified), *Lactuca kuocangshanensis*, *Lactuca japonica*, *Lactuca wanzheensis* (SEQ ID.2 not amplified), *Lactuca wanyuensis*, and *Lactuca indica*. Primer sequences are as follows:
[0069]
[0070]
[0071] Example 2: Sequence alignment of specific molecular markers of *Laoyaban* from Anhui and Henan provinces with closely related species.
[0072] To determine the species specificity of the molecular markers described in this invention, the molecular markers were aligned using the Geneious Prime BLAST program. The nr / nt library was selected, with no species limitation, and other parameters were left at their default values. The results are as follows: Figures 4-6 As shown, Figure 4 The sequence of SEQ ID NO.1 shows the highest sequence identity (94.2%) with known species in the genus *Crow's Eye*. Figure 5 The molecular marker alignment of SEQ ID NO.2 showed the highest sequence identity (94.9%) with known *Laoya* species. Figure 6The sequence of SEQ ID NO.3 is shown to be similar to that of the species Corsia dispar in the genus Corsia, but the coverage rate is only 99.33% and the identity is only 85.4%. The remaining sequences are believed to be sequences of the known genus Tulipa, and the highest coverage rate is only 50.67%. None of the sequences aligned are those of Tulipa anhuiensis and Tulipa yuzhensis. It can be seen that the molecular marker described in the present invention is different from all known species of the genus Tulipa and has extremely strong specificity.
[0073] Example 3 Identification method 1 of Tulipa anhuiensis and Tulipa yuzhensis
[0074] 1) Collect leaves of plants in the genus Tulipa as test samples respectively;
[0075] 2) Extract the total DNA of the test samples;
[0076] 3) Use the primers in Example 1) to amplify the DNA in step 2);
[0077] 4) The amplification products and the molecular marker of Tulipa anhuiensis and Tulipa yuzhensis in Example 1 are detected by 2.5% agarose gel electrophoresis together. Observe the PCR amplification under the gel imaging system, and judge the species of the test sample according to the size of the bands.
[0078] Since the PCR products in Example 1 have been sequenced to obtain the sequencing sequences, in this example, the agarose gel electrophoresis is directly simulated using the Snapgene software based on the size of the sequencing products. The results are as Figures 7-9 shown. When the electrophoresis band of the PCR product is consistent with the control marker of SEQ ID NO.1 or SEQ ID NO.3, it is judged as Tulipa anhuiensis and Tulipa yuzhensis, otherwise it is not. SEQ ID NO.2 cannot distinguish Tulipa anhuiensis and Tulipa yuzhensis from other Tulipa species.
[0079] Example 4 Identification method 2 of Tulipa anhuiensis and Tulipa yuzhensis
[0080] 1) Collect leaves of plants in the genus Tulipa as test samples respectively;
[0081] 2) Extract the total DNA of the test samples;
[0082] 3) Perform second-generation high-throughput sequencing on the total DNA of the above two samples respectively to obtain sequencing reads;
[0083] Use the Geneious software to align the sequencing reads to SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 respectively, and set the maximum number of mismatched bases and the maximum Gap ratio to 2%.
[0084] 4) Determine the species of the sample to be tested based on the coverage of sequencing reads on DNA molecular markers. If the reads can completely cover any sequence of SEQ ID NO:1 and there is no gap, the species of the sample to be tested is determined to include *Lao Ya Ban* from Anhui and Henan provinces; otherwise, the sample is determined not to contain *Lao Ya Ban*.
[0085] See results Figure 10 As shown, the sequencing reads containing samples from Anhui and Henan provinces (a mixture of second-generation sequencing reads from all samples in Example 1 and other known *Laoya* sequencing reads published on NCBI) completely cover SEQ ID NO:1 and there is no gap. Figure 11 The sequencing reads that do not contain samples from the Anhui and Henan regions (a mixture of second-generation sequencing reads from non-Anhui and Henan samples from Example 1 and other known *Laoya* sequencing reads published on NCBI) do not cover SEQ ID NO:1, indicating a gap. Figure 12 The mixed reads can also cover SEQ ID NO:2 and SEQ ID NO:3, as well as the ITS sequence of Wan Yu Lao Ya Ban. Therefore, SEQ ID NO:2, SEQ ID NO:3 and ITS sequences are not applicable in this identification scheme.
[0086] In summary, firstly, this invention provides a powerful supplement to traditional species identification methods, automating and standardizing the sample identification process, overcoming excessive reliance on experience, and enabling rapid and effective identification using fresh or dried plant leaves, such as specimens. It also allows for the establishment of an easily usable application system in a short period. Secondly, this invention can distinguish between *Lactuca indica* species from Anhui and Henan provinces and their closely related species, providing stable and accurate identification at higher resolution. Finally, the method of this invention is of great significance for the classification, phylogeny, and phylogenetic studies of *Lactuca* species, as well as for the protection and utilization of *Lactuca* resources.
[0087] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to the above embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A method for identifying the old swallow's wing of Pterospermum acuminatum Diels, characterized in that, Comprising the following steps: (1) Extract DNA of the plant to be identified; (2) Sequence the total DNA to obtain sequencing reads, the sequencing being second-generation sequencing or third-generation sequencing; (3) Use any of Geneious, Bowtie, Tophat, bwa or HISAT to align the reads in step 2) to SEQ ID NO. 1; (4) Determine the species of the sample to be tested according to the coverage of the sequencing reads on SEQ ID NO. 1, for example, if the sequencing reads completely cover SEQ ID NO. 1 without any gap, it is determined that the species of the sample to be tested contains Wan-Yu Lao Ya Ban, otherwise, it is determined that the sample to be tested does not contain Wan-Yu Lao Ya Ban.
2. A method for identifying the old swallow's wing of Pterospermum acuminatum Diels, characterized in that, Comprising the following steps: (1) Extract DNA of the plant to be identified; (2) Sequence the total DNA to obtain sequencing reads, the sequencing being second-generation sequencing or third-generation sequencing; (3) Assemble the reads in step 2, if the contigs obtained by assembly contain any of the nucleotide sequences in SEQ ID NO. 1 ~ SEQ ID NO. 3, it is determined that the species of the sample to be tested contains Wan-Yu Lao Ya Ban, otherwise, it is determined that the sample to be tested does not contain Wan-Yu Lao Ya Ban.
3. A method for identifying the old swallow's wing of Pterospermum acuminatum Diels, characterized in that, Comprising the following steps: (1) Extract DNA of the plant to be identified; (2) Perform PCR amplification using a primer set, the primer set being any of the following three primer sets: A primer set for amplifying the target sequence SEQ ID NO. 1, the nucleotide sequence of which being shown in SEQ ID NO. 4 ~ SEQ ID NO. 5; A primer set for amplifying the target sequence SEQ ID NO. 2, the nucleotide sequence of which being shown in SEQ ID NO. 6 ~ SEQ ID NO. 7; A primer set for amplifying the target sequence SEQ ID NO. 3, the nucleotide sequence of which being shown in SEQ ID NO. 8 ~ SEQ ID NO. 9; (3) Sequence the PCR product in step 2), the sequencing being first-generation sequencing, if the sequencing result is consistent with the target sequence amplified by the primer in step (2), it is determined that the species of the sample to be tested contains Wan-Yu Lao Ya Ban, otherwise, it is determined that the sample to be tested does not contain Wan-Yu Lao Ya Ban.
4. A method for identifying the old swallow's wing of Pterospermum acuminatum Diels, characterized in that, Comprising the following steps: (1) Extract DNA of the plant to be identified; (2) Perform PCR amplification using SEQ ID NO. 8 ~ SEQ ID NO. 9; (3) Perform electrophoresis on the amplification product together with SEQ ID NO. 3, and determine the species of the sample according to the electrophoresis result; (4) If the sample has a band with the same length as SEQ ID NO. 3, it is determined that the species of the sample to be tested contains Wan-Yu Lao Ya Ban, otherwise, it is determined that the sample to be tested does not contain Wan-Yu Lao Ya Ban.
5. The application of the primer set in identifying Anemone raddeana Rupr. characterized in that, The primer set is any of the following three primer sets or a combination thereof: A primer set for amplifying the target sequence SEQ ID NO. 1, the nucleotide sequence of which being shown in SEQ ID NO. 4 ~ SEQ ID NO. 5; A primer set for amplifying the target sequence SEQ ID NO. 2, the nucleotide sequence of which being shown in SEQ ID NO. 6 ~ SEQ ID NO. 7; A primer set for amplifying the target sequence SEQ ID NO. 3, the nucleotide sequence of which being shown in SEQ ID NO. 8 ~ SEQ ID NO. 9; A primer set for amplifying the target sequence SEQ ID NO. 2, the nucleotide sequences of which are shown in SEQ ID NO. 6~SEQ ID NO. 7; A primer set for amplifying the target sequence SEQ ID NO. 3, the nucleotide sequences of which are shown in SEQ ID NO. 8~SEQ ID NO.
9.
6. The use of the method of any one of claims 1-4 in identifying Wan-Yu Laofanban.
Citation Information
Patent Citations
Bulbus tulipae identification method and special primer pair for bulbus tulipae identification
CN105274243A
Chloroplast microsatellite primer pair for identifying tulipa edulis
CN116064920A