An anti-allergic Kluyveromyces marxianus, bacterial agent, and preparation and application thereof
The preparation of Kluyveromyces marxianus agents through fermentation solves the problem of lack of anti-allergic yeast in the existing technology, achieves the effect of effectively inhibiting hyaluronidase and allergic reaction relief, and improves the symptoms of allergic diseases and immune function.
Patent Information
- Application Number
- CN202510431883.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-08
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2045-04-08
AI Technical Summary
The existing technology lacks yeast with anti-allergic function, especially Kluyveromyces marxianus, and cannot effectively inhibit hyaluronidase activity and alleviate type I and type IV allergic reactions.
Provided is a Kluyveromyces marxianus 31691 bacterial agent prepared by fermentation, containing 10-30 billion CFU/g of viable bacteria, having the functions of inhibiting hyaluronidase activity and allergic reaction relief. The preparation method includes the steps of amplification culture, fermentation culture, separation and drying.
Kluyveromyces marxianus has been shown to significantly inhibit hyaluronidase activity in in vitro and in vivo experiments, reduce the symptoms of type I and type IV allergic reactions, and improve immune function and intestinal health.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of microorganisms, and in particular relates to an anti-allergic Kluyveromyces marxianus, a bacterial agent, and a preparation and application thereof. Background Art
[0002] Allergy, also known as hypersensitivity, is a pathological immune response in which the body is continuously stimulated by certain allergens or re-stimulated by the same allergen, leading to physiological dysfunction and / or tissue cell damage. Allergic diseases have become a serious global public health issue, with an increasing incidence year by year. They have become a common disease that plagues human health and seriously affects the health and quality of life of atopic individuals. Traditional treatments for allergic diseases primarily involve oral antiallergic drugs such as glucocorticoids, antihistamines, and mast cell membrane stabilizers. However, long-term use of antiallergic drugs often leads to adverse reactions such as drowsiness, metabolic disorders, and excessive gastric acid secretion.
[0003] Chinese patent number CN114149937A discloses a strain with the ability to regulate allergic constitutions and its application, belonging to the field of probiotic anti-allergy technology. This invention screened the Lactobacillus rhamnosus LR-123 strain, which, when administered to allergic individuals, was found to upregulate FoxP3 expression and downregulate STAT3 expression. It also protects the intestines, maintaining intestinal morphology and inhibiting mast cell aggregation and histamine release in the intestine, contributing to the field of probiotic anti-allergy technology.
[0004] Chinese patent number CN117683661A discloses a salivary host-associated lactobacillus with anti-allergic function and its application. The salivary host-associated lactobacillus is salivary host-associated lactobacillus HumanGutProbioTG027, which has the function of significantly inhibiting hyaluronidase activity and has a better ability to inhibit hyaluronidase in vitro. Summary of the Invention
[0005] The problem in the prior art is that the probiotics with anti-allergic function isolated and screened in the prior art are mainly derived from the genera Lactobacillus and Bifidobacterium, but lack yeast with anti-allergic function.
[0006] In view of the above problems existing in the prior art, the present invention provides a Kluyveromyces marxianus, a bacterial agent, and the preparation and application thereof.
[0007] Specifically, the present invention provides the following technical solutions:
[0008] Technical solution 1: A Kluyveromyces marxianus, characterized in that the Kluyveromyces marxianus is Kluyveromyces marxianus ( Kluyveromyces marxianus)31691, which was deposited in China Center for Type Culture Collection (CCTCC) with the deposit number CCTCC NO: M 20241589.
[0009] Technical Solution 2: The Kluyveromyces marxianus according to Technical Solution 1 is characterized in that the sequence of the 26S rDNA D1 / D2 segment of the Kluyveromyces marxianus is shown as SEQ ID NO.3.
[0010] Technical Solution 3: The Kluyveromyces marxianus according to Technical Solution 1 or 2 is characterized in that the sequence of ITS rDNA of the Kluyveromyces marxianus is shown as SEQ ID NO.6.
[0011] Technical Solution 4: The Kluyveromyces marxianus according to any one of Technical Solutions 1-3 is characterized in that the Kluyveromyces marxianus has the property of inhibiting hyaluronidase activity; and / or has the property of alleviating type I allergic reactions; and / or has the property of alleviating type IV allergic reactions.
[0012] Technical solution 5: The Kluyveromyces marxianus according to any one of technical solutions 1-4, characterized in that at OD600 nm Under the conditions, the number of viable bacteria is greater than 2.5×10 7 The inhibition rate of Kluyveromyces marxianus solution on hyaluronidase is greater than 60%.
[0013] Preferably, at OD600 nm Under the conditions, the number of viable bacteria is greater than 1.25×10 8 The inhibition rate of the solution of Kluyveromyces marxianus at CFU / mL on hyaluronidase is greater than 75%.
[0014] More preferably, at OD600 nm Under the conditions, the number of viable bacteria is greater than 2.5×10 8 The inhibition rate of the solution of Kluyveromyces marxianus at CFU / mL on hyaluronidase is greater than 80%.
[0015] Technical Solution 6: The Kluyveromyces marxianus according to Technical Solution 5 is characterized in that the type I allergic reaction is a type I allergic reaction induced by bovine milk β-lactoglobulin, and / or the type IV allergic reaction is a type IV allergic reaction induced by dinitrofluorobenzene.
[0016] Technical Solution 7: A bacterial agent, characterized in that it contains the Kluyveromyces marxianus described in any one of Technical Solutions 1-6.
[0017] Technical Solution 8: The bacterial agent according to Technical Solution 7 is characterized in that the number of viable bacteria of Kluyveromyces marxianus in the bacterial agent is 10-30 billion CFU / g.
[0018] Technical Solution 9: A fermentation preparation method of the bacterial agent described in Technical Solution 7 or 8, characterized in that it comprises the following steps: fermenting and culturing the Kluyveromyces marxianus described in any one of Technical Solutions 1-4 after amplification and culture.
[0019] Technical Solution 10: The fermentation preparation method according to Technical Solution 9 is characterized in that it includes the following steps:
[0020] (1) amplifying and culturing the Kluyveromyces marxianus according to any one of technical solutions 1 to 4 to obtain a seed solution;
[0021] (2) fermenting the seed solution obtained in step (1) in a seed culture medium to obtain a fermentation solution;
[0022] (3) The fermentation liquid obtained in step (2) is separated to obtain yeast paste, and the yeast paste is mixed with water and then filtered, pressed and dried to obtain a bacterial agent.
[0023] Technical Solution 11: The fermentation preparation method according to Technical Solution 9 or 10 is characterized in that the rotation speed of the amplification culture is 100-250 rpm, and / or the temperature of the amplification culture is 30-35°C, and / or the time of the amplification culture is 24-48 hours.
[0024] Technical Solution 12: The fermentation preparation method according to any one of Technical Solutions 9-11, characterized in that the culture medium for the expansion culture comprises one or more substances selected from the group consisting of glucose, yeast extract, KH2PO4 and MgSO4∙7H2O,
[0025] Preferably, the raw materials in the culture medium for expansion culture are a combination of glucose, yeast extract, KH2PO4 and MgSO4∙7H2O;
[0026] More preferably, the culture medium for the expansion culture contains, by weight, 95-105 parts of glucose, and / or 15-25 parts of yeast extract, and / or 0.5-1.5 parts of KH2PO4, and / or 0.5-1.5 parts of MgSO4∙7H2O;
[0027] More preferably, the expansion culture medium is prepared with water, wherein each L of the expansion culture medium contains 95-105 g of glucose, and / or 15-25 g of yeast extract, and / or 0.5-1.5 g of KH2PO4, and / or 0.5-1.5 g of MgSO4∙7H2O.
[0028] Technical Solution 13: The fermentation preparation method according to any one of Technical Solutions 9-12 is characterized in that the fermentation culture temperature is 30-35°C, and / or the air volume at the initial stage of fermentation culture is 6-12 L / min, and / or the rotation speed at the initial stage of fermentation culture is 100-250 rpm.
[0029] Technical Solution 14: The fermentation preparation method according to any one of Technical Solutions 9-13 is characterized in that the air volume at the termination of fermentation culture is 25-35 L / min, and / or the rotation speed at the termination of fermentation culture is 500-650 rpm, and / or the temperature at the termination of fermentation culture is 30-35°C.
[0030] Technical Solution 15: The fermentation preparation method according to any one of Technical Solutions 9-14, characterized in that the raw materials in the seed culture medium include one or more substances selected from the group consisting of glucose, MgSO4∙7H2O, ZnSO4∙7H2O, FeSO4∙7H2O, yeast extract, ammonium sulfate, potassium chloride, sodium chloride, calcium chloride, biotin, niacin, D-calcium pantothenate, VB1, VB2, VB6, ammonia water with a mass concentration of 15-20%, NH4H2PO4 and copper sulfate pentahydrate,
[0031] Preferably, the raw materials in the seed culture medium are glucose, MgSO4∙7H2O, ZnSO4∙7H2O, FeSO4∙7H2O, yeast extract, ammonium sulfate, potassium chloride, sodium chloride, calcium chloride, biotin, niacin, D-calcium pantothenate, VB1, VB2, VB6, ammonia water with a mass concentration of 20%, NH4H2PO4 and copper sulfate pentahydrate.
[0032] Technical Solution 16: The fermentation preparation method according to Technical Solution 15 is characterized in that the seed culture medium is prepared with water, wherein each L of seed culture medium contains 150-200 g of glucose, and / or 2-2.5 g of MgSO4∙7H2O, and / or 0.1-0.5 g of ZnSO4∙7H2O, and / or 0.01-0.05 g of FeSO4∙7H2O, and / or 1-2 g of yeast extract, and / or 18-22 g of ammonium sulfate, and / or 3-5 g of potassium chloride, and / or 2-3 g of sodium chloride, and / or Calcium chloride 0.5-1g, and / or biotin 0.001-0.005g, and / or niacin 0.03-0.04g, and / or D-calcium pantothenate 0.005-0.01g, and / or VB1 0.005-0.01g, and / or VB2 0.001-0.0015g, VB6 0.003-0.00375g, and / or 10-15mL of ammonia water with a mass concentration of 15%-20%, and / or 1-2g of NH4H2PO4, and / or 0.001-0.005g of copper sulfate pentahydrate.
[0033] Technical Solution 17: The fermentation preparation method according to Technical Solution 16 is characterized in that in step (2), during the fermentation period, a concentration of 30-35% glucose, a concentration of 20-25% ammonium sulfate, a concentration of 15-20% ammonia water and a concentration of 1-3% NH4H2PO4 are added.
[0034] Technical Solution 18: The fermentation preparation method according to any one of Technical Solutions 9-17 is characterized in that, in step (3), the separation speed is 5000-8000 rpm, and / or the separation time is 5-10 min.
[0035] Technical Solution 19: The fermentation preparation method according to any one of Technical Solutions 9 to 18 is characterized in that, in step (3), during the filtration, the yeast slurry and water are mixed uniformly in a weight ratio of 1-2:1-2 to obtain a mixed liquid.
[0036] When filtering, add 1-2% of an emulsifier based on the dry weight of the yeast to the mixture and filter for 30-60 minutes. Preferably, the emulsifier is sorbitan monostearate.
[0037] The time for filtration and / or pressing is 2 to 3 hours.
[0038] Technical Solution 20: A health product for assisting in relieving allergic reactions, characterized in that it contains the Kluyveromyces marxianus described in any one of Technical Solutions 1-6, or the bacterial agent described in Technical Solutions 7 or 8, or the bacterial agent prepared by the fermentation preparation method of any one of Technical Solutions 9-19.
[0039] Technical Solution 21: Use of the Kluyveromyces marxianus described in any one of Technical Solutions 1-6, the bacterial agent described in Technical Solutions 7 or 8, or the bacterial agent prepared by the fermentation preparation method of any one of Technical Solutions 9-19 in the preparation of health products that assist in relieving allergic reactions.
[0040] Technical Solution 22: A medicine for relieving allergic reactions, characterized in that it contains the Kluyveromyces marxianus described in any one of Technical Solutions 1-6, or the bacterial agent described in Technical Solutions 7 or 8, or the bacterial agent prepared by the fermentation preparation method of any one of Technical Solutions 9-19.
[0041] Technical Solution 23: Use of the Kluyveromyces marxianus described in any one of Technical Solutions 1-6, the bacterial agent described in Technical Solutions 7 or 8, or the bacterial agent prepared by the fermentation preparation method of any one of Technical Solutions 9-19 in the preparation of medicines for alleviating allergic reactions.
[0042] Technical Solution 24: The health product according to Technical Solution 20, the use according to Technical Solution 21, the medicine according to Technical Solution 22, or the use according to Technical Solution 23, characterized in that the allergic reaction is to alleviate type I allergic reaction and / or type IV allergic reaction;
[0043] Preferably, the allergic reaction is to alleviate type I allergic reaction induced by milk β-lactoglobulin and / or alleviate type IV allergic reaction induced by dinitrofluorobenzene.
[0044] Technical Solution 25: According to the health care product of Technical Solution 20 or 24, or the application of Technical Solution 21 or 24, or the medicine of Technical Solution 22 or 24, or the application of Technical Solution 23 or 24, it is characterized in that the dosage form of the health care product or the medicine includes one or more dosage forms selected from the group consisting of powder, tablets, capsules, granules, pills, liquid drops, gels and ointments.
[0045] Technical Solution 26: A food, characterized in that it contains the Kluyveromyces marxianus described in any one of Technical Solutions 1-6, or the bacterial agent described in Technical Solution 7 or 8, or the bacterial agent prepared by the fermentation preparation method of any one of Technical Solutions 9-19.
[0046] Technical Solution 27: Use of the Kluyveromyces marxianus according to any one of Technical Solutions 1-6, the bacterial agent according to Technical Solution 7 or 8, or the bacterial agent prepared by the fermentation preparation method according to any one of Technical Solutions 9-19 in preparing food.
[0047] Technical Solution 28: The food according to Technical Solution 26 or the application according to Technical Solution 27 is characterized in that the food includes one or more foods selected from the group consisting of solid beverages, sugar, fermented beverages, fermented products and modulated milk powder. Preferably, the food is a solid beverage.
[0048] Technical Solution 29: A solid beverage, characterized in that it contains the Kluyveromyces marxianus described in any one of Technical Solutions 1-1.6 or the bacterial agent described in Technical Solution 7 or 8, or the bacterial agent prepared by the fermentation preparation method of any one of Technical Solutions 9-19.
[0049] Technical Solution 30: The solid beverage according to Technical Solution 29 is characterized in that, based on the total weight of the solid beverage, it comprises: 25~30wt% of the bacterial agent, 30~40wt% of oligofructose and 30~45wt% of oligomaltodextrose.
[0050] Technical Solution 31: The solid beverage according to Technical Solution 29 or 30, characterized in that it has the function of inhibiting the activity of hyaluronidase, preferably, at OD600 nm Under the conditions of , the inhibition rate of hyaluronidase by a solution containing solid beverage at a concentration of 1 mg / mL was greater than 40%.
[0051] Beneficial effects of the present invention:
[0052] (1) The present invention has demonstrated through in vitro anti-allergic experiments that the Kluyveromyces marxianus 31691 provided by the present invention has an inhibitory effect on hyaluronidase activity
[0053] (2) The present invention demonstrated, through in vivo anti-allergic experiments, that the Kluyveromyces marxianus 31691 of the present invention reduced type I allergic reactions induced by bovine milk β-lactoglobulin, reduced serum specific IgE antibody levels, helped to restore ileal villus damage, and improved ileal crypt depth. Furthermore, it was demonstrated that the Kluyveromyces marxianus 31691 of the present invention improved spleen corpuscle characteristics, regulated the body's immune function, and had an ameliorative effect on type IV allergic reactions induced by p-dinitrofluorobenzene, effectively alleviating allergic symptoms. BRIEF DESCRIPTION OF THE DRAWINGS
[0054] Figure 1 This is the colony morphology of Kluyveromyces marxianus strain 31691;
[0055] Figure 2 This is a microscopic morphology of Kluyveromyces marxianus strain 31691;
[0056] Figure 3 (A) shows the inhibition rate of Kluyveromyces marxianus 31691 particles and Lactobacillus rhamnosus LGG powder on hyaluronidase activity;
[0057] FIG3 (B) shows the inhibition rate of Kluyveromyces marxianus 31691 particles and Kluyveromyces marxianus AMCC 30634 particles on hyaluronidase activity; in the figure, Kluyveromyces marxianus CCTCC No: M 2023217 is represented by Kluyveromyces marxianus AMCC 30634;
[0058] Figure 4 Flowchart of the cycle of gavage and injection of allergens to mice;
[0059] Figure 5 Scoring results for allergic symptoms in mice;
[0060] Figure 6 This is the result graph of mouse serum specific IgE antibody level;
[0061] Figure 7 The figure shows the measurement results of the ileal crypt depth of mice;
[0062] Figure 8 This is an image of mouse ileum tissue section;
[0063] Figure 9 This is an image of a mouse spleen tissue section;
[0064] Figure 10 is the mouse organ index;
[0065] Figure 11 is the degree of ear swelling in mice;
[0066] Figure 12 is the inhibition rate of probiotic solid beverage on hyaluronidase activity.
[0067] Culture collection information
[0068] The present invention provides Kluyveromyces marxianus ( Kluyveromyces marxianus ) 31691, deposited in the China Center for Type Culture Collection on July 17, 2024, with the deposit number CCTCC NO: M20241589, deposit address: Wuhan University, Wuhan, China, Postal Code: 430072; Tel: 027-68754052.
[0069] The present invention provides Kluyveromyces marxianus ( Kluyveromyces marxianus ) AMCC 30634, which was deposited in the China Center for Type Culture Collection on February 27, 2023, with the deposit number CCTCC NO: M 2023217, and the deposit address is: Wuhan University, Wuhan, China, Postal Code: 430072; Tel: 027-68754052. DETAILED DESCRIPTION
[0070] Intestinal microecological imbalance is generally associated with the occurrence and development of allergic diseases. Probiotics play a role in the prevention and treatment of allergic diseases by correcting microecological imbalance, maintaining the mucosal barrier, and regulating immune function. They can be used for the prevention and adjunctive treatment of allergic diseases. The principle is that the cellular components and metabolites of probiotics can stimulate dendritic cells and macrophages of the innate immune system and directly regulate the response of mast cells. Through Toll-like receptors (TLRs), they participate in innate and adaptive immune responses, regulate the Th1 / Th2 balance of helper T cells, and ultimately alleviate allergic symptoms. However, the probiotics isolated and screened for anti-allergic properties in existing technologies are mainly derived from Lactobacillus and Bifidobacterium. However, there is a lack of yeasts with superior anti-allergic properties, especially Kluyveromyces marxianus.
[0071] To address the problems existing in the above-mentioned prior art, the present invention provides a Kluyveromyces marxianus yeast, a bacterial agent, and its preparation and use. To better understand the technical solution of the present invention, the technical solution of the present invention is explained clearly and completely below in conjunction with the specific embodiments. It should be noted that the contents of the specific embodiments are merely specific implementations and explanations of the technical solution of the present invention and should not be construed as limiting the scope of protection of the present invention.
[0072] In some specific embodiments, the present invention provides a Kluyveromyces marxianus, wherein the Kluyveromyces marxianus is Kluyveromyces marxianus ( Kluyveromyces marxianus ) 31691, deposited with the China Center for Type Culture Collection (CCTCC) under the accession number CCTCC NO: M 20241589. The colonies of this fungus are creamy white, smooth, flat, and sticky. Microscopically, they are oblong, oval, or amorphous, solitary or opposite, budding, and measure 4.5-16.5 × 2.5-6.5 μm.
[0073] In some specific embodiments, the present invention provides a bacterial agent containing the Kluyveromyces marxianus, wherein the viable count of the Kluyveromyces marxianus in the bacterial agent is 10-30 billion CFU / g.
[0074] Preferably, in some specific embodiments, the bacterial agent provided by the present invention has the function of improving immune function and / or having anti-allergic function.
[0075] Preferably, in some specific embodiments, the bacterial agent provided by the present invention can be used as a food, a health product or a medicine that assists in relieving allergies, and can also be used as a food, a health product or a medicine that helps enhance immunity, to prevent and assist in the treatment of allergic diseases.
[0076] Preferably, in some specific embodiments, the number of viable bacteria of Kluyveromyces marxianus per gram of the bacterial agent may be 10 billion CFU, 11 billion CFU, 12 billion CFU, 13 billion CFU, 14 billion CFU, 15 billion CFU, 16 billion CFU, 17 billion CFU, 18 billion CFU, 19 billion CFU, 20 billion CFU, 21 billion CFU, 22 billion CFU, 23 billion CFU, 24 billion CFU, 25 billion CFU, 26 billion CFU, 27 billion CFU, 28 billion CFU, 29 billion CFU or 30 billion CFU, or the number of viable bacteria of Kluyveromyces marxianus per gram of the bacterial agent within a numerical range consisting of any two of the above specific values as endpoints.
[0077] In some specific embodiments, the present invention provides a fermentation preparation method of the bacterial agent, characterized in that it includes the following steps: fermenting and culturing the amplified Kluyveromyces marxianus.
[0078] Preferably, the culture medium for the expansion culture comprises: one or more of glucose, yeast extract, KH2PO4 and MgSO4∙7H2O,
[0079] Preferably, the culture medium for the expansion culture is a combination of glucose, yeast extract, KH2PO4 and MgSO4∙7H2O;
[0080] More preferably, the expansion culture medium is prepared with water, wherein each L of the expansion culture medium contains 95-105 g of glucose, and / or 15-25 g of yeast extract, and / or 0.5-1.5 g of KH2PO4, and / or 0.5-1.5 g of MgSO4∙7H2O.
[0081] In some specific embodiments, the culture medium used for fermentation culture is a seed culture medium, wherein the seed culture medium includes glucose, one or more of MgSO4∙7H2O, ZnSO4∙7H2O, FeSO4∙7H2O, yeast extract, ammonium sulfate, potassium chloride, sodium chloride, calcium chloride, biotin, niacin, D-calcium pantothenate, VB1, VB2, VB6, 20% ammonia water, NH4H2PO4 and copper sulfate pentahydrate,
[0082] Preferably, the seed culture medium is a combination of glucose, MgSO4∙7H2O, ZnSO4∙7H2O, FeSO4∙7H2O, yeast extract, ammonium sulfate, potassium chloride, sodium chloride, calcium chloride, biotin, niacin, D-calcium pantothenate, VB1, VB2, VB6, ammonia water with a mass concentration of 15%-20%, NH4H2PO4 and copper sulfate pentahydrate.
[0083] More preferably, the seed culture medium is prepared with water, wherein each L of the seed culture medium contains 150-200 g of glucose, and / or 2-2.5 g of MgSO4∙7H2O, and / or 0.1-0.5 g of ZnSO4∙7H2O, and / or 0.01-0.05 g of FeSO4∙7H2O, and / or 1-2 g of yeast extract, and / or 18-22 g of ammonium sulfate, and / or 3-5 g of potassium chloride, and / or 2-3 g of sodium chloride, and / or 0.5-1 g of calcium chloride, and / or Biotin 0.001-0.005g, and / or niacin 0.03-0.04g, and / or D-calcium pantothenate 0.005-0.01g, and / or VB1 0.005-0.01g, and / or VB2 0.001-0.0015g, VB6 0.003-0.00375g, and / or 10-15mL of ammonia water with a mass concentration of 15-20%, and / or 1-2g of NH4H2PO4, and / or 0.001-0.005g of ammonia copper sulfate pentahydrate.
[0084] It should be noted that the yeast extract used in the preparation of culture media in the present invention primarily serves as an organic nitrogen source, present in the culture medium to provide the nitrogen necessary for microbial growth during expansion or fermentation cultures. Common organic nitrogen sources, such as yeast extract powder and yeast extract, decompose in the seed culture medium, releasing amino acids and small peptides, which serve as nitrogen sources for microbial growth. In other words, when yeast extract is used as a common organic nitrogen source in the preparation of fermentation or seed culture media in the present invention, its source is not particularly limited; it can be commercially available or homemade. As long as the commercially available or homemade yeast extract has a total nitrogen content of 10.0 wt% or greater and an amino nitrogen content of 5.0 wt% or greater, it can be used in the present invention.
[0085] Preferably, based on the weight of the yeast extract, the yeast extract further comprises: 2-2.5 ppm of vitamin B1, 37-40 ppm of vitamin B2, 113-116 ppm of vitamin B5, 15-20 ppm of vitamin B6, 6-10 ppm of vitamin B7, 25-28 ppm of vitamin B9, 3205-3210 ppm of choline, 1575-1580 ppm of inositol, 325-330 ppm of niacin, and 2-4 ug of vitamin B12 per 100 g of the yeast extract.
[0086] Preferably, based on the weight of the yeast extract, the yeast extract further comprises: 30.3-40.85% free amino acids and 51-70.5% hydrolyzed amino acids.
[0087] The free amino acid content includes, based on the weight of the yeast extract, 1-2% free aspartic acid, 2-3% free threonine, 1.5-2% free serine, 6.5-7% free glutamic acid, 1-1.5% free glycine, 4-5% free alanine, 0.1-0.15% free cysteine, 2-3% free valine, 0.5-1% free methionine, 2-2.5% free isoleucine, 3.3-3.7% free leucine, 0.5-1% free tyrosine, 1.5-2% free phenylalanine, 2-2.5% free lysine, 0.1-1% free histidine, 1.5-2.5% free arginine and 0.5-1% free proline.
[0088] The hydrolyzed amino acid content includes, based on the weight of the yeast extract, 6-6.5% hydrolyzed aspartic acid, 2-3% hydrolyzed threonine, 2-3% hydrolyzed serine, 10-15% hydrolyzed glutamic acid, 2-3% hydrolyzed glycine, 5-6% hydrolyzed alanine, 0.5-1% hydrolyzed cysteine, 3-4% hydrolyzed valine, 0.5-1% hydrolyzed methionine, 3-4% hydrolyzed isoleucine, 4-5% hydrolyzed leucine, 1-2% hydrolyzed tyrosine, 2-3% hydrolyzed phenylalanine, 4-5% hydrolyzed lysine, 1-2% hydrolyzed histidine, 3-4% hydrolyzed arginine and 2-3% hydrolyzed proline.
[0089] In some specific embodiments, the present invention also provides the use of the bacterial agent or the bacterial agent prepared by the fermentation preparation method in the preparation of health products that assist in relieving allergic reactions and / or the preparation of medicines that relieve allergic reactions.
[0090] Preferably, in some embodiments, the allergic reaction is alleviation of type I allergic reaction and / or type IV allergic reaction.
[0091] More preferably, in some embodiments, the allergic reaction is alleviation of type I allergic reaction induced by milk β-lactoglobulin, and / or alleviation of type IV allergic reaction induced by dinitrofluorobenzene.
[0092] Most preferably, when alleviating type I allergic reactions, the effective amount of the bacterial agent is 0.01-0.1 mg / g per gram of the subject's body weight.
[0093] Most preferably, when allergic reaction IV is alleviated, the effective amount of the bacterial agent is 0.01-0.1 mg / g per gram of the subject's body weight.
[0094] It should be noted that, in some specific embodiments, the bacterial agent is administered orally or non-orally, preferably orally.
[0095] It should be noted that, in some specific embodiments, the bacterial agents provided by the present invention are usually used as test subjects in mammals, for example, humans, primates, sheep, horses, camels, pigs, dogs, cats, rats or mice, etc. The bacterial agents provided by the present invention can be applied in vivo or in vitro to the test subjects.
[0096] It should be noted that the effective dosage for different subjects is not exactly the same and may vary depending on the intended biological endpoint, the condition being treated, the route of administration, and the subject's age, weight, health status, treatment course, individual differences, and dosage form. Those skilled in the art can determine the effective dosage range of the bacterial agent based on individual needs, where the effective dosage refers to an amount sufficient to elicit the desired biological response.
[0097] It should be noted that, in some specific embodiments, the bacterial agent further includes a pharmaceutically acceptable excipient, auxiliary material, or carrier. The present invention does not particularly limit the specific type of pharmaceutically acceptable excipient, auxiliary material, or carrier. As long as the bacterial agent can be prepared using conventional preparation methods and pharmaceutically acceptable auxiliary materials based on common technical knowledge in the art, and the dosage form includes one or more dosage forms selected from the group consisting of powders, tablets, capsules, granules, pills, liquid drops, gels, and pastes, it can be used in the present invention.
[0098] In order to better understand the technical solution of the present invention, the technical solution of the present invention is described in detail below in conjunction with specific embodiments.
[0099] Unless otherwise specified, the various reagents and instruments used in the examples of the present invention are conventional commercial products. The sources of the experimental reagents used in the present invention are shown in Table 1 (1) and Table 1 (2), and the sources of the experimental instruments used in the present invention are shown in Table 2.
[0100] Table 1 (1). Experimental reagent information
[0101]
[0102] Table 1 (2). Experimental reagent information table
[0103]
[0104] Table 2. Experimental instrument information
[0105]
[0106] The trace elements contained in the yeast extract (model: FM888) used in the examples are as follows: vitamin B1 2.3 ppm, vitamin B2 38.8 ppm, vitamin B5 115.0 ppm, vitamin B6 18.0 ppm, vitamin B7 7.9 ppm, vitamin B9 26.7 ppm, vitamin B12 2.3 (ug / 100g), choline 3206.0 ppm, inositol 1577.7 ppm, and niacin 328.0 ppm.
[0107] The yeast extract (model: FM888) used in the example contains 35.1% free amino acids.
[0108] and hydrolyzed amino acids 61.21%.
[0109] The free amino acid content is specifically as follows: based on the weight of the yeast extract, free aspartic acid 1.6%, free threonine 2.1%, free serine 1.7%, free glutamic acid 6.7%, free glycine 1.2%, free alanine 4.2%, free cysteine 0.1%, free valine 2.7%, free methionine 0.8%, free isoleucine 2.2%, free leucine 3.5%, free tyrosine 0.9%, free phenylalanine 1.8%, free lysine 2.3%, free histidine 0.5%, free arginine 2.0%, and free proline 0.8%.
[0110] The hydrolyzed amino acid content is specifically as follows: based on the weight of the yeast extract, the hydrolyzed aspartic acid is 6.23%, the hydrolyzed threonine is 2.71%, the hydrolyzed serine is 2.73%, the hydrolyzed glutamic acid is 12.33%, the hydrolyzed glycine is 2.74%, the hydrolyzed alanine is 5.17%, the hydrolyzed cysteine is 0.61%, the hydrolyzed valine is 3.84%, the hydrolyzed methionine is 0.84%, the hydrolyzed isoleucine is 3.65%, the hydrolyzed leucine is 4.72%, the hydrolyzed tyrosine is 1.65%, the hydrolyzed phenylalanine is 2.68%, the hydrolyzed lysine is 4.63%, the hydrolyzed histidine is 1.19%, the hydrolyzed arginine is 3.30%, and the hydrolyzed proline is 2.19%.
[0111] The preparation methods of the reagents involved in the embodiments are as follows:
[0112] 1. Preparation of Sodium Phosphate Buffer: Mix 1120.54 mg of disodium hydrogen phosphate dodecahydrate, 312 mg of sodium dihydrogen phosphate dihydrate, 900 mg of sodium chloride, and 256 mL of deionized water. Sterilize at 115°C for 20 minutes to obtain a stock solution of sodium phosphate buffer. Next, mix 10 mg of bovine serum albumin with 100 mL of the stock solution to obtain a 20 mM sodium phosphate buffer with a pH of 7.00.
[0113] 2. Preparation of hyaluronic acid solution: Mix 4.68 g of sodium dihydrogen phosphate dihydrate, 50 mg of hyaluronic acid, and 98.92 mL of ultrapure water, and fully dissolve in a 60°C water bath to obtain a hyaluronic acid solution with a pH of 5.35.
[0114] 3. Preparation of pH = 3.75 acetate buffer: Mix 787.2 mg of anhydrous sodium acetate, 5.1 mL of glacial acetic acid, and 736 mL of deionized water to obtain pH = 3.75 acetate buffer.
[0115] 4. Preparation of acetate buffer with pH = 5.60: Mix 0.2 M glacial acetic acid solution and 0.2 M sodium acetate solution in a volume ratio of 1:9.5 and adjust the pH to 5.60 using 0.2 M glacial acetic acid solution or 0.2 M sodium acetate solution to obtain acetate buffer with pH = 5.60.
[0116] 4. Preparation of acidic albumin solution: Mix 50 mg of BSA and 50 mL of acetate buffer (pH 3.75) to obtain acidic albumin solution.
[0117] 5. Preparation of 10 U / mL hyaluronidase solution: Mix hyaluronidase powder with acetate buffer (pH = 5.60) to obtain a hyaluronidase stock solution with a concentration of 2500 U / mL. Then, dilute the 2500 U / mL hyaluronidase stock solution to 10 U / mL with phosphate buffer (pH 7.00) to obtain a 10 U / mL hyaluronidase solution.
[0118] 6. Preparation of 0.3 g / mL sodium carboxymethyl cellulose solution: Mix 3.00 g of sodium carboxymethyl cellulose powder and distilled water, dilute to 1000 mL, and fully dissolve in a 60°C water bath to obtain a 0.3% sodium carboxymethyl cellulose solution.
[0119] 7. Preparation of 4 mg / mL β-lactoglobulin solution: Mix 0.0400 g of β-lactoglobulin powder and normal saline and dilute to 10 mL to obtain a 4 mg / mL β-lactoglobulin solution.
[0120] The preparation process of the mouse ileum tissue paraffin sections in Example 4 is as follows:
[0121] (1) Fixation: Fix the ileum tissue with a fixative for more than 24 hours. Remove the ileum tissue from the fixative and trim the target area with a scalpel in a fume hood. Place the trimmed tissue and the corresponding label in a dehydration box. (2) Dehydration: Place the dehydration box in a hanging basket and dehydrate it in a dehydrator using alcohol in a gradient manner. Specifically, dehydrate with 75% alcohol for 4 hours, 85% alcohol for 2 hours, 90% alcohol for 2 hours, 95% alcohol for 1 hour, anhydrous ethanol I for 30 minutes, and anhydrous ethanol II for 30 minutes. (3) Transparency: After dehydration, treat the tissue in a solution of anhydrous ethanol and xylene (1:1) for 10 minutes, xylene I for 10 minutes, and xylene II for 10 minutes to make it transparent. (4) Wax dipping: Wax dipping the dehydration box in sequence. Specifically, paraffin I was melted at 65°C for 1 hour, paraffin II was melted at 65°C for 1 hour, and paraffin III was melted at 65°C for 1 hour. (5) Embedding: The tissue soaked in wax was embedded in an embedding machine. First, the melted wax was placed in the embedding frame. Before the wax solidified, the tissue was taken out of the dehydration box and placed in the embedding frame according to the requirements of the embedding surface and labeled accordingly. Cooled in a -20°C freezer. After the wax solidified, the wax block was taken out of the embedding frame and trimmed. (6) Sectioning: The trimmed wax block was placed on a paraffin slicer and sliced to a thickness of 4 μm. The slices were floated on 40°C warm water on the spreader to flatten the tissue. Then, the slices were picked up with a glass slide and baked in a 60°C oven until the water in the slices was dried and the wax was melted. Paraffin sections of mouse ileum tissue were obtained.
[0122] The preparation process of the paraffin sections of mouse ileum tissue stained with hematoxylin and eosin in Example 4 is as follows: (1) The paraffin sections of ileum tissue are sequentially treated with xylene I for 20 min, xylene II for 20 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, and 75% alcohol for 5 min, and then washed with water. (2) The sections obtained in step (1) are stained with hematoxylin staining solution for 3 min, then washed with water, then differentiated with differentiation solution, washed with water, and blued with bluing solution, then rinsed with running water. (3) The sections obtained in step (2) are sequentially dehydrated with 85% alcohol for 5 min, then dehydrated with 95% alcohol for 5 min, and then stained with eosin staining solution for 5 min. (4) The slices obtained in step (3) were sequentially placed in anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, anhydrous ethanol III for 5 min, dimethylbenzene I for 5 min, and xylene II for 5 min to make them transparent, and then sealed with neutral gum to complete the staining of the mouse ileum tissue paraffin sections using hematoxylin and eosin.
[0123] The origin and identification of the Kluyveromyces marxianus AMCC 30634 strain used in the examples are as follows:
[0124] The fermented dairy product samples collected in Tibet were dissolved in sterile water and mixed evenly. The bacterial suspension was aspirated and serially diluted 10-fold to prepare 10 -5 , 10 -6 The bacterial suspension was spread on YPD medium and incubated at 30°C for 24-48 hours. The yeast morphology was observed under a microscope and the characteristics of the single colonies on the plate were observed. The results showed that the yeast strain had a cheese-like texture, a milky white color, a smooth surface, neat edges, an oval microscopic morphology, and budding reproduction. It was streaked and purified twice, inoculated on YPD slant medium, and stored at 4°C. The yeast strain genome was extracted, and the yeast ITS sequence was amplified using primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID No.7) and ITS4 (5'-TCC TCCGCTTATTGATATGC-3', SEQ ID No.8). After 1% gel electrophoresis and sequencing, the yeast was compared with the sequence on GenBank by blast analysis. The sequence similarity was greater than 99%, indicating that the strain was the same species. Combined with morphological analysis and molecular identification, the strain was identified as Kluyveromyces marxianus ( Kluyveromyces marxianus ), the strain number is AMCC30634, and its ITS sequence is shown in SEQ ID No. 9. The strain was deposited in the China Center for Type Culture Collection on February 27, 2023, with the deposit number CCTCC NO: M 2023217.
[0125] SEQ ID No.9:
[0126] CCAACGGGGATTGCCTTAGTACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCGACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTC ATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAA CAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGG ATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGCCCGTCTTGAACCCACGGACCA
[0127] Example 1 Isolation and identification of strains
[0128] (1) Isolation and purification of strains: Xinjiang Urumqi yogurt was mixed with sterile water and then diluted in a 10-fold series gradient to 10 -5 , 10 -6A bacterial suspension of 1% yeast strains was plated on MEA plates supplemented with 1% chloramphenicol, with 200 μL of each suspension being plated and incubated at 28°C for 72 hours. Based on the morphological characteristics of the colonies, single colonies suspected of yeast were selected from the MEA plates and incubated in MEA liquid medium at 28°C for 48 hours to obtain a bacterial suspension. A loopful of this suspension was streaked onto a fresh MEA plate and purified at 28°C for 48 hours. The streak purification was repeated three times. The purified suspension was inoculated onto MEA plates and incubated at 28°C for 48 hours. Colony morphology was then observed. A 20 μL aliquot of the purified suspension was then placed on a glass slide and observed under an optical microscope with a 10x eyepiece and a 40x objective. A strain was obtained with a smooth, flat, white, and creamy texture. Microscopically, the plants are oblong, oval or amorphous, solitary or opposite, budding, and 4.5-16.5×2.5-6.5μm in size.
[0129] The genome of this strain was extracted. Using forward primer NL-1 (5'-GCATATCAATAAGCGGAAAAG-3', SEQ ID No. 1) and reverse primer NL-4 (5'-GGTCCGTGTTTCAAGACGG-3', SEQ ID No. 2), the PCR protocol was as follows: 94°C pre-denaturation for 5 min, 94°C denaturation for 50 s, 52°C annealing for 50 s, and 72°C extension for 50 s, for a total of 30 cycles; and 72°C extension for 8 min. The gene sequence of the 26S rDNA D1 / D2 region of this strain was amplified. After verification by 1% gel electrophoresis and sequencing, the sequence was compared with sequences in GenBank by blast analysis. Sequence similarity was greater than 99%, indicating identity with the species. The sequence of the 26S rDNA D1 / D2 region of this strain is shown in SEQ ID No. 3.
[0130] SEQ ID No.3:
[0131] AGCTCAAATT GAAATCTGG CGTCTTCGAC GTCCGAGTTG TAATTTGAAG
[0132] AAGGCGACTT TGTAGCTGGT CCTTGTCTAT GTTCCTTGGA ACAGGACGTC
[0133] ATAGAGGGTG AGAATCCCGT GTGGCGAGGA TCCCAGTTAT TTGTAAAGTG
[0134] CTTTCGACGA GTCGAGTTGT TTGGGAATGC AGCTCTAAGT GGGTGGTAAA
[0135] TTCCATCTAA AGCTAAATAT TGGCGAGAGA CCGATAGCGA ACAAGTACAG
[0136] TGATGGAAAG ATGAAAAGAA CTTTGAAAG GAGTGAAAA AGTACGTGAA
[0137] ATTGTTGAAA GGGAAGGGCA TTTGATCAGA CATGGCGTTT GCTTCGGCTT
[0138] TCGCTGGGCC AGCATCAGTT TTAGCGGTTG GATAAATCCT CGGGAATGTG
[0139] GCTCTGCTTC GGTAGAGTGT TATAGCCCGT GGGAATACAG CCAGCTGGGA
[0140] CTGAGGATTG CGACTTTTGT CAAGGATGCT GGCGTAATGG TTAAATGCCG
[0141] CCCGTCTTG
[0142] The genome of this strain was extracted. Using primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID No. 4) and ITS4 (5'-TCCTCCGCTTATTGATATGC-3', SEQ ID No. 5), the PCR protocol was as follows: 94°C pre-denaturation for 4 minutes, 94°C denaturation for 45 seconds, 55°C annealing for 45 seconds, and 72°C extension for 1 minute for 30 cycles; the final extension was 72°C for 10 minutes. The gene sequence of the ITS rDNA segment of this strain was amplified, verified by 1% gel electrophoresis, sequenced, and aligned with sequences in GenBank by blast analysis. Sequences showed greater than 99% similarity, indicating identity with the species. The ITS rDNA sequence of this strain is shown as SEQ ID No. 6 below.
[0143] SEQ ID No.6:
[0144] GATTATGAAT GAATAGATTA CTGGGGGAAT CGTCTGAACA AGGCCTGCGC
[0145] TTAATTGCGC GGCCAGTTCT TGATTCTCTG CTATCAGTTT TCTATTTCTC
[0146] ATCCTAAACA CAATGGAGTT TTTTCTCTAT GAACTACTTC CCTGGAGAGC
[0147] TCGTCTCTCC AGTGGACATA AACACAAACA ATATTTTGTA TTATGAAAAA
[0148] CTATTATACT ATAAAATTTA ATATTCAAAA CTTTCAACAA CGGATCTCTT
[0149] GGTTCTCGCA TCGATGAAGA ACGCAGCGAA TTGCGATATG TATTGTGAAT
[0150] TGCAGATTTT CGTGAATCAT CAAATCTTTG AACGCACATT GCGCCCTCTG
[0151] GTATTCCAGG GGGCATGCCT GTTTGAGCGT CATTTCTCTC TCAAACCTTT
[0152] GGGTTTGGTA GTGAGTGATA CTCGTCTCGG GTTAACTTGA AAGTGGCTAG
[0153] CCGTTGCCAT CTGCGTGAGC AGGGCTGCGT GTCAAGTCTA TGGACTCGAC
[0154] TCTTGCACAT CTACGTCTTA GGTTTGCGCC AATTCGTGGT AAGCTTGGGT
[0155] CATAGAGACT CATAGGTGTT ATAAAGACTC GCTGGTGTTT GTCTCCTTGA
[0156] GGCATACGGC TTTAACCAAA ACTCTCAAAG TTTGACCTCA AATCA
[0157] In summary, combined with morphological analysis and molecular identification, this strain is Kluyveromyces marxianus ( Kluyveromyces marxianus ) 31691, deposited in the China Center for Type Culture Collection on July 17, 2024, with the deposit number CCTCC NO: M20241589. Figure 1 Shown is the colony morphology of Kluyveromyces marxianus strain 31691; Figure 2 Shown is the microscopic morphology of Kluyveromyces marxianus strain 31691.
[0158] Example 2
[0159] 1. Preparation of granular Kluyveromyces marxianus 31691 inoculum:
[0160] (1) Preparation of seed solution: Take a ring of Kluyveromyces marxianus 31691 and culture it in a shake flask containing 500 mL of shake flask medium at 200 rpm and 30°C for 24 h to obtain seed solution. The shake flask medium (g / L) is prepared as follows: 100 g of glucose, 20 g of yeast extract, 1 g of KH2PO4, 1 g of MgSO4∙7H2O, and distilled water are mixed and the volume is adjusted to 1 L. The pH value is adjusted to 5.2-5.4, and the shake flask medium is sterilized at 121°C for 20 min to obtain the shake flask medium.
[0161] (2) Preparation of fermentation liquid: The seed liquid was inoculated into a fermentation tank containing 9L seed culture medium, and fermentation was carried out under the conditions of initial air volume 9L / min, initial rotation speed 200rpm, and temperature 30℃. The fermentation was terminated when the air volume reached 30L / min, the rotation speed reached 600rpm, and the temperature reached 34℃ (the fermentation temperature at this time was 24h), and the fermentation liquid was obtained. During the fermentation period, a solution with a concentration of 30% glucose, a solution with a concentration of 25% ammonium sulfate, a solution with a concentration of 20% ammonia water, and a solution with a concentration of 3% NH4H2PO4 were added.
[0162] The seed culture medium is prepared with distilled water. Based on the volume of the seed culture medium, the concentrations of the components in the seed culture medium are as follows: glucose concentration is 150 g / L, MgSO4∙7H2O concentration is 2.25 g / L, ZnSO4∙7H20 concentration is 0.5 g / L, FeSO4∙7H2O concentration is 0.04 g / L, yeast extract concentration is 1.5 g / L, ammonium sulfate concentration is 20.5 g / L, potassium chloride concentration is 4.8 g / L, and sodium chloride concentration is 3. g / L, the concentration of calcium chloride is 0.9g / L, the concentration of biotin is 0.005g / L, the concentration of niacin is 0.0375g / L, the concentration of calcium D-pantothenate is 0.01g / L, the concentration of VB1 is 0.01g / L, the concentration of VB2 is 0.0015g / L, the concentration of VB6 is 0.00375g / L, the concentration of 20% ammonia water is 15mL / L, the concentration of NH4H2PO4 is 2.0g / L and the concentration of copper sulfate pentahydrate is 0.004g / L.
[0163] (3) Separation: Centrifuge the fermentation broth at 6000 rpm for 5 min and collect the yeast slurry.
[0164] (4) Filtration and filter pressing: Yeast paste and water are mixed in a weight ratio of 1:1 to obtain a mixed solution. Then, 1.5% sorbitan monostearate is added to the mixed solution based on the dry weight of the yeast (dried to a moisture content of less than 5%) and filtered for 40 minutes to obtain a filter cake. The filter cake is further filtered for 2 hours to obtain fresh yeast.
[0165] (5) Drying: The fresh yeast was dried at 70°C with air drying to 45°C, and then further dried at 45°C for 45 minutes to obtain Kluyveromyces marxianus 31691 granules, i.e., granular Kluyveromyces marxianus 31691 inoculum, in which the number of viable bacteria was 25 billion CFU / g.
[0166] 2. The preparation method of the granular Kluyveromyces marxianus AMCC 30634 inoculum is the same as the preparation method of the granular Kluyveromyces marxianus 31691 inoculum.
[0167] Example 3
[0168] 1. Determine the inhibition rate of Kluyveromyces marxianus 31691 particles and Lactobacillus rhamnosus LGG powder on hyaluronidase activity. The specific steps are as follows:
[0169] (1) Kluyveromyces marxianus 31691 group: 500 μL of 10 U / mL hyaluronidase solution and 500 μL of sample solution were mixed in a centrifuge tube and incubated at 37°C for 10 min. Then, 5 mL of acidic albumin solution was added and reacted at room temperature for 10 min. After the reaction, the absorbance at 600 nm was immediately measured in a microplate reader and the inhibition rate was calculated based on the absorbance. The experiment was repeated 3 times. The sample solution was prepared as follows: Kluyveromyces marxianus 31691 particles were mixed with sodium phosphate buffer to prepare Kluyveromyces marxianus 31691 solutions with a concentration of 1 mg / mL, 5 mg / mL, or 10 mg / mL (i.e., the number of viable Kluyveromyces marxianus in the 1 mg / mL Kluyveromyces marxianus 31691 solution was 2.5×10 7 The number of viable Kluyveromyces marxianus in a 5 mg / mL Kluyveromyces marxianus 31691 solution was 1.25 × 10 8 CFU / mL, the number of viable Kluyveromyces marxianus in a 10 mg / mL Kluyveromyces marxianus 31691 solution was 2.5×10 8 CFU / mL).
[0170] (2) The difference between the Lactobacillus rhamnosus LGG group and the Kluyveromyces marxianus 31691 group is that the sample solution is a 1 mg / mL, 5 mg / mL or 10 mg / mL Lactobacillus rhamnosus LGG solution prepared using Lactobacillus rhamnosus LGG powder.
[0171] The calculation method of the inhibition rate is: inhibition rate (%) = (Bs / As) × 100%.
[0172] Wherein, As is expressed as the absorbance value at 600 nm of a mixed solution of 500 μL sodium phosphate buffer + 500 μL sample solution + 500 μL 10 U / mL hyaluronic acid solution + 5 mL acidic albumin; Bs is expressed as the absorbance value at 600 nm of a mixed solution of 500 μL 10 U / mL hyaluronidase solution + 500 μL sample solution + 500 μL hyaluronic acid + 5 mL acidic albumin.
[0173] It should be noted that the in vitro hyaluronidase inhibition assay is currently one of the primary methods for testing anti-allergic properties. As shown in Figure 3(A), the inhibition rates of K. marxianus 31691 granules and L. rhamnosus LGG powder on hyaluronidase activity show that the inhibition rate of K. marxianus 31691 increased with increasing K. marxianus 31691 solution concentration, and the inhibition of hyaluronidase activity was dose-dependent. When the concentration of K. marxianus 31691 solution reached 5 mg / mL, the inhibition rate was greater than that of L. rhamnosus LGG.
[0174] 2. Determine the inhibition rate of Kluyveromyces marxianus 31691 particles and Kluyveromyces marxianus AMCC 30634 particles on hyaluronidase activity. The specific steps are as follows:
[0175] (1) The method for preparing a 5 mg / mL Kluyveromyces marxianus 31691 solution and the method for detecting the inhibition rate of hyaluronidase activity were the same as those in step (1). The results are shown in FIG3 (B).
[0176] (2) The method for preparing a 5 mg / mL Kluyveromyces marxianus AMCC 30634 solution and the method for detecting the inhibition rate of hyaluronidase activity are the same as those in step (1).
[0177] As shown in FIG3 (B), FIG3 (B) shows the inhibition rate of Kluyveromyces marxianus 31691 particles and Kluyveromyces marxianus AMCC30634 particles on hyaluronidase activity. The results show that when the concentration of Kluyveromyces marxianus 31691 solution is 5 mg / mL, the inhibition rate is greater than that of Kluyveromyces marxianus AMCC 30634.
[0178] Example 4 Effect of Kluyveromyces marxianus 31691 on Type I hypersensitivity reactions induced by bovine milk β-lactoglobulin
[0179] (1) Establishment of animal model: The animal model was induced by bovine milk β-lactoglobulin. Twenty purebred female BalB / c mice (6 weeks old, Three Gorges University Animal Experiment Center) were used; Hubei Province Laboratory Animal Quality Certificate: No. 42010200009573, Experimental Unit Use Permit Number: SYXK (E) 2022-0061, Animal Sales Unit Permit Number: SCXK (E) 2022-0012. The animals were placed in an environment with a temperature of 23±2℃ and a humidity of 55%~65%, housed in separate cages, fed with ordinary feed, and allowed to eat and drink freely for adaptive feeding. After 7 days of adaptive feeding, the animals were randomly divided into 4 groups, with 5 mice in each group, namely blank group (CK), model group (MX), positive group (YX) and Kluyveromyces marxianus 31691 group (KLW). Then, each group of mice was gavaged and injected with allergens. The cycle of gavage and injection of allergens is as follows. Figure 4 The specific methods of gavage and injection of allergens for each group of mice are as follows:
[0180] Blank group: mice were gavaged with 0.01 mL of 0.3% sodium carboxymethylcellulose solution per gram of body weight for 28 days;
[0181] Model group: 0.01 mL of 0.3% sodium carboxymethylcellulose solution was administered orally per gram of mouse body weight for 28 days;
[0182] Positive group: 0.01 mL of cetirizine hydrochloride positive group solution was gavaged per gram of mouse body weight for 28 days. The preparation method of cetirizine hydrochloride positive group solution was as follows: 0.0010 g of cetirizine hydrochloride was mixed with 50 mL of 0.3% sodium carboxymethyl cellulose solution to obtain the cetirizine hydrochloride positive group solution.
[0183] The Kluyveromyces marxianus 31691 group was gavaged with 0.01 mL of a 10 mg / mL Kluyveromyces marxianus 31691 solution per gram of mouse body weight for 28 days. The Kluyveromyces marxianus 31691 solution was prepared by mixing 0.5000 g of Kluyveromyces marxianus 31691 granules with 50 mL of 0.3% sodium carboxymethylcellulose solution.
[0184] (2) Prepare allergen solution: Mix 7 mL of 4 mg / mL β-lactoglobulin with 7 mL of Freund's adjuvant to obtain the allergen solution.
[0185] (3) Allergen induction: The experimental period of allergen induction was 28 days. During the 28 days, the mice in the model group, positive group, and Kluyveromyces marxianus group were injected with 0.2 mL of the allergen solution per mouse per day to induce allergy.
[0186] (4) Allergy symptom scoring: After the last oral administration of CMC-Na to the blank group, and after the last oral administration of β-lactoglobulin to the model group, positive group, and Kluyveromyces marxianus group, the allergic reaction symptoms of mice in each group were observed and scored according to the food allergy symptom scoring table shown in Table 3. The specific results are as follows: Figure 5 The food allergy symptom scoring table is shown in Table 3 below.
[0187] Table 3. Food allergy symptom scoring table
[0188]
[0189] like Figure 5 As shown, Figure 5 Figure 2 shows the results of mouse allergy symptom scores for the blank, model, positive, and Kluyveromyces marxianus 31691 groups. CK represents the blank group, MX represents the model group, YX represents the positive group, and KLW represents the Kluyveromyces marxianus 31691 group. The results show that the CK group was more agile, occasionally scratched their nose, and had normal stool. Compared with the CK group, the MX group developed allergy symptoms, with significant differences in allergy symptom scores (P < 0.01). Compared with the MX group, allergy symptoms were significantly reduced in the YX and KLW groups (P < 0.01).
[0190] (5) Determination of serum specific IgE antibody levels: One hour after the last oral administration, the mice in each group were anesthetized and the eyeballs were removed to collect blood. After standing at 4°C for 3 hours, the blood was centrifuged at 3000 r / min and 4°C for 15 minutes to separate the serum and store it at -80°C for future use. The serum specific IgE antibody levels were determined using the Mouse IgE ELISA Kit. The results are shown in the table below. Figure 6 shown.
[0191] It should be noted that the serum specific IgE antibody level is currently recognized as the most effective evaluation index for detecting type I allergic reactions. Type I allergic reaction is also called immediate hypersensitivity reaction. It is an immune response mediated by specific IgE antibodies that occurs quickly and disappears quickly. When the body is exposed to the same allergen again, this type of reaction will occur. Common type I allergic reactions include: gastrointestinal allergic reactions, such as milk allergy, which manifests as nausea, vomiting and diarrhea. Figure 6 As shown, Figure 6Figure 2 shows the results of measuring serum specific IgE antibody levels in mice in the blank, model, positive, and Kluyveromyces marxianus 31691 groups. CK represents the blank group, MX represents the model group, YX represents the positive group, and KLW represents the Kluyveromyces marxianus 31691 group. The results showed that compared with the CK group, IgE levels in the MX group were significantly elevated (P < 0.01), indicating that β-lactoglobulin induced an increase in serum specific IgE antibody levels. After 28 days of treatment with the test substance, serum specific IgE antibody levels in the KLW group were significantly decreased, similar to the results in the YX group (P < 0.01), indicating that Kluyveromyces marxianus has a certain intervention effect on β-lactoglobulin-induced food allergy.
[0192] (6) Ileum histological analysis and measurement of ileum crypt depth: The mice after eyeball bleeding in step (4) were dissected, the ileum tissue of the mice was peeled off and 4 μm paraffin sections were prepared. The 4 μm paraffin sections were then stained with hematoxylin and eosin, and the ileum tissue sections were observed and photographed under a 40x microscope to obtain images of the ileum tissue sections. The results are as follows: Figure 8 As shown, the ileum tissue section images captured by the microscope were then imported into CaseViewer software to measure the ileum crypt depth of each group of mice. The results are shown in Figure 7 shown.
[0193] like Figure 7 As shown, Figure 7 The graph shows the measurement results of the ileal crypt depth of mice in the blank group, model group, positive group and Kluyveromyces marxianus 31691 group; Figure 8 As shown, Figure 8 Images of mouse ileum tissue sections from the blank, model, positive, and Kluyveromyces marxianus 31691 groups are shown. CK represents the blank group, MX represents the model group, YX represents the positive group, and KLW represents the Kluyveromyces marxianus 31691 group. Results show that the ileal villi in the CK group were plump, without cracks or defects, and tightly arranged. In the MX group, the villi were impaired in integrity, with surface ruptures and increased local damage. In the YX group, the villi were similar in shape to those in the normal group, with smooth, intact surfaces and no obvious breaks. Compared with the MX group, ileal villi damage in the KLW group showed some recovery. Ileal crypt depth in the MX group was significantly shallower (P < 0.01), and significantly improved in the KLW group compared with the MX group (P < 0.05).
[0194] (7) Spleen histological analysis: The mice after eyeball bleeding in step (4) were dissected, the spleen tissues of the mice were peeled off and 4 μm paraffin sections were prepared. The 4 μm paraffin sections were then stained with hematoxylin and eosin, and the spleen tissue sections were observed and photographed under a 100x microscope to obtain images of the spleen tissue sections. The results are as follows: Figure 9 shown.
[0195] It should be noted that the spleen is the largest lymphoid organ and has the functions of storing blood, producing blood, clearing aging red blood cells and conducting immune responses. Figure 9 As shown, Figure 9 Images of mouse spleen tissue sections from the blank, model, positive, and Kluyveromyces marxianus 31691 groups are shown. CK represents the blank group, MX represents the model group, YX represents the positive group, and KLW represents the Kluyveromyces marxianus 31691 group. The results show that in the spleen sections of each group, the CK group had more splenic corpuscles with clear boundaries, while the MX group had fewer splenic corpuscles and inflammatory infiltration, indicating that β-lactoglobulin-induced allergic reactions caused changes in the immune system. Similar to the YX group, the KLW group significantly improved splenic corpuscle characteristics and regulated immune function.
[0196] Example 5 Effect of Kluyveromyces marxianus 31691 on Type IV Hypersensitivity Response Induced by Dinitrofluorobenzene (DNFB)
[0197] (1) Establishment of animal model: The animal model was induced by dinitrofluorobenzene (DNFB). Eighteen male Kunming mice weighing 20±2 g were purchased from the Experimental Animal Center of China Three Gorges University with a license number of SYXK (E) 2017-0061. The animals were placed in an environment with a temperature of 23±2°C and a humidity of 55%~65%, housed in separate cages, fed with ordinary feed, and given free access to food and water for adaptive feeding. After 7 days of adaptive feeding, the mice were randomly divided into two groups of 6 mice each, namely the control group (NC) and the Kluyveromyces marxianus 31691 group (NM). The mice in each group were then gavaged. The specific gavage method is as follows:
[0198] Control group: From day 1 to day 23, mice were gavaged with 0.01 mL of 0.3% sodium carboxymethylcellulose solution per gram of body weight;
[0199] The Kluyveromyces marxianus 31691 group received oral gavage of 0.01 mL of a 10 mg / mL Kluyveromyces marxianus 31691 solution per gram of mouse body weight from day 1 to day 23. The Kluyveromyces marxianus 31691 solution was prepared by mixing 0.5000 g of Kluyveromyces marxianus 31691 granules with 50 mL of 0.3% sodium carboxymethylcellulose solution.
[0200] (2) Sensitization: On the 24th day, the abdominal hair of each group of mice was removed with depilatory cream, with an area of 3×3 cm. 2Sensitization was completed by evenly applying 50 μL of a freshly prepared solution of 1% DNFB in acetone and sesame oil (acetone: sesame oil = 1:1 by volume) to the depilated abdominal skin. This sensitization procedure was repeated on the 25th day. On days 25-27, mice in the control and K. marxianus 31691 groups received an intraperitoneal injection of 0.01 mL of normal saline per gram of mouse. Then, on the 29th day, 20 μL of a freshly prepared solution of 1% DNFB in acetone and sesame oil (acetone: sesame oil = 1:1 by volume) was evenly applied to both sides of the right ear of the mice. After fasting for 12 hours, mice in each group were anesthetized and sacrificed by cervical dislocation on the 30th day.
[0201] (3) Determination of organ index: The liver, spleen and thymus of each group of mice were taken and weighed. Organ index = organ weight / body weight, where organs are: liver, spleen and thymus. The results are as follows Figure 10 shown.
[0202] like Figure 10 As shown, Figure 10 These are the organ indices of mice in the control and Kluyveromyces marxianus 31691 groups, where NC represents the control group and NM represents the Kluyveromyces marxianus 31691 group. The results showed no significant effects on the liver, thymus, or spleen, suggesting that oral administration of Kluyveromyces marxianus 31691 has no significant toxic effects.
[0203] (4) Determination of the degree of delayed allergic reaction in mice: Use a puncher to take 8 mm pieces of left and right ear pieces, weigh them, and calculate the degree of ear swelling (DTH) to represent the degree of delayed allergic reaction in mice. The degree of ear swelling (DTH) = the difference in weight between the left and right 8 mm pieces of ear pieces. The results are as follows: Figure 11 shown.
[0204] It should be noted that type IV allergic reaction, also known as delayed-type hypersensitivity reaction, is mainly mediated by T lymphocytes. 4-Dinitrofluorobenzene (DNFB) is a hapten, which is often used to prepare animal models of allergic contact dermatitis to evaluate the effect of drugs in inhibiting type IV allergic reaction. The difference in ear thickness between the sensitized and non-sensitized sides of mice can indicate the degree of allergic reaction. The smaller the difference, the more obvious the anti-allergic effect. Figure 11 As shown, Figure 11 The following table shows the ear swelling of mice in the control group and the Kluyveromyces marxianus 31691 group, where NC represents the control group and NM represents the Kluyveromyces marxianus 31691 group. The results showed that the ear swelling of the NM group was reduced compared with the NC group (P<0.01), indicating that Kluyveromyces marxianus 31691 has certain anti-allergic activity.
[0205] Application example: Application of Kluyveromyces marxianus 31691 granules in the preparation of probiotic solid beverages
[0206] The preparation method of a probiotic solid beverage comprises the following steps: based on the weight of the probiotic solid beverage, uniformly mixing 25 wt% of Kluyveromyces marxianus 31691 particles, 40 wt% of oligofructose and 35 wt% of oligomaltodextrose to obtain the probiotic solid beverage.
[0207] The inhibition rate of probiotic solid beverage on hyaluronidase activity was determined. The specific steps are as follows: 500 μL of 10 U / mL hyaluronidase solution and 500 μL of sample solution were mixed in a centrifuge tube and incubated at 37°C for 10 min. Then, 5 mL of acidic albumin solution was added and reacted at room temperature for 10 min. After the reaction, the absorbance at 600 nm was immediately measured in a microplate reader and the inhibition rate was calculated based on the absorbance. The experiment was repeated 3 times. The sample solution was prepared as follows: the probiotic solid beverage was mixed with sodium phosphate buffer to prepare a solution of probiotic solid beverage containing Kluyveromyces marxianus 31691 particles at a concentration of 1 mg / mL, 3 mg / mL, 5 mg / mL, 9 mg / mL or 20 mg / mL.
[0208] The calculation method of the inhibition rate is: inhibition rate (%) = (Bs / As) × 100%.
[0209] Wherein, As is expressed as the absorbance value at 600 nm of a mixed solution of 500 μL sodium phosphate buffer + 500 μL sample solution + 500 μL 10 U / mL hyaluronic acid solution + 5 mL acidic albumin; Bs is expressed as the absorbance value at 600 nm of a mixed solution of 500 μL 10 U / mL hyaluronidase solution + 500 μL sample solution + 500 μL hyaluronic acid + 5 mL acidic albumin.
[0210] like Figure 12 As shown, Figure 12 is the inhibition rate of probiotic solid beverage on hyaluronidase activity, where the concentration on the horizontal axis represents the concentration of Kluyveromyces marxianus 31691 particles in the probiotic solid beverage solution. The results show that the probiotic solid beverage has anti-allergic function through in vitro hyaluronidase inhibition test. The enzymatic activity of hyaluronidase is positively correlated with the amount of histamine released. Inhibiting the release of hyaluronidase can effectively reduce the histamine content in the human body and alleviate allergic symptoms. The in vitro hyaluronidase inhibition activity of probiotic solid beverage shows a dose-effect relationship, which is consistent with the performance of single-component Kluyveromyces marxianus. When the concentration is greater than 10 mg / mL, the inhibition rate reaches more than 90%, indicating that it has good anti-allergic function.
[0211] The above embodiments are only for further explanation and understanding of the technical solutions of the present invention, and are not intended to limit the present invention. Any non-prominent substantial features and non-significant improvements made by those skilled in the art on this basis should fall within the scope of protection of the present invention.
Claims
1. A Kluyveromyces marxianus, characterized in that The Kluyveromyces marxianus is Kluyveromyces marxianus ( Kluyveromyces marxianus )31691, which was deposited in China Center for Type Culture Collection (CCTCC) with the deposit number CCTCC NO: M 20241589.
2. The Kluyveromyces marxianus according to claim 1, characterized in that The sequence of the 26S rDNA D1 / D2 segment of Kluyveromyces marxianus is shown in SEQ ID NO.
3.
3. The Kluyveromyces marxianus according to claim 1, characterized in that The sequence of the ITS rDNA of Kluyveromyces marxianus is shown as SEQ ID NO.
6.
4. The Kluyveromyces marxianus according to claim 1, characterized in that The Kluyveromyces marxianus has the property of inhibiting the activity of hyaluronidase.
5. The Kluyveromyces marxianus according to claim 1, characterized in that Possesses properties that alleviate type I allergic reactions.
6. The Kluyveromyces marxianus according to claim 1, characterized in that It has the property of alleviating type IV allergic reactions.
7. The Kluyveromyces marxianus according to claim 5, characterized in that The type I allergic reaction is a type I allergic reaction induced by bovine milk β-lactoglobulin.
8. The Kluyveromyces marxianus according to claim 6, characterized in that The type IV allergic reaction is a type IV allergic reaction induced by dinitrofluorobenzene.
9. A bacterial agent, characterized in that Contains the Kluyveromyces marxianus according to any one of claims 1 to 8.
10. The microbial agent according to claim 9, characterized in that The viable bacterial count of the Kluyveromyces marxianus in the bacterial agent is 10-30 billion CFU / g.
11. A fermentation method for preparing the bacterial agent according to claim 9 or 10, characterized in that: The method comprises the following steps: fermenting and culturing the Kluyveromyces marxianus after amplification and culture.
12. The fermentation preparation method according to claim 11, characterized in that: The steps include: (1) amplifying and culturing the Kluyveromyces marxianus to obtain a seed solution; (2) fermenting the seed solution obtained in step (1) in a seed culture medium to obtain a fermentation solution; (3) The fermentation liquid obtained in step (2) is separated to obtain yeast paste, and the yeast paste is mixed with water and then filtered, pressed and dried to obtain a bacterial agent.
13. The fermentation preparation method according to claim 12, characterized in that: The rotation speed of the expansion culture is 100-250 rpm.
14. The fermentation preparation method according to claim 12, characterized in that: The temperature of the expansion culture is 30-35°C.
15. The fermentation preparation method according to claim 14, characterized in that: The expansion culture time is 24-48h.
16. The fermentation preparation method according to claim 11, characterized in that: The raw materials in the culture medium for expansion culture include one or more substances selected from the group consisting of glucose, yeast extract, KH2PO4 and MgSO4∙7H2O.
17. The fermentation preparation method according to claim 16, characterized in that: In parts by weight, the raw materials in the culture medium for expansion culture contain 95-105 parts of glucose, and / or 15-25 parts of yeast extract, and / or 0.5-1.5 parts of KH2PO4, and / or 0.5-1.5 parts of MgSO4∙7H2O.
18. The fermentation preparation method according to claim 16, characterized in that: The expansion culture medium is prepared with water, wherein each L of the expansion culture medium contains 95-105 g of glucose, and / or 15-25 g of yeast extract, and / or 0.5-1.5 g of KH2PO4, and / or 0.5-1.5 g of MgSO4∙7H2O.
19. The fermentation preparation method according to claim 12, characterized in that: The fermentation temperature is 30-35°C.
20. The fermentation preparation method according to claim 12, characterized in that: The air volume at the beginning of fermentation culture is 6-12L / min.
21. The fermentation preparation method according to claim 12, characterized in that: The rotation speed at the beginning of fermentation culture is 100-250 rpm.
22. The fermentation preparation method according to claim 12, characterized in that: The air volume at the end of fermentation culture is 25-35L / min.
23. The fermentation preparation method according to claim 12, characterized in that: The rotation speed at the end of fermentation culture is 500-650 rpm.
24. The fermentation preparation method according to claim 12, characterized in that: The temperature at the end of the fermentation culture is 30-35°C.
25. The fermentation preparation method according to claim 12, characterized in that: The raw materials in the seed culture medium include one or more substances selected from the group consisting of glucose, MgSO4∙7H2O, ZnSO4∙7H2O, FeSO4∙7H2O, yeast extract, ammonium sulfate, potassium chloride, sodium chloride, calcium chloride, biotin, niacin, D-calcium pantothenate, VB1, VB2, VB6, ammonia water with a mass concentration of 15-20%, NH4H2PO4 and copper sulfate pentahydrate.
26. The fermentation preparation method according to claim 12, characterized in that: The seed culture medium is prepared with water, wherein each L of the seed culture medium contains 150-200 g of glucose, and / or 2-2.5 g of MgSO4∙7H2O, and / or 0.1-0.5 g of ZnSO4∙7H2O, and / or 0.01-0.05 g of FeSO4∙7H2O, and / or 1-2 g of yeast extract, and / or 18-22 g of ammonium sulfate, and / or 3-5 g of potassium chloride, and / or 2-3 g of sodium chloride, and / or 1-2 g of chlorine. Calcium chloride 0.5-1g, and / or biotin 0.001-0.005g, and / or niacin 0.03-0.04g, and / or D-calcium pantothenate 0.005-0.01g, and / or VB1 0.005-0.01g, and / or VB2 0.001-0.0015g, VB6 0.003-0.00375g, and / or 10-15mL of 15-20% ammonia water, and / or 1-2g of NH4H2PO4, and / or 0.001-0.005g of copper sulfate pentahydrate.
27. The fermentation preparation method according to claim 12, characterized in that: In step (2), during the fermentation period, glucose having a concentration of 30-35%, ammonium sulfate having a concentration of 20-25%, ammonia water having a concentration of 15-20% and NH4H2PO4 having a concentration of 1-3% are fed.
28. The fermentation preparation method according to claim 12, characterized in that: In step (3), during the filtration, the yeast slurry and water are mixed evenly in a weight ratio of 1-2:1-2 to obtain a mixed solution.
29. The fermentation preparation method according to claim 28, characterized in that: When filtering, add 1-2% emulsifier to the mixture based on the dry weight of yeast and filter for 30-60 minutes.
30. The fermentation preparation method according to claim 29, characterized in that: The emulsifier is sorbitan monostearate.
31. The fermentation preparation method according to claim 12, characterized in that: The filtration time is 2~3h.
32. A health product that helps to enhance immunity, characterized in that: Contains the Kluyveromyces marxianus according to any one of claims 1-8, or the bacterial agent according to claim 9 or 10, or the bacterial agent prepared by the fermentation preparation method according to any one of claims 11-31.
33. Use of the Kluyveromyces marxianus according to any one of claims 1 to 8, the bacterial agent according to claim 9 or 10, or the bacterial agent prepared by the fermentation preparation method according to any one of claims 11 to 31 in preparing a health product that helps enhance immunity.
34. A drug for relieving allergic reactions, characterized in that: Contains the Kluyveromyces marxianus according to any one of claims 1-8, or the bacterial agent according to claim 9 or 10, or the bacterial agent prepared by the fermentation preparation method according to any one of claims 11-31.
35. Use of the Kluyveromyces marxianus according to any one of claims 1 to 8, the bacterial agent according to claim 9 or 10, or the bacterial agent prepared by the fermentation preparation method according to any one of claims 11 to 31 in the preparation of a medicine for allergic reaction relief.
36. The health product according to claim 32 or the medicine according to claim 34, characterized in that: The dosage form of the health care product or the medicine includes one or more dosage forms selected from the group consisting of powder, tablet, capsule, granule, pill, liquid drop, gel and paste.
37. A food, characterized in that Contains the Kluyveromyces marxianus according to any one of claims 1-8, or the bacterial agent according to claim 9 or 10, or the bacterial agent prepared by the fermentation preparation method according to any one of claims 11-31.
38. Use of the Kluyveromyces marxianus according to any one of claims 1 to 8, the bacterial agent according to claim 9 or 10, or the bacterial agent prepared by the fermentation preparation method according to any one of claims 11 to 31 in preparing food.
39. The food according to claim 37, characterized in that The food comprises one or more foods selected from the group consisting of solid beverages, sugar, fermented products and modulated milk powder.
40. A solid beverage, characterized in that Contains the Kluyveromyces marxianus according to any one of claims 1-8, or the bacterial agent according to claim 9 or 10, or the bacterial agent prepared by the fermentation preparation method according to any one of claims 11-31.
41. The solid beverage according to claim 40, characterized in that Based on the total weight of the solid beverage, the solid beverage comprises: 25-30 wt% of the bacterial agent, 30-40 wt% of oligofructose and 30-45 wt% of oligomaltodextrose.
Citation Information
Patent Citations
Bacterial strain with function of regulating allergic constitution and application of bacterial strain
CN114149937A
Saliva host associated lactobacillus with anti-allergic function and application of saliva host associated lactobacillus
CN117683661A
Composition comprising Kluyveromyces marxianus for prevention and treatment of allergy,inflammation or asthma diseases
KR1020100062450A
Composition comprising Kluyveromyces marxianus for prevention and treatment of allergy,inflammation or asthma diseases
KR1020110119609A