A salt-tolerant growth-promoting composite bacterial agent and its application

By using the complex bacterial agents of actinomycetes S36, Trichoderma M2 and Bacillus Beles Y10, the soil plating problem caused by chemical reagents is solved, the salt tolerance of cotton and wheat is improved, and the growth ability of plants is enhanced.

CN120060081BActive Publication Date: 2025-08-19CHINA AGRI UNIV

Patent Information

Application Number
CN202510510473.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2025-08-19
Estimated Expiration
2045-04-23

AI Technical Summary

Technical Problem

In the prior art, when chemical reagents or soil modification agents are used to improve saline-alkali land, it is easy to cause soil crumbing, destroy the soil ecosystem, and cannot effectively improve the salt tolerance of cotton and wheat.

Method used

A complex bacterial agent composed of actinomycetes S36, Trichoderma M2 and Bacillus Beles Y10 is used, and diluted after fermentation is used as a seed soaking agent or root irrigation agent to improve the salt tolerance of the plant.

Benefits of technology

The fresh weight, dry weight and length of cotton and wheat seedlings are significantly improved, and the plants are able to resist salt stress without damaging the soil ecosystem.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060081B_ABST
    Figure CN120060081B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of microbial technology and specifically relates to a salt-tolerant growth-promoting composite bacterial agent and its application. The active ingredients of the salt-tolerant growth-promoting composite bacterial agent are actinomycete S36, deposited with CGMCC No. 32928, Trichoderma M2, deposited with CGMCC No. 41651, and Bacillus velezensis Y10, deposited with CGMCC No. 32927. The present invention screened and obtained a composite bacterial agent obtained by mixing these three bacteria, which can improve the resistance of cotton and wheat to salt stress, providing a new microbial resource for improving the salt tolerance of cotton and wheat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and in particular relates to a salt-tolerant growth-promoting composite bacterial agent and its application. Background Art

[0002] cotton( Gossypium spp. Cotton is an important cash crop and a significant source of feed and oil. Currently, cotton fiber, seeds, and straw are widely used in textiles, food and feed processing, and papermaking. Due to competition with grain and rising labor costs, cotton production is gradually shifting to the inland northwest, where soil salinization is more severe. However, secondary soil salinization severely restricts cotton growth. Although cotton has a certain degree of salt tolerance and is often used as a pioneer crop for the development of saline-alkali farmland, excessive salt ions significantly inhibit cotton growth. Salt stress treatment significantly decreases seed biomass, superoxide dismutase, catalase, and peroxidase activities, and increases malondialdehyde content. Salt stress also significantly reduces cotton fiber length and elongation, severely impacting cotton yield and quality. Winter wheat is the primary crop, cultivated in nearly all agricultural regions from south to north, from plains to mountainous areas. Its cultivated area and total yield are second only to rice. During wheat growth, soil salinization has become a significant ecological and environmental issue. Increased upper soil salt content in agricultural ecosystems can affect crop growth and development, leading to yield reductions. Existing technologies typically use chemical reagents or soil conditioners to improve saline-alkali land, thereby reducing the impact of soil salinization on cotton or wheat growth. However, long-term use of chemical reagents or soil conditioners can cause soil compaction, damage the soil ecosystem, and affect the structure and function of soil microbial communities. Furthermore, these agents are unable to effectively improve the salt tolerance of cotton or wheat. Summary of the Invention

[0003] To solve the above problems, the present invention provides a salt-tolerant growth-promoting composite bacterial agent and its application. The composite bacterial agent obtained by compounding microorganisms can effectively improve the salt tolerance of cotton and wheat without damaging the soil ecosystem.

[0004] To achieve the above objectives, the technical solutions of the present invention are as follows.

[0005] The first aspect of the present invention provides a salt-tolerant growth-promoting composite bacterial agent, the active ingredient of which is deposited with CGMCC No. 32928 and classified as Streptomyces rochei The strain was named Actinomycetes S36; the deposit number was CGMCC No.41651, and the classification was named Trichoderma Trichoderma sp. The strain was named Trichoderma M2; the deposit number was CGMCC No. 32927 and the classification name was Bacillus Velezii Bacillus velezensis The strain was named Bacillus Velez Y10.

[0006] The present invention obtained actinomycete S36, Trichoderma M2 and Bacillus Velezii Y10 through screening. Experiments found that the salt-tolerant growth-promoting composite bacterial agent obtained by using the above three bacteria as active ingredients can effectively improve the resistance of cotton and wheat to salt stress, providing a new microbial resource for improving the salt tolerance of cotton and wheat, while also avoiding the damage to the soil ecosystem caused by chemical reagents or soil conditioners.

[0007] In a preferred embodiment, the salt-tolerant growth-promoting composite bacterial agent is obtained by mixing actinomycetes S36 bacterial solution, Trichoderma M2 bacterial solution and Bacillus velezensis Y10 bacterial solution and fermenting the mixture;

[0008] The amount of live bacteria in the actinomycete S36 bacterial solution is 1×10 6 CFU / mL~5×10 6 CFU / mL, the viable bacteria of the Trichoderma M2 bacterial solution is 1×10 6 CFU / mL~5×10 6 CFU / mL, the viable bacteria amount of the Bacillus Velez Y10 bacterial solution is 2×10 8 CFU / mL~5×10 8 CFU / mL.

[0009] In a preferred embodiment, the volume ratio of the actinomycete S36 bacterial solution, the Trichoderma M2 bacterial solution and the Bacillus velezensis Y10 bacterial solution is 2-3:1-2:1-2.

[0010] The second aspect of the present invention provides the use of the salt-tolerant growth-promoting composite bacterial agent in improving the salt tolerance of plants.

[0011] In a preferred embodiment, the improving plant salt tolerance refers to improving the germination rate of plant seeds under salt stress.

[0012] In a preferred embodiment, the salt-tolerant growth-promoting composite bacterial agent is used as a seed soaking agent for plant seeds to improve the germination rate of plant seeds under salt stress.

[0013] In a preferred embodiment, the improving plant salt tolerance refers to increasing the fresh weight, dry weight and length of plant seedlings under salt stress.

[0014] In a preferred embodiment, the salt-tolerant growth-promoting composite bacterial agent is used as a root irrigation agent for plant seedlings to increase the fresh weight, dry weight and length of plant seedlings under salt stress.

[0015] In a preferred embodiment, the plants are cotton and wheat.

[0016] Compared with the prior art, the present invention has the following beneficial effects.

[0017] The three bacteria screened by the present invention, namely actinomycete S36, Trichoderma M2 and Bacillus Velez Y10, are used as active ingredients. The obtained salt-tolerant growth-promoting composite bacterial agent can not only effectively improve the salt tolerance of cotton and wheat, but also will not damage the soil ecosystem, providing a new solution to the growth problem of cotton and wheat caused by soil salinization.

[0018] The present invention discovered through experiments that a salt-tolerant growth-promoting composite bacterial agent can promote the growth of cotton and wheat seedlings. The results showed that the use of the composite bacterial agent can significantly increase the fresh weight of cotton seedlings by 70.37%. Under salt stress, the use of the composite bacterial agent significantly increased the fresh weight of cotton seedlings by 64.82%; the use of the composite bacterial agent can significantly increase the dry weight of cotton seedlings by 21.86%. Under salt stress, the use of the composite bacterial agent significantly increased the dry weight of cotton seedlings by 36.22%; the use of the composite bacterial agent can significantly increase the length of cotton seedlings by 13.69%. Under salt stress, the use of the composite bacterial agent significantly increased the length of cotton seedlings by 56.79%.

[0019] The salt-tolerant growth-promoting composite bacterial agent can increase the fresh weight of wheat seedlings by 10.78%. Under salt stress, the use of the composite bacterial agent significantly increased the fresh weight of wheat seedlings by 45.47%; the use of the composite bacterial agent can increase the dry weight of wheat seedlings by 23.05%. Under salt stress, the use of the composite bacterial agent increased the dry weight of wheat seedlings by 25.54%; the use of the composite bacterial agent can increase the length of wheat seedlings by 4.36%. Under salt stress, the use of the composite bacterial agent significantly increased the length of wheat seedlings by 29.76%. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 These are morphological diagrams of S36, M2, and Y10 on PDA solid culture medium in the present invention; wherein, A is the morphological diagram of S36, B is the morphological diagram of M2, and C is the morphological diagram of Y10.

[0021] Figure 2 The graphs show the effect of 100-fold dilution of the salt-tolerant growth-promoting composite bacterial agent on the germination of cotton seeds at different times under salt stress; A shows the germination of cotton seeds after 3 days, and B shows the germination of cotton seeds after 6 days.

[0022] Figure 3 The figure shows the effect of different soaking times on the root length of cotton seeds germinating under salt stress after the salt-tolerant growth-promoting composite bacterial agent of the present invention is diluted 100 times; among them, A is the effect diagram of the root length of cotton seeds germinating after 3 days, and B is the effect diagram of the root length of cotton seeds germinating after 6 days.

[0023] Figure 4The figure shows the effect of a 100-fold dilution of the salt-tolerant growth-promoting composite bacterial agent of the present invention on the length, fresh weight and dry weight of cotton seedlings; wherein A is the result diagram of the fresh weight of the cotton seedlings, B is the result diagram of the dry weight of the cotton seedlings, and C is the result diagram of the height of the cotton seedlings; in the figure, H2O2 represents the water treatment group, the bacterial agent represents the 100-fold diluted strain fermentation liquid treatment group, NaCl represents the 150mM saline treatment group, and NaCl+bacterial agent represents the 150mM saline + 100-fold diluted strain fermentation liquid treatment group.

[0024] Figure 5 This is a comparative illustration of the effects of a 100-fold diluted bacterial solution of the salt-tolerant growth-promoting composite bacterial agent of the present invention on cotton seedlings.

[0025] Figure 6 This is a graph showing the effect of a 100-fold dilution of the salt-tolerant growth-promoting composite bacterial agent on the length, fresh weight, and dry weight of wheat seedlings; wherein A is the result graph for the length of wheat seedlings, B is the result graph for the fresh weight of wheat seedlings, and C is the result graph for the dry weight of wheat seedlings.

[0026] Figure 7 This is a comparison chart of the effects of a 100-fold dilution of the salt-tolerant growth-promoting composite bacterial agent on wheat seedlings. DETAILED DESCRIPTION

[0027] The present invention will be described in detail below with reference to the accompanying drawings and specific examples, but they should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0028] The salt-tolerant growth-promoting composite bacterial agent of the present invention comprises actinomycete S36 bacterial solution, Trichoderma M2 bacterial solution and Bacillus velezensis Y10 bacterial solution.

[0029] Actinomycetes S36 was deposited in the General Microbiology Center of China Culture Collection Administration on December 5, 2024, with the deposit number CGMCC No.32928 and the classification name Streptomyces rochei , hereinafter referred to as S36.

[0030] Trichoderma M2 was deposited in the General Microbiology Center of China Culture Collection Administration on December 5, 2024, with the deposit number CGMCC No.41651, and was classified as Trichoderma Trichoderma sp. , hereinafter referred to as M2.

[0031] Bacillus velezis Y10 was deposited in the General Microbiology Center of China Culture Collection Administration on December 5, 2024, with the deposit number CGMCC No.32927, and the classification name is Bacillus velezis Bacillus velezensis , hereinafter referred to as Y10.

[0032] Example 1: Screening and identification of strains.

[0033] 1. Strain Screening: Isolate microbial strains from saline-alkali soil and screen for strains capable of phosphate solubilization, nitrogen fixation, potassium solubilization, and IAA production. Store in glycerol tubes at -80°C. Activate strains capable of phosphate solubilization, nitrogen fixation, potassium solubilization, and IAA production before use. The specific steps are as follows.

[0034] Use PDA solid culture medium for activation and propagation, then inoculate the strain into Montgina medium, Asbby medium and silicate bacterial culture medium respectively, observe the growth status of the strain in the culture dish, and judge that the strain has this function if a transparent circle is produced in the culture medium.

[0035] The specific steps for the IAA colorimetric reaction are as follows: Use a sterile inoculating loop to pick a single colony with distinct morphological characteristics from a purified bacterial plate and inoculate it into a flask or test tube filled with Czapek liquid medium. Place the inoculated medium in a constant temperature shaker at 30°C and 200 rpm for 7 days. Remove the culture and pipette 5 mL of the culture into a sterile centrifuge tube. Centrifuge at 10,000 rpm for 5 minutes, aspirate 1 mL of the supernatant, and add 1 mL of Salkowski colorimetric reagent. After mixing thoroughly, place the test tube in a dark place at room temperature for 30 minutes to allow the IAA to fully react with the colorimetric reagent. The specific criterion is that the mixed solution turns red. The effects of the strains are shown in Table 1, which shows that all three strains produce IAA.

[0036] Table 1: Strain screening results

[0037]

[0038] Note: “+” represents effect, “-” represents no effect, the same below.

[0039] 2. Antagonism of strains: The three strains screened were subjected to mutual antagonism tests, and the results are shown in Table 2. As can be seen from Table 2, the strains did not antagonize each other.

[0040] Table 2: Antagonistic effect between strains

[0041]

[0042] 3. Strain Identification: Strains S36, M2, and Y10 were inoculated onto PDA medium and cultured at 28°C for 10 days. Afterward, the bacterial sludge was collected and genomic DNA was extracted using the 16S rDNA method. Gene sequences were amplified using universal primers. Sequencing results were then searched for similarity in NCBI using Blast software.

[0043] The DNA sequence of S36 was obtained by sequencing and classified as Streptomyces ( Streptomyces rochei ), with a deposit number of CGMCC No. 32928. The DNA sequence of M2 was obtained by sequencing and the result of alignment was classified as Trichoderma longibrachiatum ( Trichoderma longibrachiatum ), with the deposit number of CGMCC No. 41651. The DNA sequence of strain Y10 was obtained by sequencing and it was classified as Bacillus velezinis ( Bacillus velezensis ), the accession number is CGMCC No.32927.

[0044]

[0045] The 16s rDNA sequence of the M2 bacterium is shown in SEQ ID NO.2: CCTCCGTAGGGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCCAAACTCTTTTTTCTCTCCGTCGCGGCTCCCGTCGCGGCTCTGTTTTATTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGKAATACCCGCTGAACTTAAGCATATCAATAAAGCGGAGGA。

[0046]

[0047] 4. Strain morphology: The three strains were activated and cultured in PDA culture dishes. Their morphologies in the culture dishes were as follows: Figure 1 As shown. Figure 1 As shown in A, the colony has a dense texture, a dense velvety surface or a solid, dry, and wrinkled surface. The colony is small and does not spread. Figure 1 As shown in B, the colony is initially white, and gradually turns green as conidia are produced. There are fewer aerial hyphae, and conidia are usually arranged in concentric patterns. Figure 1 As shown in C, the colonies are milky white, round, and have a smooth, slightly convex surface.

[0048] Example 2: Cultivation and preparation of composite bacterial agent.

[0049] The three strains obtained in Example 1 were activated, with S36 and Y10 cultured in LB liquid medium as seed solution at 28°C, 180 rpm, and cultured for 2 days. The medium formula was 10 g of tryptone, 5 g of yeast extract, and 5 g of NaCl, adjusted to pH 7.0, and balanced with 1 L of distilled water. The culture was sterilized at 121°C for 20 minutes. The concentration of the activated actinomycete S36 liquid was 5×10 6 CFU / mL, the concentration of Y10 bacterial solution is 5×10 8 CFU / mL.

[0050] Trichoderma M2 was cultured in 150 mL of PD medium at 28°C and 180 rpm for 2 days. The medium was formulated as follows: 200 g of potato starch, 20 g of glucose, pH adjusted to 7.0, 1 L of distilled water, and sterilized at 121°C for 20 minutes. The concentration of the activated Trichoderma M2 solution was 5 × 10 6 CFU / mL.

[0051] The above seed liquid was inoculated into the fermentation medium at a volume ratio of 2:1:1, with an inoculum amount of 4% of the mass of the fermentation medium. The conditions were 28°C, 220 r / min, and cultured for 2 days. The number of viable bacteria was ≥10 9 cfu / mL, and the salt-tolerant growth-promoting composite bacterial agent was obtained, which was diluted 100 times for subsequent experiments.

[0052] The fermentation medium formula is: corn starch 20g, glucose 10g, soybean meal 20g, MgSO4 1.0g, KH2PO4 0.6g, NaCl 7.5g, 150mL is divided into 500ml Erlenmeyer flasks, adjusted to pH 7, balanced with distilled water to 1L, and sterilized at 121℃ for 20min.

[0053] Example 3: Cotton seed germination test using salt-tolerant growth-promoting composite bacterial agent.

[0054] Cotton seeds with full grains and uniform size were selected, disinfected with 2.5wt% hypochlorous acid for 15 minutes, and rinsed four times with sterile water to obtain sterilized seeds. The sterilized seeds were divided into two groups and soaked in sterile water and the salt-tolerant growth-promoting composite bacterial agent diluted 100 times in Example 2 for 12 hours, respectively, to obtain water-soaked seeds and bacterial agent-soaked seeds.

[0055] Germination experiments were conducted on the two seed groups using the vertical paper roll method. The germination papers were soaked with water and 150 mM saline solution, respectively. The seeds were divided into four groups based on the germination paper environment: the control group (H2O), the inoculum group (inoculum), the salt-treated group (NaCl), and the salt-stress group (NaCl + inoculum). Seeds from each group were arranged 2 cm apart on the germination paper, with eight cotton seeds placed on each sheet. Five replicates were set for each treatment. The rolled germination papers were secured at the top with a rubber band and placed vertically in five ziplock bags. 20 mL of 150 mM saline solution was added to the salt-treated and salt-stressed groups, while equal amounts of sterile water were added to the control and inoculum groups, ensuring that the sterile water and saline solution in the ziplock bags reached approximately one-quarter of the paper, respectively. The germination papers were incubated in a greenhouse at a day / night temperature of 30 ± 2°C / 22 ± 2°C, with a 14-h photoperiod, for three days.

[0056] 1. Determination of cotton seedling growth indicators.

[0057] The cotton seed germination rate was recorded 3 days and 6 days after salt treatment, and the length of the cotton hypocotyl and root was measured with a ruler. The hypocotyl was from the cotyledon node to the boundary between the hypocotyl and the root, and the main root was from the boundary between the hypocotyl and the root to the root tip. Three replicates were set for each treatment. The results of measuring the length of the cotton hypocotyl and root are as follows. Figure 2 shown.

[0058] The results of the root length survey on the third day showed that the root length of cotton seeds soaked with the fungus agent increased by 5.04% compared with the water treatment, and the root length increased by 103.85% under salt stress. The results of the survey on the fifth day showed that the root length of cotton seeds soaked with the fungus agent increased by 15.2% compared with the water treatment, and the root length increased by 14.4% under salt stress. The results on the third and sixth days are as follows: Figure 3 As shown in A and B.

[0059] 3. Determination of enzyme activity in cotton hypocotyls.

[0060] 1) Superoxide dismutase: Superoxide dismutase (SOD) activity was determined using a total SOD assay kit (model A001-1, purchased from Nanjing Jiancheng Biological Co., Ltd.). After 3 days of salt stress, 0.15 g of sample was weighed and added to 1.35 ml of pH 7.2 phosphate buffer. The sample was ground on ice and centrifuged at 4000 rpm for 10 minutes. The supernatant was collected and the absorbance was measured at 550 nm according to the kit instructions.

[0061] 2) Hydrogen peroxide: Hydrogen peroxide was measured using a hydrogen peroxide assay kit (model A064-1-1, purchased from Nanjing Jiancheng Biological Co., Ltd.). After 3 days of salt stress, 0.15 g of sample was weighed and added to 1.35 ml of pH 7.2 phosphate buffer. The sample was ground on ice and centrifuged at 10,000 rpm for 10 minutes. The supernatant was collected and the absorbance was measured at 405 nm according to the kit instructions.

[0062] 3) Catalase: Samples were assayed using a catalase assay kit, model A007-1-1, purchased from Nanjing Jiancheng Biological Co., Ltd. After 3 days of salt stress, 0.15 g of sample was weighed and added to 0.6 mL of pH 7.2 phosphate buffer. The sample was ground on ice and centrifuged at 2500 rpm for 10 minutes. The supernatant was collected and the absorbance was measured at 405 nm according to the kit instructions. The results are shown in Table 3.

[0063] Table 3: Enzyme activity assay for cotton hypocotyls

[0064]

[0065] The results showed that when cotton suffered from salt damage, the use of salt-tolerant growth-promoting compound bacteria agent could significantly increase the SOD and CAT activities of cotton hypocotyls and significantly reduce the H2O2 activity, indicating that the salt-tolerant growth-promoting compound bacteria agent can effectively improve the salt tolerance of cotton.

[0066] Example 4: Salt tolerance test of cotton seedlings using a composite bacterial agent.

[0067] Uniformly sized, plump cotton seeds were selected and surface-sterilized with a 5wt% H2O2 solution for 10 minutes. The seeds were then rinsed repeatedly with deionized water and soaked in deionized water for 24 hours. The seeds were then placed on a petri dish lined with moistened gauze and germinated at 28°C for 2 days. Seeds with consistent bud length were sown in plastic pots, with four seeds per pot. Four treatments were set up: water (H2O), a 100-fold diluted bacterial fermentation solution (inoculation agent), 150 mM saline (NaCl), and 150 mM saline plus a 100-fold diluted bacterial fermentation solution (NaCl + inoculation agent). Root irrigation was performed, with 50 mL of each of the four solutions applied around the rhizosphere. Watering was performed once when the cotyledons were flattened and again when one true leaf was flattened. Watering was continued with normal watering. After 21 days of treatment, samples were collected and analyzed. The entire process was incubated at room temperature (25-28°C), with 30% humidity and a minimum of 8 hours of light.

[0068] Slowly pull the cotton seedlings out of the nutrient pot, gently rinse the soil attached to the roots with running water, wipe off excess water with toilet paper, place the cotton seedlings flat on the table, and measure the plant height with a ruler. Use absorbent paper to absorb the surface water of the cotton seedlings and weigh the fresh weight of the whole cotton plant; the plants with recorded fresh weight are sterilized at 105℃ for 20 minutes, dried at 80℃ to constant weight, and then weighed. Test results are shown in Figure 4 , phenotypic results are shown in Figure 5 .

[0069] The results showed that the use of the compound bacterial agent can significantly increase the fresh weight of cotton seedlings by 70.37%. Under salt stress, the use of the compound bacterial agent significantly increased the fresh weight of cotton seedlings by 64.82%; the use of the compound bacterial agent can significantly increase the dry weight of cotton seedlings by 21.86%. Under salt stress, the use of the compound bacterial agent significantly increased the dry weight of cotton seedlings by 36.22%; the use of the compound bacterial agent can significantly increase the length of cotton seedlings by 13.69%. Under salt stress, the use of the compound bacterial agent significantly increased the length of cotton seedlings by 56.79%.

[0070] Example 5: Salt tolerance test of wheat seedlings using a composite bacterial agent.

[0071] Uniformly sized, plump cotton seeds were selected and surface-sterilized with a 5wt% H₂O₂ solution for 10 minutes. The seeds were rinsed repeatedly with deionized water and soaked in deionized water for 24 hours. The seeds were then placed on a Petri dish lined with moistened gauze and germinated at 28°C for 2 days. Seeds with consistent bud length were sown in plastic pots, with 12 seeds per pot. Four treatments were set up: water, a 100-fold diluted bacterial fermentation solution, 150 mM saline, and saline plus a 100-fold diluted bacterial fermentation solution. Root irrigation was used, with 50 mL of each of the four solutions applied around the rhizosphere every five days for a total of four irrigations. Samples were collected and analyzed. The entire process was incubated at room temperature at 28°C, 30% humidity, and a minimum of 8 hours of light.

[0072] Slowly pull the wheat seedlings out of the nutrient pot, gently rinse the soil attached to the roots with running water, wipe off excess water with toilet paper, place the cotton seedlings flat on the table, and measure the plant height with a ruler. Use absorbent paper to absorb the surface moisture of the wheat seedlings and weigh the fresh weight of the whole cotton plant; the plants with recorded fresh weight are sterilized at 105℃ for 20 minutes, dried at 80℃ to constant weight, and then weighed. For the convenience of calculation, the measurement data are all for one pot of wheat seedlings. Test results are shown in Figure 6 , phenotypic results are shown in Figure 7 .

[0073] The results showed that the use of salt-tolerant growth-promoting compound bacteria agent can increase the fresh weight of wheat seedlings by 10.78%. Under salt stress, the use of salt-tolerant growth-promoting compound bacteria agent significantly increased the fresh weight of wheat seedlings by 45.47%; the use of salt-tolerant growth-promoting compound bacteria agent can increase the dry weight of wheat seedlings by 23.05%. Under salt stress, the use of salt-tolerant growth-promoting compound bacteria agent increased the dry weight of wheat seedlings by 25.54%; the use of salt-tolerant growth-promoting compound bacteria agent can increase the length of wheat seedlings by 4.36%. Under salt stress, the use of salt-tolerant growth-promoting compound bacteria agent significantly increased the length of wheat seedlings by 29.76%.

[0074] Although preferred embodiments of the present invention have been described, further changes and modifications may be made to these embodiments by those skilled in the art once the basic inventive concepts are understood. It is apparent that various modifications and variations may be made by those skilled in the art without departing from the spirit and scope of the present invention. Thus, the present invention is intended to encompass such modifications and variations as fall within the scope of equivalents of the present invention.

Claims

1. A salt-tolerant growth-promoting composite bacterial agent, characterized in that: Its active ingredient is an actinomycete with a deposit number of CGMCC No.32928 ( Streptomyces rochei ) S36, Trichoderma spp. deposited with CGMCC No.41651 ( Trichoderma sp. ) M2 and Bacillus velezii with a deposit number of CGMCC No.32927 ( Bacillus velezensis )Y10; The salt-tolerant growth-promoting composite bacterial agent is obtained by mixing actinomycete S36 bacterial solution, Trichoderma M2 bacterial solution and Bacillus velezii Y10 bacterial solution and fermenting the mixture; The amount of live bacteria in the actinomycete S36 bacterial solution is 1×10 6 CFU / mL~5×10 6 CFU / mL, the viable bacteria of the Trichoderma M2 bacterial solution is 1×10 6 CFU / mL~5×10 6 CFU / mL, the viable bacteria amount of the Bacillus Velez Y10 bacterial solution is 2×10 8 CFU / mL~5×10 8 CFU / mL; The volume ratio of actinomycete S36 bacterial solution, Trichoderma M2 bacterial solution and Bacillus Velez Y10 bacterial solution is 2~3:1~2:1~2.

2. Use of the salt-tolerant growth-promoting composite bacterial agent according to claim 1 in improving the salt tolerance of plants.

3. The use of the salt-tolerant growth-promoting composite bacterial agent according to claim 2 in improving plant salt tolerance, characterized in that: The improving of plant salt tolerance refers to improving the germination rate of plant seeds under salt stress.

4. The use of the salt-tolerant growth-promoting composite bacterial agent according to claim 3 in improving plant salt tolerance, characterized in that: The salt-tolerant growth-promoting composite bacterial agent is used as a seed soaking agent for plant seeds to improve the germination rate of plant seeds under salt stress.

5. The use of the salt-tolerant growth-promoting composite bacterial agent according to claim 4 in improving plant salt tolerance, characterized in that: Improving plant salt tolerance refers to increasing the fresh weight, dry weight and length of plant seedlings under salt stress.

6. Use of the salt-tolerant growth-promoting composite bacterial agent according to claim 5 in improving plant salt tolerance, characterized in that: The salt-tolerant growth-promoting composite bacterial agent is used as a root irrigation agent for plant seedlings to increase the fresh weight, dry weight and length of the plant seedlings under salt stress.

7. The use of the salt-tolerant growth-promoting composite bacterial agent according to claim 2 in improving plant salt tolerance, characterized in that: The plants are cotton and wheat.

Citation Information

Patent Citations

  • Stress-resistant growth-promoting compound microbial agent and application thereof

    CN115558615A

  • Bacillus velezensis, fungicide, plant growth promoting agent, biological fertilizer and application

    CN117903986A

  • Bacillus velezensis C5, bacterial fermentation liquor and application of bacterial fermentation liquor

    CN118126891A

Cited By

  • Use of actinomyces s36

    CN122767355A