Application of trichina source RANKL binding protein TsPULP in inhibition of osteoclast differentiation and prevention and treatment of bone destruction

Abstract

The invention relates to the field of biological medicine, in particular to application of trichina-source RANKL binding protein TsPULP in inhibition of osteoclast differentiation and prevention and treatment of bone destruction, and discloses application of TsPULP in inhibition of osteoclast differentiation and prevention and treatment of bone destruction. According to the present invention, the combination of the RANKL and the receptor nuclear factor kappa B receptor activating factor (RANK) thereof is competitively inhibited so as to inhibit the downstream signal pathway of osteoclast differentiation, reduce the generation of osteoclasts, and alleviate the single protein (TsPULP) of osteoporosis or rheumatoid arthritis and other bone destructive diseases. The TsPULP has no obvious cytotoxicity and hepatorenal toxicity, can be directly expressed and produced by escherichia coli, has stable properties, high yield and lower cost in the production process, and can provide candidate molecules for research and development of novel anti-bone destruction drugs with high efficiency and low toxic and side effects.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to the application of Trichinella - derived RANKL - binding protein TsPULP in inhibiting osteoclast differentiation and preventing and treating bone destruction. Background Art

[0002] Bone destruction refers to the local bone tissue loss caused by factors such as immune or metabolic imbalance, resulting in changes in bone structure and dysfunction. There are many types of diseases clinically causing bone destruction, such as osteoporosis, rheumatoid arthritis, etc. The normal maintenance of the skeletal system is achieved by the dynamic balance between osteoclastic bone resorption and osteoblastic bone formation. Osteoclasts are the only cells in the body that play the function of bone resorption, and are tissue - specific multinucleated giant cells formed by the differentiation and fusion of monocytes / macrophages located on the bone surface. The hyperactive bone resorption function caused by the over - activation of osteoclasts is an important cause of bone destruction. Targeting osteoclasts has become the main direction for preventing and treating bone destruction, such as bisphosphonate drugs. The RANKL / RANK / OPG axis is the main factor regulating osteoclast differentiation. The receptor activator of nuclear factor - κB (RANK) on the surface of osteoclast precursor cells binds to the ligand of RANK (receptor activator of nuclear factor - κB Ligand, RANKL) produced by osteoblasts, etc., initiating downstream signal cascades, promoting the maturation of osteoclasts, degrading and absorbing the bone matrix. OPG is osteoprotegerin, a decoy protein of RANKL, which can bind to RANKL, inhibit the binding of RANKL to RANK, thereby blocking the signal pathway of osteoclast differentiation and reducing the generation of osteoclasts. The drugs for research targeting this target mainly include recombinant OPG protein and the monoclonal antibody Denosumab of RANKL, etc. Currently, Denosumab has been applied to the treatment of patients with osteoporosis or rheumatoid arthritis, etc. in clinical practice.

[0003] Although there are currently various drugs for treating bone - destructive diseases clinically, most of them have obvious side effects. The long - term use of the monoclonal antibody Denosumab of RANKL can lead to the inhibition of the RANKL function in patients, prompting the accumulation of osteoclast precursor cells in patients. Once the drug is stopped, it is easy to induce a rebound increase in the formation and activation of osteoclasts, resulting in multiple fractures. The bone resorption inhibitor bisphosphonate drugs are prone to cause events such as cardiovascular diseases, breast cancer, atypical femoral fractures, osteonecrosis of the jaw, etc. In addition, the prices of such drugs are usually high, and patients with osteoporosis or arthritis usually need to take medicine for a long time, causing a large economic burden on patients. Therefore, there is still a need to develop more effective, safe and low - cost drugs. Summary of the Invention

[0004] Aiming at the deficiencies existing in the prior art, the object of the present invention is to provide the application of Trichinella - derived RANKL - targeting protein TsPULP in inhibiting osteoclast differentiation and preventing and treating bone destruction. A single protein (Trichinella polyubiquitin - like protein, TsPULP) is screened from Trichinella excretory - secretory antigen (TsMES), which can bind to receptor activator of nuclear factor - κB ligand (RANKL), competitively inhibit its binding to its receptor receptor activator of nuclear factor - κB (RANK), thereby inhibiting the downstream signaling pathway of osteoclast differentiation, reducing the generation of osteoclasts, and alleviating bone - destructive diseases such as osteoporosis or rheumatoid arthritis. Moreover, it has no obvious cytotoxicity and hepatorenal toxicity, providing a new solution for the treatment of bone - destructive diseases.

[0005] To solve the above - mentioned technical problems, the technical solution provided by the present invention is:

[0006] The application of Trichinella - derived RANKL - targeting protein TsPULP in any of the following aspects:

[0007] 1) Inhibiting osteoclast differentiation;

[0008] 2) Preventing and treating bone destruction;

[0009] 3) Alleviating bone loss caused by osteoporosis;

[0010] 4) Alleviating bone destruction caused by rheumatoid arthritis and arthritis.

[0011] Furthermore, the amino acid sequence of the Trichinella - derived RANKL - targeting protein TsPULP is any of the following:

[0012] (1) The amino acid sequence shown in SEQ ID NO.1;

[0013] (2) A protein with the same function in which one or several amino acid residues in the amino acid sequence shown in SEQ ID NO.1 are substituted and / or deleted and / or added;

[0014] (3) The amino acid sequence of a protein that can hybridize with the coding sequence of the amino acid sequence shown in SEQ ID NO.1 under moderately stringent conditions and encodes a protein with the same function.

[0015] Furthermore, it is achieved by the Trichinella - derived RANKL - targeting protein TsPULP competitively binding to RANKL and inhibiting the binding of RANK to RANKL.

[0016] Furthermore, the Trichinella - sourced RANKL - binding protein TsPULP inhibits the activation of the downstream signaling pathway of osteoclasts and the expression of osteoclast - related proteins, thereby inhibiting bone resorption or osteoclast activity.

[0017] Use of the Trichinella - sourced RANKL - binding protein TsPULP in the preparation of a drug for treating osteoclast - induced bone diseases.

[0018] Furthermore, the drug includes a drug for inhibiting osteoporosis caused by osteoclasts.

[0019] Furthermore, the drug for inhibiting osteoporosis caused by osteoclasts is a drug for treating rheumatoid arthritis and bone - destructive diseases caused by arthritis.

[0020] Use of the Trichinella - sourced RANKL - binding protein TsPULP in the preparation of a drug for inhibiting osteoclast differentiation in vitro.

[0021] Furthermore, the Trichinella - sourced RANKL - binding protein TsPULP is used for preparing a drug for inhibiting in - vivo bone loss caused by over - activation of osteoclasts.

[0022] Furthermore, the method for preparing the Trichinella - sourced RANKL - targeted protein TsPULP is as follows:

[0023] 1) Prepare the Trichinella excretory - secretory antigen TsMES;

[0024] 2) Based on the number of unique peptides, the number of times the unique peptides are detected, and the amino acid coverage, preliminarily screen the proteins in the Trichinella excretory - secretory antigen that bind to RANKL, and screen the proteins TsPULP, Uncharacterized protein, and Tubulin alpha chain that can bind to RANKL;

[0025] 3) Verify the binding ability of the target proteins TsPULP, Uncharacterized protein, and Tubulin alpha chain screened in 2) to RANKL, and confirm that only TsPULP can directly bind to RANKL;

[0026] 4) Extract the mRNA of Trichinella;

[0027] 5) Using the mRNA obtained in step 4) as a template, obtain cDNA after reverse transcription;

[0028] 6) Using the reverse - transcribed cDNA obtained in step 5) as a template, PCR amplify the target gene TsPULP as shown in SEQ ID NO.2, and the primer sequences are:

[0029] Forward primer: F - GGAATTCTTGATTTTTGCTGGAAAGCAATTAGAA (SEQ ID NO.3)

[0030] Reverse primer: R - CCAAGCTTTTACTTCGCAGAGAAATTTCCACGGT (SEQ ID NO.4)

[0031] 7) The target gene obtained in step 6) was digested with XhoⅠ and HindⅢ and then ligated to the His-tag-containing PET-28a vector to construct the recombinant vector PET-28a-TsPULP;

[0032] 8) The recombinant vector PET-28a-TsPULP obtained in step 7) was transformed into DH5α competent cells. After sequencing and comparison, the positive plasmid was obtained, and then it was transferred into DE3 competent cells and screened with 50 ng / ml kanamycin to obtain the positive bacteria expressing TsPULP protein;

[0033] 9) The recombinant positive plasmid obtained in step 8) was induced for expression;

[0034] 10) The Trichinella spiralis TsPULP recombinant protein after induced expression was purified to obtain a single Trichinella spiralis-derived RANKL-binding protein TsPULP.

[0035] The beneficial effects of the present invention are as follows:

[0036] The present invention verifies that TsPULP can effectively bind to human and murine RANKL, competitively inhibit the binding of RANKL to RANK, thereby reducing the generation of osteoclasts, alleviating bone loss in animal models of bone destructive diseases such as osteoporosis or arthritis, and no obvious cytotoxicity and hepatorenal toxicity were found. TsPULP can be directly expressed and produced by Escherichia coli, with stable properties, large yield, and low production cost. Description of the Drawings

[0037] The drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation to the present invention. In the drawings:

[0038] Figure 1 It is the protein result diagram of the protein in TsMES that binds to murine RANKL (murine RANKL, mRANKL); a. The pulldown experiment verifies the protein that can bind to mRANKL screened by proteomics; b. The ELISA experiment verifies that the binding of TsPULP to mRANKL is concentration-dependent; c. The SPR experiment detects the affinity result diagram of the binding of TsPULP to mRANKL;

[0039] Figure 2 Protein result diagram of the binding to human RANKL (hRANKL) in TsMES; a. Pulldown experiment to verify the protein that can bind to hRANKL; b. ELISA experiment to verify that the binding of TsPULP to hRANKL is concentration-dependent; c. SPR experiment to detect the affinity result diagram of the binding between TsPULP and hRANKL;

[0040] Figure 3 Diagram of TsPULP competitively inhibiting the binding of RANKL to RANK; a. Complex model diagram of the binding of TsPULP to mRANKL predicted by AlphaFold2, where the red amino acid residues are the amino acid residues with an interaction distance less than between the two proteins analyzed by UCSF Chimera; b. Complex structure diagram of the binding of mRANKL to mRANK, where the red amino acid residues are the amino acid residues with an interaction distance less than between the two proteins analyzed by UCSF Chimera; c. Merged diagram of the binding of mRANKL to TsPULP and mRANK, where the red amino acid residues are the amino acid residues where mRANKL binds to TsPULP and mRANK simultaneously; d. Complex model diagram of the binding of TsPULP to hRANKL predicted by AlphaFold2, where the red amino acid residues are the amino acid residues with an interaction distance less than between the two proteins analyzed by UCSF Chimera; e. Complex structure diagram of the binding of hRANKL to hRANK, where the red amino acid residues are the amino acid residues with an interaction distance less than between the two proteins analyzed by UCSF Chimera; f. Merged diagram of the binding of hRANKL to TsPULP and hRANK, where the red amino acid residues are the amino acid residues where hRANKL binds to TsPULP and hRANK simultaneously; g. Result diagram of the competitive SPR experiment to verify that TsPULP inhibits the binding of mRANKL to mRANK; h. Result diagram of the competitive SPR experiment to verify that TsPULP inhibits the binding of hRANKL to hRANK;

[0041] Figure 4Figure for the in vitro inhibition of mRANKL-induced osteoclast differentiation of mouse BMDMs by TsPULP; a. Western blot verification of the results of the expression levels of osteoclast differentiation-related proteins in mouse BMDMs induced by mRANKL inhibited by TsPULP; b. Western blot gray value statistical chart; c. TRAP staining verification of the typical figure of the inhibition of mRANKL-induced osteoclast formation in mouse BMDMs by TsPULP; d. Statistical chart of the number of TRAP-positive cells.

[0042] Figure 5 Figure for the in vitro inhibition of hRANKL-induced osteoclast differentiation of human PBMCs by TsPULP; a. Western blot verification of the results of the expression levels of osteoclast differentiation-related proteins in human PBMCs induced by hRANKL inhibited by TsPULP; b. Western blot gray value statistical chart; c. TRAP staining verification of the typical figure of the inhibition of hRANKL-induced osteoclast formation in human PBMCs by TsPULP; d. Statistical chart of the number of TRAP-positive cells.

[0043] Figure 6 Figure for the results of TsPULP alleviating bone loss in OVX mice; a. Typical figure of micro-CT scanning of femurs of mice in each group; b. Statistical chart of femoral parameters of mice in each group; c. TRAP staining verification of the typical figure of the inhibition of osteoclast formation in the femurs of OVX mice by TsPULP; d. Statistical chart of the number of TRAP-stained positive cells in the femurs of mice.

[0044] Figure 7 Figure for the results of TsPULP alleviating bone erosion in CIA mice; a. Typical figure of micro-CT scanning of paw bones of mice in each group; b. Statistical chart of paw bone parameters of mice in each group; c. TRAP staining verification of the typical figure of the inhibition of local osteoclast formation in the paws of CIA mice by TsPULP; d. Statistical chart of the number of TRAP-stained positive cells in the paws of mice.

[0045] Figure 8 Figure for the toxicity detection results of TsPULP; a. Results of the effect of TsPULP on the cell viability of mouse BMDMs and human PBMCs detected by CCK8; c. Figure of the effect of TsPULP on mouse liver tissue detected by HE staining; d. Figure of the effect of TsPULP on mouse kidney tissue detected by HE staining. Detailed implementation mode

[0046] The preferred embodiments of the present invention will be described below in conjunction with the accompanying drawings. It should be understood that the following examples are given only for the purpose of illustration and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0047] Example 1. Preparation of Trichinella spiralis excretory-secretory antigen TsMES

[0048] After sacrificing ICR mice used for preservation by cervical dislocation, remove the animal's skin, internal organs, adipose tissue, etc. Cut them into pieces and put them into a meat grinder. Add 200 ml of distilled water, grind for 2 min, stop for 1 min, repeat three times. Pour it out, add 1% pepsin and hydrochloric acid, stir evenly and put it in a 37 °C water bath for 4 h for digestion. After digestion, add 1.7 g of sodium chloride to terminate. Filter through a 100-mesh sieve, let it stand for 40 min to allow the worms to settle to the bottom of the beaker, and pour out the suspended impurities. Centrifuge the worm precipitate at the bottom and collect it in a 15-ml tube. Rinse it 20 times with 2% penicillin-streptomycin in a biosafety cabinet. Immerse it at 3000 - 5000 worms / ml in 1640 medium and incubate it in an incubator at 37 °C, 5% CO 2 for 48 h. After 48 h, filter the liquid through a 200-mesh sieve and collect it in a 15-ml tube. Centrifuge at 5000 rpm at 4 °C for 10 min. The excretory-secretory antigen is contained in the obtained supernatant. Transfer the supernatant to a 3KD concentrator tube, centrifuge at 4000 rpm at 4 °C for 40 min for concentration, and replace it with phosphate buffer (PBS). When the final remaining liquid is 1 ml, stop concentration to obtain Trichinella spiralis excretory-secretory antigen.

[0049] Example 2. Screening of proteins in Trichinella spiralis excretory-secretory antigen that bind to mRANKL

[0050] Incubate 5 μg of Trichinella excretory-secretory antigen with 5 μg of mouse RANKL at 4°C for 4 - 6 h. Add RANKL antibody at a ratio of 1:200 and incubate at 4°C for 4 - 6 h. Finally, add protein A / G agarose beads. After incubation, centrifuge at 3000 rpm at 4°C for 4 min, collect the bottom agarose beads, wash them 3 - 4 times with PBS, then perform SDS-PAGE electrophoresis and identify the protein bands by mass spectrometry to analyze whether there are proteins that can bind to mouse RANKL. Based on indicators such as the number of unique peptides, the number of times the unique peptides were detected, and the amino acid coverage, several proteins that may bind to mRANKL were initially identified, as shown in Table 1. Select the top three proteins in terms of the comprehensive ranking of the number of unique peptides, the number of times the unique peptides were detected, and the amino acid coverage, namely Polyubiquitin-like protein, Uncharacterized protein, and Tubulin alpha chain, for further identification to clarify the single protein that can bind to RANKL.

[0051] Table 1

[0052]

[0053] Example 3. Expression and purification of a single Trichinella-derived protein that binds to mRANKL

[0054] First, extract the mRNA of Trichinella using the Trizol method. After reverse transcription, obtain cDNA, and PCR amplify the target genes (Polyubiquitin-like protein, Uncharacterized protein, Tubulin alpha chain). After double digestion (XhoⅠ and HindⅢ), ligate them to the PET-28a (containing His tag) vector. Transform the recombinant vectors PET-28a-Polyubiquitin-like protein, PET-28a-Uncharacterized protein, and PET-28a-Tubulin alpha chain into DH5α competent cells. After sequencing and comparison, obtain the positive plasmids, and then transfer them into DE3 competent cells and screen with kanamycin (50 ng / ml) to complete the construction of positive expression bacteria. Inoculate the positive expression bacteria into 1 L of LB medium. When the bacterial amount expands to OD 600When = 0.6 - 0.8, add IPTG, induce at 16 °C for 12 - 16 h, centrifuge, collect the bacterial precipitate, resuspend and sonicate, then centrifuge at high speed. Since all three proteins are inclusion bodies, discard the supernatant, dissolve the protein precipitate with binding buffer containing 6 M guanidine hydrochloride, and sonicate with an output intensity of 30%, sonicate for 10 min, centrifuge at 12,000 rpm for 30 min, collect the supernatant, and combine it with Ni 2+ Incubate with affinity chromatography medium for 2 h, wash away impurities with 50 mM imidazole, and elute with 500 mM imidazole to obtain the target protein. Then dialyze it overnight at 4 °C in 20 mM Tris - HCl, centrifuge at 12,000 rpm for 15 min, collect the protein precipitate, and then use a protein renaturation kit for denaturation and renaturation to obtain a soluble protein solution. Detect the purity of the purified target protein by SDS - PAGE gel electrophoresis and determine its concentration by the BCA method.

[0055] Example 4. Expression and purification of murine and human RANKL and RANK

[0056] (1) Expression and purification of murine and human RANKL

[0057] Perform vector construction according to the method in 3 above. Construct murine RANKL (murine RANKL, mRANKL) and human RANKL (human RANKL, hRANKL) onto the plasmid PEGX - 6P - 1 vector (expressing GST tag), screen positive clones, and induce protein expression. Induce expression for 12 - 16 h, centrifuge, collect the bacterial precipitate, resuspend with binding buffer and sonicate, centrifuge at high speed, collect the supernatant, incubate it with GST - binding resin for 2 h, and elute the target protein with elution buffer containing 10 mM reduced glutathione. Dialyze it into GST - tag protease cleavage buffer, add protease at a ratio of 2 U per 100 μg of protein, cleave at 4 °C for 4 - 8 h, then add it to glutathione - agarose resin for binding, centrifuge, collect the supernatant (containing the target protein), detect the purity of the purified target protein (mRANKL and hRANKL) by SDS - PAGE gel electrophoresis and determine its concentration by the BCA method.

[0058] (2) Expression and purification of murine and human RANK

[0059] Construct murine RANK (murine RANK, mRANK) and human RANK (human RANK, hRANK) onto the PET - 28a vector for expression according to the method in 3. Since they are also inclusion bodies, purify and renature them according to the method in 3 to obtain the target proteins (mRANK and mRANKL), and determine the protein concentration by the BCA method.

[0060] Example 5. Verification of the binding of the screened target proteins Polyubiquitin-like protein, Uncharacterized protein, Tubulin alpha chain to mRANKL

[0061] (1) Verification of proteins that can bind to mRANKL by pull-down assay

[0062] Bind 5 μg of the cloned and expressed GST-mRANKL fusion protein to glutathione agarose beads at 4°C for 4 - 6 h. Add 5 μg of the top three proteins (Polyubiquitin-like protein, Uncharacterized protein, Tubulin alpha chain) respectively, incubate for 2 h, centrifuge to collect the precipitate, wash three times with PBS to remove non-specifically bound proteins, then resuspend with 50 μl of PBS. After electrophoresis, perform western blot to detect whether these three proteins can directly bind to mRANKL. Figure 1 a shows that only Trichinella polyubiquitin-like protein (Polyubiquitin-like protein, TsPULP) can directly bind to mRANKL.

[0063] (2) Verification of the binding of TsPULP to mRANKL by ELISA assay

[0064] Coat the bottom of the ELISA plate with TsPULP protein at different doses (0, 0.25, 0.5, 1, 2, 4, 8, 16 μg / ml) overnight at 4°C. Wash three times with PBST, after blocking, add GST-mRANKL at a dose of 1 μg / well, and add an equal amount of BSA as a negative control. Incubate at room temperature for 2 h, wash, then add GST antibody, and then add HRP-labeled goat anti-mouse secondary antibody. Develop color with TMB for 10 - 15 min, add the stop solution to terminate the color development. Measure the absorbance value of each group at a wavelength of 450 nm using an enzyme-linked immunosorbent assay reader, and observe the change in the binding ability of mRANK to mRANKL with the increase in the content of TsPULP. Figure 1 b shows that compared with the negative control BSA, as the amount of TsPULP protein coated on the bottom of the plate increases, the absorbance value of GST-mRANKL also increases, indicating that the binding of TsPULP to mRANKL is concentration-dependent.

[0065] (3) Observation of the binding affinity of TsPULP to mRANKL by surface plasmon resonance (SPR) technology

[0066] mRANKL was immobilized on the CM5 chip, and protein solutions of TsPULP with different concentrations of 15.625 nM, 31.25 nM, 62.5 nM, 125 nM, 250 nM, and 500 nM were used as the mobile phase to flow through the surface of the channel immobilized with RANKL. The dissociation constant (KD) value (dissociation constant Kd / association constant Ka) was calculated based on the change data of the final refractive index of the protein surface, and the binding affinity of TsPULP was observed. Figure 1 c shows that the binding affinity between the two is 3.27 nM, indicating that TsPULP has a strong binding force with mRANKL directly.

[0067] (4) Verify the binding ability of TsPULP to hRANKL

[0068] 1) Pull down experiment to verify the binding of TsPULP to hRANKL

[0069] Perform pull down detection according to the method of Example 5(1). Figure 2 a shows that TsPULP can directly bind to hRANKL in vitro.

[0070] 2) ELISA experiment to verify the binding of TsPULP to hRANKL

[0071] Perform ELISA detection according to the method of Example 5(2). Figure 2 b shows that the binding of TsPULP to hRANKL is concentration-dependent.

[0072] 3) Observe the binding affinity of TsPULP to hRANKL by surface plasmon resonance (SPR) technology. Perform SPR according to the method of Example 5(3) to detect the binding affinity of TsPULP to hRANKL. Figure 2 c shows that the affinity between the two is 62.4 nM, indicating that there is a strong binding force between TsPULP and hRANKL.

[0073] Example 6. TsPULP competitively inhibits the binding of human and murine RANKL to RANK

[0074] (1) Comparison of the binding sites of RANKL, TsPULP, and RANK

[0075] The amino acid sequences of mRANKL and TsPULP, and hRANKL and TsPULP were respectively input into the molecular docking algorithm AlphaFold2 (https: / / colab.research.google.com / github / sokrypton

[0076] In / ColabFold / blob / main / AlphaFold2.ipynb (AlphaFold), the protein structure and interaction sites were predicted, the model with the highest score was selected, and it was imported into the UCSF Chimera tool to analyze the amino acids with an interaction distance less than between the two proteins, so as to predict the amino acid sites in RANKL that can interact with TsPULP and compare them with the resolved structures. Figure 3 a-f show that there are sites in both human and mouse RANKL that can bind to both TsPULP and RANK simultaneously, indicating that human and mouse RANK can bind to TsPULP and RANK simultaneously.

[0077] (2) Competitive SPR experiment to verify the ability of TsPULP to inhibit the binding of RANKL to RANK

[0078] mRANK or hRANK was immobilized on the CM5 chip respectively. Different concentrations of TsPULP protein solutions of 0, 0.5 μM, 1 μM, and 2 μM were incubated with 500 nM of mRANKL or hRANKL at room temperature for 1 h. The mixture was used as the mobile phase and flowed through the surface of the channel immobilized with RANK. By observing the change in the RU value of the binding of RANKL to RANK, the ability of TsPULP to competitively inhibit the binding of RANKL to RANK was observed. Figure 3 g-h show that as the concentration of TsPULP increases, the RU values of the binding of human and mouse RANKL to RANK both decrease, indicating that TsPULP can inhibit the binding of human and mouse RANKL to RANK.

[0079] Example 7. TsPULP inhibits the differentiation of mouse bone marrow macrophages into osteoclasts in vitro

[0080] (1) Induction of mouse bone marrow macrophages (BMDMs) into osteoclasts

[0081] After C57 mice were sacrificed by cervical dislocation, their femurs and tibias were taken, and the bone marrow cells were rinsed clean with PBS and placed in DMEM complete medium (containing 1% penicillin-streptomycin and 10% fetal bovine serum), and incubated at 37 °C and 5% CO 2 in an incubator overnight. The next day, the cells were centrifuged at 500 g for 5 min, and the adherent cells in the supernatant were collected and placed in DMEM complete medium containing 30 ng / ml M-CSF and cultured in an incubator. The next day, 50 ng / ml of RANKL was added for induction, and the medium was changed every three days to keep the concentrations of M-CSF and RANKL unchanged. BMDMs were obtained after 5-7 days of induction.

[0082] (2) Western blot verification of the inhibition of the activation of osteoclast signaling pathways by TsPULP in mice

[0083] The mouse BMDMs obtained above were seeded in 6-well plates. After the cells adhered, 50 ng / ml mRANKL was added, and at the same time, TsPULP was added. The groups were as follows: ① PBS group; ② mRANKL group; ③ mRANKL + TsPULP group. After stimulation for 60 min, the cells were collected. After lysing the cells with RIPA, the expression of proteins related to osteoclast signaling pathways was detected by Western blot. Figure 4 a - b showed that compared with the mRANKL group, after adding TsPULP, the protein levels of molecules related to osteoclasts (p-p65, p-iκB, p-p38, p-ERK, p-JNK, NFAT) decreased, indicating that TsPULP could significantly inhibit the expression of osteoclast-related proteins in mouse BMDMs induced by mRANKL.

[0084] (3) Observation of the number of osteoclasts formed by TRAP staining

[0085] A large amount of tartrate-resistant alkaline phosphatase (TRAP) can be expressed in mature osteoclasts and can be stained purple-red or wine-red by TRAP staining. Therefore, TRAP staining was used to analyze the effect of TsPULP on the in vitro differentiation of osteoclasts. The mouse bone marrow BMDMs obtained above were seeded in 48-well plates at 5×10 4 / well, and DMEM complete medium containing 30 ng / ml M-CSF and 50 ng / ml mRANKL was added. At the same time, TsPULP was added, and the grouping was the same as above. The cell fusion state was observed every day. After cell fusion on the 5th - 7th day, the supernatant was discarded, and the cells were fixed with 4% paraformaldehyde at room temperature for 10 min. Osteoclast staining was performed using a TRAP staining kit. After rinsing with double-distilled water, the nuclei were stained with hematoxylin. After bluing with tap water, photographs were taken under an optical microscope. Cells with three or more nuclei and cytoplasm stained wine-red or purple-red were osteoclasts. The number of osteoclasts in each well was counted to observe the effect of TsPULP on the formation of mouse osteoclasts induced by mRANKL in vitro. Figure 4 c - d showed that compared with the mRANKL group, after adding TsPULP, the number of TRPA-positive osteoclasts decreased significantly, indicating that TsPULP could significantly inhibit the formation of mouse osteoclasts in vitro.

[0086] Example 8. In vitro inhibition of the differentiation of human peripheral blood monocytes into osteoclasts by TsPULP

[0087] (1) Induction of human peripheral blood monocytes (PBMCs) into osteoclasts

[0088] Human peripheral blood was placed in human peripheral blood mononuclear cell separation fluid, and mononuclear cells (PBMCs) were extracted under the condition of differential centrifugation (3000 rpm, 30 min, with the acceleration and deceleration speed at gear 3). The human peripheral blood CD14 monocytes were extracted by immunomagnetic bead separation method using the CD14 MicroBead Kit monocyte sorting kit (Miltenyi Biotec GmbH, Germany) according to the kit instructions. + The monocytes were inoculated into cell culture dishes, and αMEM complete medium containing 30 ng / ml M-CSF was added to induce them into macrophages.

[0089] (2) Western blot was used to verify the inhibition of the activation of the osteoclast signaling pathway by TsPULP

[0090] The human macrophages obtained above were inoculated into 6-well plates. After the cells adhered, 50 ng / ml RANKL was added, and TsPULP was added simultaneously. The groups were as follows: ① PBS group; ② hRANKL group; ③ hRANKL + TsPULP group. After stimulating for 60 min, the cells were collected. After lysing the cells with RIPA, the expression of proteins related to the osteoclast signaling pathway was detected by Western blot. Figure 5 a - b showed that compared with the hRANKL group, after adding TsPULP, the protein levels of molecules related to osteoclasts (p-p65, p-iκB, p-p38, p-ERK, p-JNK, NFAT) decreased. TsPULP could significantly inhibit the expression of osteoclast-related proteins in human PBMCs induced by hRANKL.

[0091] (3) TRAP staining was used to observe the number of osteoclasts formed

[0092] The human macrophages obtained above were inoculated into 48-well plates at 5×10 4 / well. DMEM complete medium containing 30 ng / ml M-CSF and 50 ng / ml hRANKL was added, and TsPULP was added simultaneously. The grouping was the same as above. The cell fusion state was observed every day. After cell fusion on days 10 - 14, TRAP staining was performed according to the method of Example 7(3), and the number of osteoclasts was counted to observe the effect of TsPULP on the differentiation of human peripheral blood monocytes into osteoclasts induced by hRANKL in vitro. Figure 5 c - d showed that compared with the hRANKL group, after adding TsPULP, the number of TRPA-positive osteoclasts decreased significantly, indicating that TsPULP could significantly inhibit the formation of osteoclasts in human PBMCs in vitro.

[0093] Example 9. TsPULP alleviates bone loss in ovariectomized osteoporosis (OVX) mice

[0094] C57BL / 6 female mice were used to establish an ovariectomized (OVX) mouse model of osteoporosis by ovariectomy. They were randomly divided into 4 groups of 8 mice each: ① Sham operation group (Sham group); ② Simple ovariectomy group (OVX group); ③ OVX + TsPULP (1 mg / kg) group; ④ OVX + TsPULP (2 mg / kg) group. Each group of mice was anesthetized with 3% sodium pentobarbital, and each mouse was intraperitoneally anesthetized at a dose of 0.1 ml / 100 g. The back side was shaved and disinfected with iodophor. In the OVX group, a longitudinal incision about 1 cm was made on the back side, the skin and muscle were separated, ligated at the end of the uterus, and both bilateral ovaries were removed; in the sham operation group (Sham group), only a part of the adipose tissue around the ovaries was removed, and after suturing, they were routinely raised for one week. The OVX + TsPULP group was treated with TsPULP by intraperitoneal injection one week later. The mice were sacrificed at the eighth week after modeling to observe the effect of TsPULP on bone destruction in osteoporotic mice.

[0095] (1) Observation of the degree of bone loss in osteoporotic mice by Micro-CT and 3D modeling technology

[0096] The bilateral femurs of the mice were fixed in 4% paraformaldehyde, and the fixed femurs were subjected to Micro-CT tomographic scanning using a Scanco Micro-CT 50 imaging system (SCANCO Company, Switzerland). Three-dimensional analysis software (VGStudioMAX) was used for analysis to measure indicators such as bone volume / tissue volume percentage (BV / TV), bone mineral density (BMD), trabecular bone number (Tb.N), and trabecular bone thickness (Tb.Th) of the femurs of each group of mice, and to observe the effect of TsPULP on bone loss in osteoporotic mice. Figure 6 As shown in a - b, compared with the OVX group, after intraperitoneal injection of TsPULP, indicators such as BV / TV, BMD, Tb.N, and Tb.Th were all significantly increased, indicating that TsPULP can significantly relieve bone loss in OVX mice.

[0097] (2) Detection of the activation level of osteoclasts in the femurs of osteoporotic mice by TRAP staining

[0098] The fixed femurs were decalcified and made into paraffin sections. After dewaxing, they were placed in 0.1M CaCl 2 -MgCl 2Immerse in the solution to activate tartrate-resistant acid phosphatase (TRAP). After rinsing with PBS, prepare the staining solution according to the instructions of the TRAP staining kit, perform TRAP staining, stain at 37 °C for 45 min, rinse with double-distilled water, stain the nuclei with hematoxylin, blue back with tap water, dry and mount the slides, and then count the osteoclasts under a light microscope to observe the effect of TsPULP on the number of osteoclasts in osteoporotic mice. Figure 6 c-d show that compared with the OVX group, after intraperitoneal injection of TsPULP, the number of osteoclasts in the femurs of mice was significantly reduced, indicating that TsPULP can inhibit the formation of osteoclasts in OVX mice.

[0099] Example 10. TsPULP alleviates bone destruction in collagen-induced arthritis (CIA) mice

[0100] Randomly divide male DBA / 1 mice into four groups, including: ① normal control group (Control group); ② model group (CIA group); ③ CIA + TsPULP group (1 mg / kg); ④ CIA + TsPULP group (2 mg / kg). Mix bovine type II collagen (collagen II, CII) and complete Freund's adjuvant (CFA) and emulsify (100 μg CII, 100 μL / mouse). Immunize intradermally at 1.5 cm from the base of the mouse tail. Take the first collagen induction as day 0, and on day 21, change to an equal volume mixture of incomplete Freund's adjuvant and CII, and boost the immunization in the same method to prepare the CIA model. The CIA + TsPULP groups were treated with TsPULP by intraperitoneal injection starting from day 0. After the second boost immunization, observe the incidence and joint scores of mice in each group every other day. Sacrifice the mice on day 49 to observe the effect of TsPULP on bone erosion in CIA mice.

[0101] (1) Observe the degree of bone destruction in CIA mice by Micro-CT and 3D modeling techniques

[0102] Take the mouse paw, fix it in 4% paraformaldehyde, perform Micro-CT scanning according to the method in Example 9(1), and calculate bone parameter indexes such as BV / TV and Tb.Th to observe the effect of TsPULP on bone destruction in CIA mice. Figure 7 a-b show that compared with the CIA group, after intraperitoneal injection of TsPULP, indexes such as BV / TV and Tb.Th were significantly increased, indicating that TsPULP can significantly alleviate bone destruction in CIA mice.

[0103] (2) Detect the activation level of local osteoclasts in the joints of CIA mice by TRAP staining

[0104] The fixed femurs were decalcified and made into paraffin sections, and TRAP staining was performed according to the method of Example 9(2) to observe the effect of TsPULP on the number of osteoclasts in osteoporotic mice. Figure 7 c-d showed that compared with the CIA group, after intraperitoneal injection of TsPULP, the number of osteoclasts in the femurs of mice was significantly reduced, indicating that TsPULP could inhibit the formation of local osteoclasts in the joints of CIA mice.

[0105] Example 11. Toxicity detection of TsPULP

[0106] (1) CCK8 assay for the cytotoxicity of TsPULP

[0107] The mouse BMDM obtained in Example 7 and human PBMCs obtained in Example 8 were respectively inoculated into 96-well plates at 1×10 4 After overnight adherence, different concentration gradients of TsPULP at 0, 1, 2, 4, 8, 16 μg / ml were added in serial dilutions. After incubation for 24 h, CCK8 reagent was added, and the absorbance was measured at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader after 4 h to observe the cytotoxicity of TsPULP. Figure 8 a showed that TsPULP had no significant cytotoxicity to mouse BMDM and human PBMCs.

[0108] (2) HE staining for the liver and kidney toxicity of TsPULP

[0109] To detect the toxicity of TsPULP to the liver and kidney tissues of mice, C57 mice were divided into three groups: PBS group, low-dose TsPULP (1 mg / kg), and high-dose TsPULP (2 mg / kg). TsPULP was injected once a day for 8 consecutive weeks. After 8 weeks, the livers and kidneys of the mice were taken, fixed in 4% paraformaldehyde overnight, embedded, sectioned, and then HE staining was performed to observe the effect of TsPULP on the livers and kidneys of mice. Figure 8 b showed that after intraperitoneal injection of TsPULP, there was no obvious infiltration of inflammatory cells in the liver tissue, the hepatocytes were arranged regularly, and the hepatic lobule structure was normal. There was no obvious change compared with the non-injected group; Figure 8 c showed that after intraperitoneal injection of TsPULP, the renal tubular epithelial cells in the kidney tissue were arranged neatly, the interstitial tissue had no edema, fibrosis or inflammation, the glomerular basement membrane was intact, and there was no atrophy or sclerosis. There was also no obvious change compared with the non-injected group. The above results indicated that TsPULP did not show obvious liver and kidney toxicity in vivo and had relatively few side effects.

[0110] The content not described in detail in this specification belongs to the prior art well known to those of ordinary skill in the art.

[0111] Finally, it should be noted that the above are only preferred examples of the present invention and are not used to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or perform equivalent replacements on some of the technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Application of Trichinella spiralis-derived RANKL binding protein TsPULP in any of the following aspects: 1) Inhibit osteoclast differentiation; 2) Prevent and treat bone destruction; 3) Alleviate bone loss caused by osteoporosis; 4) Relieve rheumatoid arthritis and arthritis.

2. The use according to claim 1, characterized in that: The amino acid sequence of the Trichinella spiralis-derived RANKL binding protein TsPULP is any one of the following: (1) the amino acid sequence of the amino acid sequence shown in SEQ ID NO.1; (2) A protein having the same function as the one shown in SEQ ID NO. 1, in which one or more amino acid residues are substituted and / or deleted and / or added; (3) An amino acid sequence that can hybridize with the coding sequence of the amino acid sequence shown in SEQ ID NO. 1 under moderately stringent conditions and encodes a protein with the same function.

3. The use according to claim 1, characterized in that: This is achieved by the Trichinella spiralis-derived RANKL targeting protein TsPULP competitively binding to the nuclear factor κB receptor activator ligand RANKL and inhibiting the binding of RANK and RANKL.

4. The use according to claim 1, characterized in that: The Trichinella spiralis-derived RANKL targeting protein TsPULP inhibits the activation of downstream signaling pathways of osteoclasts and the expression of osteoclast-related proteins, thereby inhibiting bone resorption or osteoclast activity.

5. Application of the Trichinella spiralis-derived RANKL targeting protein TsPULP in the preparation of drugs for the treatment of osteoclast-induced bone disease.

6. The use according to claim 5, characterized in that: The drugs include drugs for inhibiting osteoporosis caused by osteoclasts.

7. The use according to claim 6, characterized in that: The drug for inhibiting osteoporosis caused by osteoclasts is a drug for treating rheumatoid arthritis and bone destructive diseases caused by arthritis.

8. Use of the Trichinella spiralis-derived RANKL targeting protein TsPULP in the preparation of a drug for inhibiting RANKL-induced osteoclast differentiation in vitro.

9. The use according to claim 8, characterized in that: The Trichinella spiralis-derived RANKL targeting protein TsPULP is used to prepare a drug for inhibiting bone loss caused by excessive osteoclast activation in vivo.

10. The use according to claim 1, characterized in that: The method for preparing the Trichinella spiralis-derived RANKL targeting protein TsPULP is as follows: 1) Preparation of Trichinella spiralis excretory and secretory antigen TsMES; 2) Based on the number of unique peptides, the number of times unique peptides were detected, and the amino acid coverage, proteins that bind to RANKL in the excretory and secretory antigens of Trichinella spiralis were preliminarily screened, and proteins that can bind to RANKL, such as TsPULP, Uncharacterized protein, and Tubulin alpha chain; 3) Verify the binding ability of the screened target proteins TsPULP, Uncharacterized protein, Tubulin alpha chain and RANKL in 2) and confirm that only TsPULP can directly bind to RANKL; 4) Extracting mRNA of Trichinella spiralis; 5) using the mRNA obtained in step 4) as a template, obtaining cDNA after reverse transcription; 6) Using the reverse transcribed cDNA obtained in step 5) as a template, PCR amplify the target gene TsPULP as shown in SEQ ID NO.2; 7) The target gene obtained in step 6) was double-digested with XhoⅠ and HindⅢ and then connected to the PET-28a vector containing the His tag to construct the recombinant vector PET-28a-TsPULP; 8) The recombinant vector PET-28a-TsPULP obtained in step 7) was transformed into DH5α competent cells, and a positive plasmid was obtained after sequencing and comparison, which was then transferred into DE3 competent cells, and screened with 50 ng / ml kanamycin to obtain positive bacteria expressing TsPULP protein; 9) inducing the expression of the recombinant positive plasmid obtained in step 8); 10) The induced expressed Trichinella spiralis TsPULP recombinant protein was purified to obtain a single Trichinella spiralis-derived RANKL binding protein TsPULP.

Images