Pharmaceutical composition containing hiHeps-derived exosome and application thereof

By fusing exosomes from hiHeps with cationic liposomes, efficient expression and targeted delivery of targeted nucleic acid sequences in the mouse liver, solving the immune response and safety issues of existing gene therapy vectors, and significantly improving the therapeutic effect of liver disease.

CN120053691APending Publication Date: 2025-05-30SHANGHAI INSTITUTE OF MATERIA MEDICA CHINESE ACADEMY OF SCIENCES +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311584009.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-11-24
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

Existing gene therapy vectors such as AAV and LNP have immune response and safety problems, resulting in low efficiency and complexity of gene therapy, making it difficult to achieve efficient targeted treatment for liver diseases.

Method used

The hiHeps-derived exosomes are fused with cationic liposomes to efficiently load the nucleic acid sequence of interest to achieve efficient expression and targeted delivery in the mouse liver.

Benefits of technology

It improves the efficiency of nucleic acid delivery and liver targeting, reduces immunotoxicity and cytotoxicity, significantly improves the liver failure status of FAH-deficient mice, and improves survival rate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120053691A_ABST
    Figure CN120053691A_ABST
Patent Text Reader

Abstract

The invention discloses a pharmaceutical composition containing a hiHeps-derived exosome, an application of the pharmaceutical composition or the hiHeps-derived exosome in preparation of a medicine for treating liver diseases, and an application of the pharmaceutical composition or the hiHeps-derived exosome in preparation of a medicine for reducing inflammation. The pharmaceutical composition comprises an exosome, a liposome and a nucleic acid drug, wherein the exosome is derived from hiHeps. The pharmaceutical composition can realize better nucleic acid delivery, has lower immunotoxicity and better biocompatibility compared with single cationic liposome delivery, and can efficiently realize expression and functions in in-vitro cell lines, primary hepatocytes and in-vivo mice. Compared with other exosomes, the pharmaceutical composition constructed by the hiHeps exosome also has higher liver targeting property and parenchymal hepatic cell targeting property.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of pharmacy, and particularly relates to a pharmaceutical composition containing exosomes derived from hiHeps, the use of the pharmaceutical composition or exosomes derived from hiHeps in the preparation of a drug for treating liver diseases, and the use of the pharmaceutical composition or exosomes derived from hiHeps in the preparation of a drug for reducing inflammation. Background Art

[0002] Hereditary tyrosinemia type I (HT1), also known as congenital tyrosinemia, is a genetic disease with an incidence of approximately one in one hundred thousand. It is caused by a mutation in the FAH gene, resulting in the inactivation of FAH, which leads to the accumulation of toxic metabolites of tyrosine in hepatocytes, thereby causing extensive and persistent damage to the liver and renal tubular defects, and may induce liver fibrosis, cirrhosis, and even liver cancer. Patients need to be treated with long-term supplementation of NTBC (2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione), and at the same time, the content of phenylalanine and tyrosine in the diet should be controlled. However, some patients are not sensitive to NTBC, and there is still a risk of liver cancer during the treatment process. When NTBC is unavailable or the patient has a malignant tumor or decompensated liver disease, liver transplantation can be used for treatment.

[0003] Gene therapy, which is a treatment strategy that delivers foreign genetic material into the patient's target cells to replace defective genes, is a potential means of treating HT1. By introducing the normal FAH gene, the patient can produce tyrosine metabolic enzymes by themselves, thus eliminating pathological symptoms. Some attempts have been made in this regard. For example, the adenoassociated virus (AAV), a viral vector, is used for delivery; non-viral vectors such as lipid nanoparticles (LNPs) are also used as delivery carriers. However, their disadvantages cannot be avoided. The safety issue of the AAV vector is the key factor restricting its large-scale entry into the clinic. It can induce host immune responses, leading to rapid degradation or neutralization of the vector, seriously affecting its gene therapy efficiency. Severe immunotoxicity can also cause liver toxicity or even death in patients. The PEG component in LNPs can accelerate its clearance rate in the blood, affecting its treatment efficiency. At the same time, the active lipids in LNPs may also be recognized by the immune system and activate immune responses, thus causing safety hazards. The related immune activation problems have been reported in many literatures. Therefore, co-administration of potent immunosuppressants is usually accompanied in the clinical application of LNPs, which makes the clinical development of LNP gene drug formulations more complex. Therefore, finding a nucleic acid delivery carrier with high targeting and safety is the top priority of current gene therapy.

[0004] Exosomes are extracellular vesicles with a diameter of 30 - 200 nm, which are produced and secreted by cells. They have a topological structure similar to that of cells and are rich in nucleic acids, proteins, lipids, and metabolites. Exosomes can act as transmitters of genetic information, delivering cytokines, signaling molecules, and genetic material carried to neighboring and distant cells, thereby regulating the physiological and pathological states of recipient cells and participating in the occurrence and development processes of various diseases. Since exosomes can mediate cell-to-cell communication, exogenous substances such as proteins, mRNA, small nucleic acids, and lipids can be delivered into recipient cells with the help of exosomes. Compared with the widely studied liposome delivery materials currently, the various advantages of exosomes make exosomes a potential ideal drug delivery carrier (Table 1), and the research in related fields has rapidly become a hot spot in scientific research and translational research in recent years.

[0005] Table 1 Advantages of exosomes compared with existing lipid nanoparticle delivery materials

[0006]

[0007] The most unique advantage of exosomes in drug-loading function is their homing property, which makes them more likely to be taken up by cells of the same cell type as their source cells. However, most of the existing exosome-producing cells are derived from non-parenchymal liver cells, and their targeting to parenchymal liver cells is not strong (see the data comparison section below). Exosomes derived from non-parenchymal liver cells, even if they enter the liver, are more likely to be taken up by non-parenchymal liver cells such as Kupffer cells, reducing their drug efficacy and potentially causing additional safety problems. Therefore, the development of exosomes derived from hepatocytes has become the best choice for combating liver diseases. However, primary human hepatocytes (PHH) are not easily obtained, which to some extent hinders the acquisition of exosomes derived from hepatocyte-like cells and severely limits the application of exosomes. Therefore, there is an urgent need to find suitable alternatives. Human induced hepatocytes (hiHeps) are cells directly differentiated from human fibroblasts by adding three transcription factors, HNF1α, HNF4α, and Foxa3, and have mature hepatocyte functions. However, there have been no reports on the use of exosomes derived from hiHeps cells for the treatment of liver diseases or drug delivery. Summary of the Invention

[0008] In view of the immune response and safety problems existing in the lack of gene delivery vectors for HT1 (Hereditary tyrosinemia Ⅰ) in the prior art, the present invention provides the application of the described pharmaceutical composition or exosomes derived from hiHeps in the preparation of a drug for treating liver diseases. By fusing exosomes derived from hiHeps with cationic liposomes to efficiently load the target nucleic acid sequence, liver-targeted expression of the target nucleic acid sequence in mice is achieved. The present invention finds that the delivery efficiency after fusing hiHep exosomes, cationic liposomes and nucleic acid drugs is better than that of using electroporation and co-incubation methods for exosomes and nucleic acid drugs alone. Compared with cationic liposomes alone, exosomes derived from hiHeps combined with cationic liposomes can efficiently deliver the carried plasmid DNA into the liver of mice and express it. At the same time, the delivery system formed by exosomes derived from hiHeps combined with cationic liposomes has lower toxicity to hepatocytes than cationic liposomes alone. The pharmaceutical composition containing exosomes derived from hiHeps, cationic liposomes and FAH plasmid DNA can improve liver failure in FAH-deficient mice and increase the survival rate of mice. Since hiHeps can be stably and massively proliferated and cultured, the exosomes secreted by them are easier to obtain than exosomes derived from human primary hepatocytes (PHH), and are a potential substitute for PHH exosomes, with great potential for medicinal use and as a delivery vector. In addition, the delivery vector constructed by exosomes derived from hiHeps and liposomes has anti-inflammatory and immunosuppressive effects, and is less likely to cause an immune response after entering the body compared with viral vectors and LNPs.

[0009] To solve the above technical problems, a technical solution provided by the present invention is: a pharmaceutical composition containing exosomes derived from hiHeps, the pharmaceutical composition includes exosomes, liposomes and nucleic acid drugs, and the exosomes are derived from hiHeps (human induced hepatocytes).

[0010] In a preferred embodiment of the present invention, the liposome is a cationic liposome, preferably Meilunbio liposome gene transfection reagent (product number: MA0672).

[0011] In a preferred embodiment of the present invention, the preparation method of the exosomes is conventional in the art. For example, the culture supernatant of the exosome-producing cells is purified to obtain the exosomes. Preferably, the purification method is centrifugation.

[0012] In a preferred embodiment of the present invention, the particle number ratio of the exosomes to the liposomes is 1:20 - 1:5, preferably 1:10.

[0013] In a preferred embodiment of the present invention, the mass-to-particle number ratio of the nucleic acid drug to the exosomes is 1 μg: 1×10 9 particles - 1 μg: 1×10 10 particles, preferably 2 μg: 1×10 9 particles.

[0014] In a specific embodiment of the present invention, the hiHeps are hiHeps cells produced by Shanghai Vizor Biotech Co., Ltd., preferably the hiHeps cells prepared according to Example 1 of Patent CN103981147B.

[0015] In a preferred embodiment of the present invention, the nucleic acid drug is a macromolecular nucleic acid drug, such as a nucleic acid fragment or plasmid encoding a therapeutic active substance. Preferably, the nucleic acid drug is a plasmid containing a nucleic acid fragment encoding eGFP or a FAH (fumarylacetoacetate hydrolase) plasmid. The plasmid of FAH is, for example, NM_010176.4.

[0016] In a preferred embodiment of the present invention, the pharmaceutical composition is obtained by co-blending and incubating the exosomes, the liposomes and the nucleic acid drug. Preferably, the incubation time is 6 - 24 h. More preferably, the incubation time is 12 h.

[0017] In a specific embodiment of the present invention, the liposome is Meilunbio liposome gene transfection reagent;

[0018] The hiHeps are hiHeps cells prepared according to Example 1 of Patent CN103981147B;

[0019] The particle number ratio of the exosomes to the liposomes is 1:10;

[0020] The mass-to-particle number ratio of the nucleic acid drug to the exosomes is 2 μg: 1×10 9 particles;

[0021] The nucleic acid drug is a plasmid containing a nucleic acid fragment encoding eGFP or a FAH plasmid;

[0022] The pharmaceutical composition is obtained by co-blending and incubating the exosomes, the liposomes and the nucleic acid drug for 12 h.

[0023] To solve the above technical problems, a technical solution provided by the present invention is: the application of the pharmaceutical composition or exosomes derived from hiHeps as described in the present invention in the preparation of a drug for treating liver diseases.

[0024] In a preferred embodiment of the present invention, the liver disease is liver failure. Preferably, the liver failure is FAH-deficient liver failure. More preferably, the FAH-deficient liver failure is hereditary tyrosinemia type I (HT1).

[0025] To solve the above technical problems, one technical solution provided by the present invention is: the use of the pharmaceutical composition or exosomes derived from hiHeps as described in the present invention in the preparation of a drug for reducing inflammation.

[0026] In a preferred embodiment of the present invention, the inflammation is liver inflammation.

[0027] In a preferred embodiment of the present invention, the inflammation is LPS-induced inflammation.

[0028] In a preferred embodiment of the present invention, the reduction is to reduce the expression levels of TNF-α and / or IL-1β.

[0029] On the basis of conforming to the common knowledge in the art, the above preferred conditions can be arbitrarily combined to obtain various preferred examples of the present invention.

[0030] The reagents and raw materials used in the present invention are all commercially available.

[0031] The positive and progressive effects of the present invention are as follows:

[0032] After the combination of hiHeps exosomes and cationic liposomes, better nucleic acid delivery can be achieved, with lower immunotoxicity, better biocompatibility compared to the delivery of cationic liposomes alone, and can efficiently achieve expression and function in vitro cell lines, primary hepatocytes, and mice. Compared with other exosomes, the pharmaceutical composition containing exosomes derived from hiHeps constructed by hiHeps exosomes also has higher liver targeting and hepatic parenchymal cell targeting. On this basis, the present invention further realizes the delivery of FAH by the pharmaceutical composition containing the FAH plasmid, exosomes derived from hiHeps, and cationic liposomes, and verifies the feasibility of the effective treatment of genetic metabolic liver diseases such as HT1 (fumarylacetoacetate hydrolase deficiency) by the pharmaceutical composition in animals (mice). BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Shows the transfection effect of each drug assembly loaded with eGFP plasmid in Example 1 on 293T, and the scale bar is 130 μm.

[0034] Figure 2 Shows liposomes (Lipo), exosomes derived from hiHeps (EVs), and the pharmaceutical composition group (EVpDNA ) cytotoxicity

[0035] Figure 3 Show the uptake selectivity of PRH for exosomes from different cell sources

[0036] Figure 4 Showed the expression of cellular inflammatory genes in the LPS-induced mouse macrophage inflammation model and the effects of each experimental group on inflammation

[0037] Figure 5 Showed the effect of intravenous injection of a pharmaceutical composition containing exosomes from hiHeps on the transfection of eGFP in the mouse liver. Among them, part A is the immunofluorescence result of eGFP; part B is the qPCR detection of the eGFP gene expression level in the liver and spleen

[0038] Figure 6 Showed the therapeutic effect of a pharmaceutical composition containing exosomes from hiHeps on FAH- / - mice. Among them, part A is the graph of the body weight change of the mice; part B is the survival curve of the mice; part C is the serum BUN value of the mice

[0039] Figure 7 Is the plasmid map of pDNA3.1 Detailed implementation manners

[0040] The present invention will be further illustrated below by way of examples, but the present invention is not limited to the scope of the described examples. The experimental methods without specific conditions noted in the following examples are carried out according to conventional methods and conditions, or selected according to the product specifications

[0041] The raw materials involved in the examples include: DMSO was purchased from Sigma-Aldrich; penicillin-streptomycin, fetal bovine serum (FBS), and 10×PBS were purchased from Gibco; DMEM (containing 4.5 g / L D-Glucose, L-Glutamine, Sodium Pyruvate), PBS, 0.25% Trypsin-EDTA, Phenol Red, DMEM / F12, ITS, and double-antibody sterilizing solution, Meilunbio liposomal gene transfection reagent (product number: MA0672, belonging to cationic liposome, can replace Lipo2000, with less toxicity and higher transfection efficiency), CCK8 working solution, and lipid dye DID were purchased from meilunbio; dexamethasone (DEX) and LPS were purchased from Sigma-Aldrich; Trizol was purchased from Meiji Biological; FAH primary antibody was purchased from Proteintech; eGFP antibody was purchased from Shanghai Solarbio Science & Technology Co., Ltd.; reverse transcriptase, SYBR Green fluorescent dye, 4% formaldehyde, FITC-labeled secondary antibody, and Tex RED-labeled secondary antibody were purchased from Shanghai Yisheng Biological Technology Co., Ltd.; alanine aminotransferase (ALT), aspartate aminotransferase (AST), and blood urea nitrogen (BUN) assay kits were purchased from Nanjing Jiancheng Bioengineering Institute; eGFP plasmid and FAH plasmid (FAH sequence is NM_010176.4) were purchased from Shanghai Shengong Biological Engineering Co., Ltd., and the starting vector plasmid is pDNA3.1, and the map is shown in Figure 7 ; The FAH kit was purchased from Shanghai Bihe Biochemistry Technology Co., Ltd.; DAPI mounting medium was purchased from Beyotime Co., Ltd.; mouse IL-6 and TNF-α ELISA kits were purchased from Lianke Biotechnology.

[0042] The eGFP nucleic acid sequence is as follows:

[0043] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGAC

[0044] GGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGC

[0045] AAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGA

[0046] CCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTT

[0047] CTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGC

[0048] AACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTG

[0049] AAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAAC

[0050] AGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCC

[0051] GCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCG

[0052] GCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAG

[0053] ACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCT

[0054] CGGCATGGACGAGCTGTACAAGTCCGGAGCTGCGGCCGCTGCCGCTGCGGCAGCGGCCGAATT

[0055] CCCCGGGCTCGAGAAGCTTGGATCCACCGGATCTAGATAA(SEQ ID NO:9)

[0056] Experimental instruments: Tissue homogenizer (Shanghai Biheng Biotechnology Co., Ltd.), low-temperature high-speed centrifuge (Eppendorf, 5415R), cell culture incubator (Thermo Fisher Scientific, 371), ultrapure water preparation system (Pall Cascada), multi-functional microplate reader (Bio Tek Synergy4), Applied Bio-system 7500fast real-time fluorescence quantitative PCR instrument (Thremo), upright and inverted fluorescence microscope (Echo Revolve), IVIS small animal in vivo fluorescence imaging system (PERKINELMER), flow cytometer (Agilent NovoCyte).

[0057] Experimental animals: The genetic background of FAH- / - mice is C57Bl6 / J×129Sv. Male C57BL / 6 strain mice, weighing 22-25 g, were purchased from Shanghai Slac Laboratory Animal Co., Ltd. Male SD rats, weighing 220-240 g, were purchased from Shanghai Slac Laboratory Animal Co., Ltd.

[0058] Experimental cells: The preparation method of human induced hepatocytes (hiHeps) was referred to Example 1 of Patent CN103981147B. HF cells and MSC cells were both purchased from Shanghai Yuchun Biotechnology. HEK-293T human embryonic kidney cells (293T), mouse mononuclear macrophage leukemia cells (RAW264.7) and mouse normal hepatocyte cell line (AML12) were purchased from the Cell Bank of the Chinese Academy of Sciences. The bEnd.3 mouse brain microvascular endothelial cell line was purchased from Shanghai Yuchun Biotechnology. Primary rat hepatocytes (PRH) were isolated from the livers of SD rats.

[0059] The primers used in the experiment are shown in Table 2 below:

[0060] Table 2 Primer sequence information

[0061]

[0062] Example 1 Gene delivery application of hiHeps exosomes on in vitro cells

[0063] (1) Isolation of exosomes derived from hiHeps

[0064] Collect the culture supernatant of hiHeps cells. After centrifuging at 300 g for 10 minutes, take the supernatant. Then centrifuge the obtained supernatant at 1000 g for 10 minutes and take the supernatant. After that, centrifuge the obtained supernatant at 10000 g for 30 minutes and take the supernatant. Next, centrifuge the obtained supernatant at 100000 g for 80 minutes and discard the supernatant. Resuspend the bottom precipitate with an appropriate amount of PBS. After centrifuging the resuspended solution at 100000 g for 80 minutes, discard the supernatant. Then resuspend the bottom precipitate with an appropriate amount of PBS to obtain exosomes derived from hiHeps.

[0065] (2) Delivery of the eGFP plasmid (gene map shown in Figure 7 ) to 293T cells

[0066] Plate 293T cells at a cell density of 1×10 5 cells / ml. After the cells adhere for 24 h, change the medium to DMEM medium and add the positive control (2 μg / ml eGFP plasmid incubated with 1×10 10 particles / ml Meilunbio liposomal gene transfection reagent for 20 min), the electroporation group (2 μg / ml eGFP plasmid and 1×10 9 particles / ml exosomes derived from hiHeps electroshocked 9 times at 200 V), the co-incubation group (2 μg / ml eGFP plasmid co-incubated with 1×10 9 particles / ml exosomes derived from hiHeps for 12 h), the lipo group (2 μg / ml eGFP plasmid co-incubated with 1×10 10 particles / ml Meilunbio liposomal gene transfection reagent for 12 h, with a longer incubation time compared to the positive control), and the EV pDNA group (drug composition group, containing 2 μg / ml eGFP plasmid, 1×10 9 particles / ml exosomes derived from hiHeps and 1×10 10 particles / ml Meilunbio liposomal gene transfection reagent, the three co-incubated for 12 h) solutions and incubate for 6 h. Then change to the medium containing serum for each group of cells and continue to culture for 48 h. Observe the expression of eGFP under a fluorescence microscope. All cell experiment results were repeated at least three times.

[0067] (3) Cell viability detection

[0068] After performing relevant transfection treatments on PRH cells, add the CCK8 working solution (diluted 1:10), and continue to incubate in the dark in the cell culture incubator for 1 - 2 h. Then detect the fluorescence intensity at a wavelength of 450 nm with an enzyme-labeled instrument. The EVs group is 1×109 Cells were treated with hiHeps-derived exosomes at a concentration of particles / ml for 6 h.

[0069] (4) Data analysis

[0070] Data processing and significance analysis were performed using GraphPad Prism 8.0 software. Two-tailed, unpaired t-tests were used to compare two groups of data; one-way analysis of variance (one-way ANOVA) followed by Tukey's test was used to correct for multiple comparisons of univariate data. * / #P < 0.05, ** / ##P < 0.01, *** / P < 0.001, **** / #P < 0.001 indicate increasing significance differences.

[0071] Result analysis:

[0072] The experimental results showed that no green fluorescence was generated in the co-incubation and electroporation groups, while green fluorescence was generated in the EV pDNA group, positive control, and Lipo group, as shown in Figure 1 . The above results indicate that hiHeps exosomes can successfully deliver the eGFP plasmid into target cells and express it successfully; electroporation and simple incubation groups are unable to deliver the plasmid. By comparing the positive control and Lipo groups, it can be seen that when liposomes are incubated with the plasmid for 12 h, their transfection efficiency decreases, while hiHeps exosomes still have a high transfection rate. This result indicates that the formulation stability of hiHeps exosomes is significantly higher than that of cationic liposomes alone.

[0073] By detecting cell viability, it can be seen that cationic liposomes have a certain toxicity to receptors, and the cell survival rate drops to about 80%, as shown in Figure 2 . In contrast, neither hiHeps exosomes nor their transfection system showed toxicity to PRH, and they could also improve the cell survival rate of PRH, playing a hepatoprotective role. This result indicates that the safety of hiHeps exosomes is higher than that of cationic liposomes.

[0074] Example 2 In vitro pharmacodynamics of hiHeps exosomes and gene delivery in mice

[0075] (1) Hepatocyte targeting of hiHeps exosomes

[0076] hiHeps, MSC, and human fibroblast (HF) cell-derived exosomes (same as in Example 1) were co-incubated with the lipid dye DID at 37 °C for 20 min, then centrifuged at 100,000 g for 1 h. After removing the supernatant, the exosomes were resuspended with PBS to obtain stained exosomes.

[0077] PRH was seeded at 3 × 105 Plate the cells at a cell density of cells / ml. After the cells adhered, add equal amounts of stained hiHeps, MSC, and HF cell-derived exosomes. After trypsin digestion at 1, 2, and 4 h, use the 640 / 675 channel of a flow cytometer to detect the uptake efficiency of AML12 for different exosomes.

[0078] (2) In vitro anti-inflammatory effect of hiHeps exosome-liposome-nucleic acid composition (hiHeps-EVs)

[0079] Seed RAW264.7 at a concentration of 3×105 cells / ml in a 12-well plate and culture in an incubator for 24 h. The cells are divided into a control group, a model group, a positive drug group, and an EVs group. The positive drug group is only pretreated with 10 μM dexamethasone (DEX) for 2 h. bEnd.3 (mouse brain microvascular endothelial cells, used as a negative control)-EVs (prepared in the same way as the EVs in Example 1) pDNA group and hiHeps-EVs are used to pretreat the cells at a concentration of 1×10 9 particles / ml for 2 h. In the model group, positive drug group, bEnd.3-EVs group, and hiHeps-EVs group, add LPS to each well to make the LPS concentration 1 μg / ml. After 12 h, collect the cell samples, extract mRNA, and use fluorescence quantitative PCR to measure the gene expression levels of TNF-α and IL-6.

[0080] (3) RNA extraction and real-time quantitative reverse transcription gene expression analysis

[0081] Extract the RNA of Raw264.7 cells in step 2) using the Trizol method. Adjust the concentration of the extracted RNA to 50 ng / μl, then add reverse transcriptase to synthesize the first strand of cDNA as a template. Use SYBR as the fluorescent reporter gene, Gapdh gene as the internal reference gene, and a template-free system as the negative control to detect the expression of TNF-α and IL-6 genes in RAW264.7 cells.

[0082] (4) Delivery of genes by hiHeps exosome-liposome-nucleic acid composition (hiHeps-EVs) in mice

[0083] After adaptive cultivation of C57 / BL6 mice, inject the relevant delivery reagent through the tail vein. After 72 h, anesthetize the mice and collect blood and liver tissues for subsequent analysis.

[0084] Administration method of the transfection reagent in the Lipo group: Weigh the body weight of the mice. For every 1 g of mice, 1 μg of plasmid and 5×10 9Particles of Meilunbio liposome gene transfection reagent. After co-incubating the required plasmid with Meilunbio liposome gene transfection reagent for 20 min, the solution was diluted with PBS to a concentration of 0.1 μg / μl eGFP plasmid and injected into mice via the tail vein. The injection volume was determined according to the body weight of the mice, and 10 μl of the solution was injected per gram of the mice.

[0085] Administration method of transfection reagent in the hiHeps-EVs group: Weigh the body weight of the mice. Each gram of the mice needs to be given 1 μg of plasmid, 5×10 9 particles of Meilunbio liposome and 5×10 8 particles of hiHeps exosomes. After co-incubating the required plasmid with Meilunbio liposome gene transfection reagent and hiHeps exosomes for 12 h, the solution was diluted with PBS to a concentration of 0.1 μg / μl eGFP plasmid and injected into mice via the tail vein. The injection volume was determined according to the body weight of the mice, and 10 μl of the solution was injected per gram of the mice.

[0086] (5) Immunofluorescence detection

[0087] The mouse liver was embedded with OCT, sectioned after freezing, fixed with paraformaldehyde for 15 min, blocked for 1 h, incubated overnight with eGFP antibody, rinsed three times with PBS, incubated with secondary antibody labeled with Tex red for 1 h, rinsed three times with PBS, and then mounted with a mounting medium containing DAPI and observed under a fluorescence microscope.

[0088] Result analysis:

[0089] As Figure 3 shown, the uptake rate and uptake amount of hiHeps-derived exosomes by PRH are both better than those of MSC-derived exosomes and HF-derived exosomes, which are more than twice that of them. This indicates that hiHeps has stronger hepatocyte-targeting ability than exosomes derived from the other two cell sources. This is the direct evidence that hiHep hepatocyte-like cell exosomes are suitable for hepatocyte-targeted drug delivery.

[0090] The results of inflammatory gene expression showed that after LPS induction, the inflammatory genes TNF-α and IL-1β of RAW264.7 were significantly increased. However, after treatment with the hiHeps exosome-liposome-nucleic acid composition, their inflammatory genes were significantly down-regulated, while the bEnd.3 exosome-liposome-nucleic acid composition could not reverse this, as Figure 4 shown. These results indicate that the hiHeps exosome-liposome combination has a certain anti-inflammatory effect, while the bEnd.3 exosome-liposome combination does not have an anti-inflammatory effect. The anti-inflammatory effect can reduce the possibility of immune response after in vivo delivery of nucleic acid drugs, so it is more conducive to being used as a delivery carrier for nucleic acid drugs.

[0091] The gene expression results of the spleen and liver are shown in parts A, B, and C of Figure 5 . After injecting the hiHeps exosome-liposome-nucleic acid composition containing the plasmid with the target gene for 72 h, the expression of the eGFP gene in the spleen and liver of mice increased significantly. Subsequently, immunofluorescence detection of eGFP was performed on the spleen of mice. The results showed that eGFP could be expressed in the spleen, while there was no obvious change in the expression of either eGFP protein or gene in the Lipo group, indicating that it could not be transfected in vivo. (From the in vitro transfection results of lipo shown in Example 1 and its inability to be transfected in vivo, it can be found that the in vivo non-transfection of lipo cannot be predicted based on in vitro experiments) No immunosuppressant was used in this experiment. This result proves that the hiHeps exosome-liposome vector can successfully deliver plasmid DNA to the liver and express it, which is superior to the single cationic liposome vector.

[0092] Example 3 Application of hiHeps exosomes in the treatment of FAH- / - mice

[0093] (1) Delivery of genes by hiHeps exosomes in mice

[0094] After the adaptive cultivation of FAH- / - mice, the relevant delivery reagents were injected via the tail vein once a week. After 42 days, the mice were anesthetized and blood and liver tissues were collected for subsequent analysis. After centrifuging the blood at 10000 g for 10 min, the serum was taken, and the BUN value was measured using a BUN kit.

[0095] According to the results of Example 2, since lipo cannot deliver the eGFP plasmid in vivo, theoretically it also cannot deliver the FAH plasmid, and thus cannot achieve a therapeutic effect.

[0096] Administration method of the transfection reagent in the hiHeps exosome group: Weigh the mice. For every 1 g of mice, 1 μg of plasmid, 5×10 9 particles of Meilunbio liposome and 5×10 8 particles of hiHeps exosomes are required. After co-incubating the required plasmid with Meilunbio liposome gene transfection reagent and hiHeps exosomes for 12 h, the solution was diluted with PBS to a concentration of 0.1 μg / μl of FAH plasmid and injected into mice via the tail vein. The injection volume was determined according to the body weight of the mice, and 10 μl of the solution was injected per g of mice.

[0097] Experimental results:

[0098] After administration, the survival rate of the administration group was significantly improved compared with the blank group, and the degree of weight loss was also smaller than that of the blank group, as shown in Figure 6as shown in parts A and B. The liver and kidney functions (ALT, BUN) of the administration group were also significantly improved compared with the blank group, as Figure 6 shown in part C. The experimental results indicate that hiHeps exosomes can play a good therapeutic role in FAH- / - mice.

[0099] The results of the present invention show that the hiHeps exosome-liposome-nucleic acid composition can be successfully transfected into cells to express the target protein, and its transfection efficiency is better than that of the existing cationic liposome transfection reagent. In addition, compared with the cationic liposome transfection reagent, the hiHeps exosome-liposome combination has higher safety and stability. Compared with exosomes derived from HF and MSC, hiHeps exosomes have better hepatocyte targeting and can be efficiently taken up by hepatocytes. Compared with the bEnd.3 exosome-liposome-nucleic acid composition, the hiHeps exosome-liposome has a stronger anti-inflammatory effect.

[0100] In vivo animal level data show that the hiHeps exosome-liposome-nucleic acid composition can successfully express and deliver the eGFP gene in the mouse liver. And exosomes can deliver related plasmids to reduce liver and kidney injuries and lower the mortality rate of FAH- / - mice.

[0101] Compared with the previous technologies, all of the above results verify and illustrate that the hiHeps exosome-liposome combination, as a new nucleic acid drug delivery carrier, can efficiently achieve the delivery of DNA plasmids and realize the application against liver diseases in vivo. hiHeps exosomes can express and deliver the target DNA in cells and the mouse liver, thereby improving the liver and kidney injuries and survival rate of FAH- / - mice.

Claims

1. A pharmaceutical composition containing exosomes derived from hiHeps, characterized in that, the pharmaceutical composition comprises exosomes, liposomes and nucleic acid drugs, and the exosomes are derived from hiHeps.

2. The pharmaceutical composition according to claim 1, characterized in that, the liposome is a cationic liposome, preferably Meilunbio liposome gene transfection reagent; and / or, the hiHeps are hiHeps cells produced by Shanghai Micro-Zhuozhuo Biotechnology Co., Ltd.

3. The pharmaceutical composition according to claim 1, characterized in that, the particle number ratio of the exosomes to the liposomes is 1:20 - 1:5, preferably 1:10; and / or, the ratio of the mass to the number of particles of the nucleic acid drug and the exosome is 1 μg: 1×10 9 particles - 1 μg: 1×10 10 particles, preferably 2 μg: 1×10 9 particles.

4. The pharmaceutical composition according to claim 1, characterized in that, the nucleic acid drug is a macromolecular nucleic acid drug, such as a nucleic acid fragment or plasmid encoding a therapeutic active substance; preferably, the nucleic acid drug is a plasmid containing a nucleic acid fragment encoding eGFP or a FAH plasmid.

5. The pharmaceutical composition according to claim 1, characterized in that, the pharmaceutical composition is obtained by co-blending and incubating the exosomes, the liposomes and the nucleic acid drugs; preferably, the incubation time is 6 - 24 h; more preferably, the incubation time is 12 h.

6. The pharmaceutical composition according to claim 1, characterized in that, the liposome is Meilunbio liposome gene transfection reagent; the hiHeps are hiHeps cells prepared according to Example 1 of Patent CN103981147B; the particle number ratio of the exosomes to the liposomes is 1:10; The ratio of the mass to the number of particles of the nucleic acid drug to the exosomes is 2 μg: 1×10 9 particles; the nucleic acid drug is a plasmid containing a nucleic acid fragment encoding eGFP or a FAH plasmid; the pharmaceutical composition is obtained by co-blending and incubating the exosomes, the liposomes and the nucleic acid drugs for 12 h.

7. Use of the pharmaceutical composition according to any one of claims 1 - 6 or exosomes derived from hiHeps in the preparation of a drug for treating liver diseases.

8. The use according to claim 7, characterized in that, the liver disease is liver failure; preferably Select a site, wherein the liver failure is Fah-deficient liver failure; more preferably, the Fah-deficient liver failure is hereditary tyrosinemia type I.

9. Use of the pharmaceutical composition according to any one of 1 - 6 or exosomes derived from hiHeps in the preparation of a drug for reducing inflammation.

10. The use according to claim 9, characterized in that, the inflammation is blood inflammation or liver inflammation; and / or, the inflammation is inflammation induced by LPS; preferably, the reduction is to reduce the expression levels of TNF-α and / or IL-1β.

Citation Information

Patent Citations

  • A novel method for preparing hepatocytes

    CN103981147B