Saccharomyces cerevisiae strain for efficiently synthesizing cordycepin as well as construction method and application thereof

By integrating Cordyceps sinensis synthesis-related enzyme genes in Saccharomyces cerevisiae strains, the problem of low yield of Cordyceps sinensis in Saccharomyces cerevisiae was solved, and the effect of efficient synthesis of Cordyceps sinensis was achieved, and the yield was significantly improved.

CN120098813AActive Publication Date: 2025-06-06NANJING TECH UNIV

Patent Information

Application Number
CN202510290708.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-12
Publication Date
2025-06-06
Estimated Expiration
2045-03-12

AI Technical Summary

Technical Problem

In the prior art, the yield of synthetic cordyceps sinensis in Saccharomyces cerevisiae is relatively low and it is difficult to meet market demand.

Method used

Expressing cordyceps synthesis-related enzyme genes, including the 2’-carbonyl-3’-deoxyadenosine reductase gene and the 3’-adenosine monophosphate phosphate hydrolase gene, is optimized by multi-copy integration of the genome of Saccharomyces cerevisiae strains.

Benefits of technology

The synthesis capacity of Cordyceps sinensis was significantly improved, with the output reaching 0.93g/L, the output in the shaker reached 2.92g/L, and the output in the fermenter reached 7.5g/L.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120098813A_ABST
    Figure CN120098813A_ABST
Patent Text Reader

Abstract

The invention relates to a saccharomyces cerevisiae strain for efficiently synthesizing cordycepin as well as a construction method and application of the saccharomyces cerevisiae strain, and belongs to the technical field of microbial genetic engineering. The construction method provided by the invention comprises the following steps: carrying out multi-copy genome integrated expression on heterologous codon optimized 2 '-carbonyl-3'-deoxyadenosine reductase genes and 3 '-adenosine monophosphate phosphohydrolase genes, so as to increase the dosage of key enzymes; and supplementing the defective gene of the engineering strain to obtain the saccharomyces cerevisiae strain B5U3 with high yield of cordycepin. According to the obtained saccharomyces cerevisiae strain for efficiently synthesizing the cordycepin, the cordycepin yield reaches 2.92 g / L after shake flask fermentation, the cordycepin yield reaches 7.5 g / L after fermentation in a fermentation tank, and a foundation is laid for safer and more reliable industrial production of the cordycepin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to a high-cordycepin-producing yeast strain and a construction method and application thereof, belonging to the technical field of microbial genetic engineering. Background Art

[0002] Cordycepin is a nucleoside compound with a wide range of biological activities, and has a variety of pharmacological effects such as anti-tumor, anti-viral, and immunomodulatory. In recent years, the application demand of cordycepin in the fields of medicine, health products, and food additives has continued to increase. However, the natural sources of cordycepin are limited, and it mainly relies on extraction from natural fungi such as Cordyceps sinensis. The extraction cost is high and the yield is low, which is difficult to meet market demand. In recent years, with the development of synthetic biology and metabolic engineering, the biosynthesis of cordycepin using microorganisms has become a research hotspot. Among them, in Yarrowia lipolytica, a yield of 4.36g / L was achieved through metabolic engineering modification (such as optimization of glycolysis pathway and pentose phosphate pathway) and optimization of culture medium. In Pichia pastoris, a record of 19.5g / L was set in a 10L tank by strengthening methanol metabolism and cofactor balance. As a generally recognized safe microorganism (GRAS status), Saccharomyces cerevisiae has a longer application history and more reliable safety in food and drug production, and is a more ideal chassis cell for cordycepin biosynthesis. However, the current yield of cordycepin synthesized in Saccharomyces cerevisiae is still low. Therefore, the production of cordycepin in Saccharomyces cerevisiae is of far-reaching significance. Summary of the invention

[0003] Purpose of the invention: The technical problem to be solved by the present invention is to provide a high-yield cordycepin brewer's yeast strain and its construction method and application in view of the deficiencies in the prior art.

[0004] In order to solve the above technical problems, the present invention discloses a high-yield cordycepin yeast strain and its construction method and application. The specific technical scheme is as follows:

[0005] A saccharomyces cerevisiae strain that efficiently synthesizes cordycepin, wherein multiple copies of a cordycepin synthesis-related enzyme gene are integrated and expressed in the genome of the saccharomyces cerevisiae strain;

[0006] Wherein, the cordycepin synthesis-related enzyme genes include 2'-carbonyl-3'-deoxyadenosine reductase gene and 3'-adenosine monophosphate phosphohydrolase gene; the multi-copy integration, the integration site is the spacer length of the nearest essential gene ≥ 1kb. Preferably, the integration site includes any one or more combinations of Saccharomyces cerevisiae genome 1622b, 416d, 911b, 208a, 308a, 1309a, YPRCδ15c, 1021b, 1014a, HIS3b, YOLCd1b, SAP155b, CAN1y, SAP155c, 1114a, 720a, 1414a, 511b, X-2, X-3, XI-2, XI-3, XII-1 and XII-5. A combination of any one or more of 1622b, 416d, 911b, 208a, 308a, 1309a, 720a, 1414a and 511b is preferred, and a combination of 1622b, 416d, 911b, 208a and 308a is further preferred.

[0007] Wherein, the multiple copies are 2-30 copies, preferably 3-15 copies, and more preferably 5 copies.

[0008] Among them, 2'-carbonyl-3'-deoxyadenosine reductase and 3'-adenosine monophosphate phosphohydrolase are both derived from any one of Aspergillus hiratsukae, Penicillium fimorum, Aspergillus terricola var. indicus, Aspergillus similis, Aspergillus varians, Aspergillus nidulans, Aspergillustetrazonus, Aspergillus nidulans var. acristatus, Emericellopsis atlantica and Cordyceps militaris, preferably 2'-carbonyl-3'-deoxyadenosine reductase and 3'-adenosine monophosphate phosphohydrolase are both derived from Cordyceps militaris, and their NCBI accession numbers are XP_006669647 and XP_006669648, respectively. More preferably, the nucleotide sequences of the 2'-carbonyl-3'-deoxyadenosine reduction gene and the 3'-adenosine monophosphate phosphohydrolase gene are shown in SEQ ID No. 1-2, respectively.

[0009] Wherein, the 2'-carbonyl-3'-deoxyadenosine reductase gene and the 3'-adenosine monophosphate phosphohydrolase gene are driven to express by any one of the promoters PGK1, TEF1, GPD, TPI1, ADH1, TDH3, CYC1, HXT1, GAL1, GAL7, GAL10, CUP1 or MET25. Preferably, any one of TPI1, TDH3 and TEF1; more preferably, the 2'-carbonyl-3'-deoxyadenosine reductase gene is driven to express by the promoter TPI1, and the 3'-adenosine monophosphate phosphohydrolase gene is driven to express by the promoter TEF1.

[0010] The starting bacteria is any one of Saccharomyces cerevisiae BY4742, BY4741, W303-1A or CEN.PK2-1C. Preferably, the starting bacteria is Saccharomyces cerevisiae BY4742 or BY4741, and more preferably, the starting bacteria is Saccharomyces cerevisiae BY4742.

[0011] The genome of the yeast strain expresses any one or a combination of orotidine-5'-phosphate decarboxylase (URA3) gene, imidazole glycerol phosphate dehydrogenase (HIS3) gene, 3-isopropylmalate dehydrogenase (LEU2) gene and L-aminoadipic acid-semialdehyde dehydrogenase (LYS2) gene; the NCBI accession numbers of the orotidine-5'-phosphate decarboxylase, imidazole glycerol phosphate dehydrogenase, 3-isopropylmalate dehydrogenase and L-aminoadipic acid-semialdehyde dehydrogenase are NP_010893.3, NP_014845.1, NP_009911.2 and NP_009673.1, respectively. Preferably, the integration sites for orotidine-5'-phosphate decarboxylase, imidazoleglycerolphosphate dehydrogenase, 3-isopropylmalate dehydrogenase and L-aminoadipate-semialdehyde dehydrogenase include but are not limited to 1622b, 416d, 911b, 208a, 308a, 1309a, YPRCδ15c, 1021b, 1014a, HIS3b, YOLCd1b, SAP155b, CAN1y, SAP155c, 1114a, 720a, 1414a, 511b, X-2, X-3, XI-2, XI-3, XII-1 and XII-5. Further preferably, the genome of the Saccharomyces cerevisiae strain integrates and expresses the orotidine-5'-phosphate decarboxylase (URA3) gene, the imidazole glycerol phosphate dehydrogenase (HIS3) gene, the 3-isopropylmalate dehydrogenase (LEU2) gene and the L-aminoadipate-semialdehyde dehydrogenase (LYS2) gene.

[0012] In a second aspect, the present invention provides a method for constructing a Saccharomyces cerevisiae strain capable of efficiently synthesizing cordycepin according to the first aspect, comprising the following steps:

[0013] (1) amplifying a gene expression cassette for an enzyme related to cordycepin synthesis; the gene expression cassette for an enzyme related to cordycepin synthesis comprises a 2'-carbonyl-3'-deoxyadenosine reductase gene expression cassette and a 3'-adenosine monophosphate phosphohydrolase gene expression cassette;

[0014] (2) Using Crispr / Cas9 technology, the gene expression frame of the cordycepin synthesis-related enzyme described in step (1) is integrated into one or more integration sites of the genome of the starting yeast Saccharomyces cerevisiae for multi-copy expression to obtain a Saccharomyces cerevisiae strain that efficiently synthesizes cordycepin. Preferably, the multi-copy expression can be achieved through one round or multiple rounds.

[0015] Wherein, in step (1), the 2'-carbonyl-3'-deoxyadenosine reductase gene expression cassette comprises a promoter, a 2'-carbonyl-3'-deoxyadenosine reductase gene and a terminator, and the 3'-adenosine monophosphate phosphohydrolase gene expression cassette comprises a promoter, a 3'-adenosine monophosphate phosphohydrolase gene and a terminator.

[0016] Further preferably, the construction method further comprises step (3), wherein the step (3) is to amplify an auxotrophic gene expression cassette and integrate it into the genome of the Saccharomyces cerevisiae obtained in step (2) using Crispr / Cas9 technology; the auxotrophic gene expression cassette comprises any one or a combination of the URA3 gene expression cassette, the HIS3 gene expression cassette, the LEU2 gene expression cassette and the LYS2 gene expression cassette.

[0017] In the third aspect, the present invention provides the use of the Saccharomyces cerevisiae strain for efficiently synthesizing cordycepin described in the first aspect in the production of cordycepin. The Saccharomyces cerevisiae strain for efficiently synthesizing cordycepin is inoculated into a fermentation medium and fermented at 20 to 40°C for 96 to 144 hours to obtain cordycepin; the fermentation medium includes 10 to 100 g / L of a carbon source, 10 to 50 g / L of a nitrogen source, and 0.1 to 15 g / L of adenine. The carbon source is preferably glucose, and the nitrogen source is preferably yeast extract and / or peptone; preferably, the fermentation medium is cultured at 30°C for 144 hours, and includes 50 g / L of glucose, 10 g / L of yeast extract, 20 g / L of peptone, and 3 g / L of adenine, wherein the adenine is a precursor.

[0018] Preferably, the method for synthesizing cordycepin is as follows: the saccharomyces cerevisiae strain that efficiently synthesizes cordycepin is activated and cultured, and then inoculated into a 5L fermentation tank containing a fermentation medium, and the parameters of the fermentation tank are controlled as follows: the temperature is 28-30°C, the stirring speed is 400-600rpm, the ventilation volume is 6, the liquid volume is 2L, the pH is 5.5±0.1, and the dissolved oxygen is maintained at about 30%. After 13 hours of fermentation, feeding is carried out, during which the glucose concentration in the fermentation tank is controlled to be below 1.0g / L, and fermentation is carried out for 144 hours. Further preferably, the feed medium used for the feeding is 400g / L glucose.

[0019] Beneficial effects:

[0020] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0021] (1) The multi-copy integration of genes related to cordycepin synthesis increased the expression level of key enzymes and enhanced the ability to synthesize cordycepin. The cordycepin production of the multi-copy integrated expression engineered strain reached 0.93 g / L.

[0022] (2) Genome integration and expression of any one or a combination of orotidine-5'-phosphate decarboxylase (URA3), imidazole glycerol phosphate dehydrogenase (HIS3), 3-isopropylmalate dehydrogenase (LEU2) and L-aminoadipic acid-semialdehyde dehydrogenase (LYS2) improved the growth performance of the strain and increased the yield of cordycepin. The yield of cordycepin in the shake flask reached 2.92 g / L, and the yield of cordycepin in the fermenter reached 7.5 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0024] Figure 1 This is the pCas9-Hyg plasmid map in Example 1.

[0025] Figure 2 It is the cns expression cassette in Example 2.

[0026] Figure 3 The cordycepin yields of different base plate Saccharomyces cerevisiae strains in Example 2, where COR is cordycepin.

[0027] Figure 4 The figure is the liquid chromatography spectrum of cordycepin standard in Example 2.

[0028] Figure 5 This is the liquid chromatography spectrum of the recombinant bacteria B1 sample in Example 2.

[0029] Figure 6This is the standard mass spectrum of cordycepin in Example 2.

[0030] Figure 7 This is the mass spectrum of the recombinant strain B1 sample in Example 2.

[0031] Figure 8 OD of the 1-15 copy recombinant strain constructed in the present invention 600 and cordycepin production.

[0032] Fig. 9 The cordycepin yields at different integration sites in Example 4.

[0033] Fig.10 Schematic diagram of the integration site of the multi-copy strain B6 in Example 6.

[0034] Fig.11 Schematic diagram of the integration site of the multi-copy strain B11 in Example 7.

[0035] Fig.12 This is the cordycepin yield when the glucose concentration is optimized in Example 8.

[0036] Fig.13 This is the cordycepin yield when the adenine concentration is optimized in Example 9.

[0037] Fig.14 is the OD of the recombinant strains B5U, B5U1, B5U2, and B5U3 in Example 10 600 and cordycepin production.

[0038] Fig.15 This is the cordycepin yield after fed-batch fermentation of the recombinant strain B5U3 in a 5 L fermenter in Example 12. DETAILED DESCRIPTION

[0039] The present invention can be better understood according to the following examples. However, it is easy for those skilled in the art to understand that the contents described in the examples are only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims.

[0040] Example 1 Construction of CRISPR / Cas9 tool plasmid

[0041] Plasmid pCas9-Hyg was used as template [kindly donated by Professor Sheng Yang from Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences]. Figure 1 The vector was digested with restriction endonuclease BsaI, reacted at 37°C for 2 h, and then subjected to agarose gel electrophoresis. After gel cutting, the pCas9-Hyg linear vector was purified and recovered using a recovery kit to obtain the vector.

[0042] The sites on the genome that do not affect the growth of Saccharomyces cerevisiae strains were selected: 1622b, 416d, 911b, 208a, 308a, 1309a, XI-3 and XII-1 sites, and their N20 sequences corresponded to: GTCACGTTCCTGAGGTTACT; TAGTGCACTTACCCCACGTT; GTAATATTGTCTTGTTTCCC; GTCCGCTAAACAAAAGATCT; CACTTGTCAAACAGAATATA; CCTGTGGTGACTACGTATCC; GATATGTCTCTAATTTTGGA; GTGGAGCAAATAATGAGCAC. The N20 primers were designed as follows: 1622b-F / 1622b-R, 416d-F / 416d-R, 911b-F / 911b-R, 208a-F / 208a-R, 308a-F / 308a-R, 1309a-F / 1309a-R, XI-3-F / XI-3-R, XII-1-F / XII-1-R. The primer sequences are shown in Table 1. Annealing amplification was performed using the corresponding primers as templates. The system was: F 1 μL R 1 μL 1 10×Ligase Buffer 1 μL ddH 2 O 7 μL. PCR program: 94°C 5 min.

[0043] After annealing and amplification, the system was diluted 10 times to obtain the N20 fragment, and the N20 fragment was ligated with the linear vector fragment pCas9-Hyg using Norwegian's T4 ligase overnight. The enzyme-ligated product was transformed into the competent state of Trans1T1 by heat shock, cultured overnight, and the transformant was picked for sequencing. Finally, the corresponding plasmids pCas9-Hyg-1622b, pCas9-Hyg-416d, pCas9-Hyg-911b, pCas9-Hyg-208a, pCas9-Hyg-308a, pCas9-Hyg-1309a, pCas9-Hyg-XI-3 and pCas9-Hyg-XII-1 were obtained.

[0044] Example 2 Construction and fermentation of single copy strains

[0045] The cns expression cassette of the enzyme gene related to the synthesis of cordycepin is designed and synthesized. The cns expression cassette includes a 2'-carbonyl-3'-deoxyadenosine reductase cns1 gene expression cassette and a 3'-adenosine monophosphate phosphohydrolase cns2 gene expression cassette. The cns1 gene is obtained by optimizing the amino acid sequence as shown in XP_006669647 through the codon of Saccharomyces cerevisiae, and the nucleotide sequence is shown in SEQ ID No.1. The cns2 gene is obtained by optimizing the amino acid sequence as shown in XP_006669648 through the codon of Saccharomyces cerevisiae, and the nucleotide sequence is shown in SEQ ID No.2. The cns expression cassette is as shown in Figure 2 As shown, it is composed of a cns1 expression cassette and a cns2 expression cassette connected back to back, wherein the cns1 expression cassette is composed of promoter TPI1, cns1 and terminator ADH1t, and the cns2 expression cassette is composed of promoter TEF1, cns2 and terminator GAL2t. In the back-to-back connection, the 3' end of the promoter TPI1 in the cns1 expression cassette is connected to the cns1 gene, and the 5' end is connected to the 5' end of the promoter TEF1 in the cns2 expression cassette.

[0046] The construction process of the cns expression cassette is as follows: the optimized sequences of cns1 and cns2 are located on the default vector provided by the company, and the genome of BY4742 strain is used as a template and TPI1p-F / TPI1p-R are used as primers to amplify TPI1p; the default vector is used as a template and primers cns1-F / cns1-R are used for PCR to amplify the optimized sequence of cns1; the genome of BY4742 strain is used as a template and primers ADH1t-F / ADH1t-R are used to amplify ADH1t, and then primers TPI1p-F / ADH1t-R are used and the above amplified fragments are used as templates for overlap to obtain the cns1 expression cassette. The genome of BY4742 strain was used as a template and TEF1p-F / TEF1p-R was used as primers to amplify TEF1p; the default vector was used as a template and primers cns2-F / cns2-R were used for PCR to amplify the optimized sequence of cns2; the genome of BY4742 strain was used as a template and primers GAL2t-F / GAL2t-R were used to amplify GAL2t, and then primers TEF1p-F / GAL2t-R were used to overlap the fragments obtained by the above amplification to obtain the cns2 expression cassette. The primer sequences are shown in Table 1. The empty vector pG418 (kindly donated by Professor Liu Zihe of Beijing University of Chemical Technology) was digested with restriction endonucleases EcoR I and BamH I, and the reaction was carried out at 37°C for 2h before running agarose gel electrophoresis. After gel cutting, the pG418 linear vector was purified and recovered using a recovery kit to obtain the pG418 linear vector. Use one-step cloning enzyme to connect the pG418 linear vector and the cns1 expression cassette. The system is: 5×CE II Buffer 4μL, Exnase II 2μL, target fragment 200ng, vector fragment 200ng, ddH 2 O to 20μL. The ligated product was transformed into the Trans1T1 competent medium by heat shock, cultured overnight, and the transformants were picked for verification and sequencing to obtain the plasmid pG418 (cns1). The plasmid pG418 (cns1) was digested with restriction endonucleases SaC I and Sal I, reacted at 37℃ for 2h, and then run agarose gel electrophoresis. After gel cutting, the pG418 (cns1) linear vector was purified and recovered using a recovery kit, and the pG418 (cns1) linear vector was connected to the cns2 expression frame using a one-step cloning enzyme. The ligated product was transformed into the Trans1T1 competent medium by heat shock, cultured overnight, and the transformants were picked for verification and sequencing to obtain the plasmid pG418 (cns).

[0047] The nucleotide sequences of the promoter TPI1, terminator ADH1t, promoter TEF1 and terminator GAL2t are shown in SEQ ID No. 3 to 6 respectively.

[0048] The 1622b site and pCas9-Hyg-1622b plasmid in Example 1 were selected. Using plasmid pG418 (cns) as a template, primers 1622b-cns-F / 1622b-cns-R were used to amplify the cns expression cassette; using the genome of BY4742 strain as a template, primers 1622b-up-F / 1622b-up-cns-R were used to amplify the upper homology arm of the 1622b site; using the genome of BY4742 strain as a template, primers 1622b-down-cns-F / 1622b-down-R were used to amplify the lower homology arm of the 1622b site. After amplification, the corresponding gene fragment was obtained after purification using a DNA fragment recovery kit. Then, primers 1622b-up-F / 1622b-down-R were used to overlap the three fragments to obtain a cns expression cassette containing the homologous fragment of the 1622b site. The primer sequences are shown in Table 1. The corresponding gene fragments were obtained by PCR amplification and purification using a DNA fragment recovery kit.

[0049] The BY4742, BY4741, W303-1A and CEN.PK2-1 strains of Saccharomyces cerevisiae chassis were cultured in a 30°C incubator for 48 hours, and single colonies were picked to activate and prepare competent cells. The pCas9-Hyg-1622b plasmid and the cns expression frame containing the homologous fragment of the 1622b site were transformed by electroporation at a mass ratio of 300ng:1500ng. Transformants were screened using YPD solid medium containing 400mg / L hygromycin (HygR), and the transformants were verified by PCR. The verified strains were inoculated into the fermentation medium for fermentation. The cordycepin yield of the four chassis strains was as follows: Figure 3 As shown, the best chassis strain is BY4742, and the corresponding strain is named B1. The cordycepin yield is 0.25g / L. Subsequent experiments are all based on BY4742 strain as the chassis. The fermentation medium is: glucose 20-100g / L, yeast extract 10g / L, peptone 20g / L, adenine 0.5-5g / L. Preferably, glucose 50g / L, yeast extract 10g / L, peptone 20g / L, adenine 3g / L. Culture at 28-30°C, 200-220rpm for 144h, preferably, 30°C, 220rpm.

[0050] The production of cordycepin was detected by high performance liquid chromatography. The method for analyzing cordycepin was as follows: Agilent 1260 Infinity II high pressure liquid chromatography with ultraviolet detector (VWD) was used to separate and quantitatively determine the cordycepin in the fermentation broth supernatant. The chromatographic column was ZORBAX SB-Aq, the mobile phase was 2% acetonitrile, 98% 0.3‰ trifluoroacetic acid, the flow rate was 0.8mL / min, the column oven was set to 40°C, and the absorbance was 260nm. The sample was centrifuged at 13000rpm / min for 5min, and the supernatant was filtered through a 0.22μm membrane to remove impurities and used for analysis.

[0051] The chromatogram of the standard product of cordycepin is as follows: Figure 4 As shown, the chromatogram of the fermentation sample of the recombinant strain B1 is as follows Figure 5 LC-MS was also used for qualitative analysis. The mass spectra of the standard and the fermentation samples of the recombinant strain B1 are shown in Figure 6 and Figure 7 shown.

[0052] Example 3 Construction and fermentation of 2-5 copy strains

[0053] Based on the recombinant strain B1 in Example 2, the cns expression cassette was superimposed and integrated at the 416d, 911b, 208a and 308a sites in sequence to obtain the recombinant strains B2, B3, B4 and B5 in sequence, as follows:

[0054] Plasmid pG418 (cns) was used as a template, and primers 416d-cns-F / 416d-cns-R were used to amplify the cns expression cassette; the genome of BY4742 strain was used as a template, and primers 416d-up-F / 416d-up-cns-R were used to amplify the upper homology arm of the 416d site; the genome of BY4742 strain was used as a template, and primers 416d-down-cns-F / 416d-down-R were used to amplify the lower homology arm of the 416d site. After amplification, the corresponding gene fragment was purified using a DNA fragment recovery kit. Then, primers 416d-up-F / 416d-down-R were used to overlap the three fragments to obtain the cns expression cassette containing the homology fragment of the 416d site.

[0055] Plasmid pG418 (cns) was used as a template, and primers 911b-cns-F / 911b-cns-R were used to amplify the cns expression cassette; the genome of BY4742 strain was used as a template, and primers 911b-up-F / 911b-up-cns-R were used to amplify the upper homology arm of the 911b site; the genome of BY4742 strain was used as a template, and primers 911b-down-cns-F / 911b-down-R were used to amplify the lower homology arm of the 911b site. After amplification, the corresponding gene fragment was purified using a DNA fragment recovery kit. Then, primers 911b-up-F / 911b-down-R were used to overlap the three fragments to obtain the cns expression cassette including the homology fragment of the 911b site.

[0056] Plasmid pG418 (cns) was used as a template, and primers 208a-cns-F / 208a-cns-R were used to amplify the cns expression cassette; the genome of BY4742 strain was used as a template, and primers 208a-up-F / 208a-up-cns-R were used to amplify the upper homology arm of the 208a site; the genome of BY4742 strain was used as a template, and primers 208a-down-cns-F / 208a-down-R were used to amplify the lower homology arm of the 208a site. After amplification, the corresponding gene fragment was purified using a DNA fragment recovery kit. Then, primers 208a-up-F / 208a-down-R were used to overlap the three fragments to obtain the cns expression cassette including the homology fragment of the 208a site.

[0057] Plasmid pG418 (cns) was used as a template, and primers 308a-cns-F / 308a-cns-R were used to amplify the cns expression cassette; the genome of BY4742 strain was used as a template, and primers 308a-up-F / 308a-up-cns-R were used to amplify the upper homology arm of the 308a site; the genome of BY4742 strain was used as a template, and primers 308a-down-cns-F / 308a-down-R were used to amplify the lower homology arm of the 308a site. After amplification, the corresponding gene fragment was purified using a DNA fragment recovery kit. Then, primers 308a-up-F / 308a-down-R were used to overlap the three fragments to obtain the cns expression cassette including the homology fragment of the 308a site.

[0058] After 3-4 subcultures, the strain B1 in Example 2 was plated and spotted on both the YPD plate containing 400 mg / L hygromycin (HygR) and the YPD plate without antibiotics. The single colony that did not grow on the plate containing antibiotics but grew on the plate without antibiotics proved that the CRISPR / Cas9 tool plasmid had been lost. The corresponding single colony was activated and the cns expression cassette was integrated into the 416d site according to the method described in Example 2 to obtain the recombinant strain B2. Recombinant strains B3, B4 and B5 were then obtained in turn. The fermentation method and detection method were the same as those in Example 2. The cordycepin production of the recombinant strains B2, B3, B4 and B5 were 0.47 g / L, 0.68 g / L, 0.86 g / L and 0.93 g / L, respectively (the results are shown in Figure 8 shown).

[0059] Example 4 Effect of different integration sites on cordycepin yield

[0060] While carrying out Example 3, the effects of different integration sites on cordycepin were also verified. Five sites with high integration efficiency and expression efficiency were selected for verification, namely 1622b, 416d, 911b, 208a, 308a and 106a. Fig. 9 shown.

[0061] The single-copy strains were integrated at these six sites, and the results showed that the yield was best when integrated at the 1622b site. The single-copy strain was transformed multiple times at the 106a site, but no transformants grew out, probably because the 106a site was closest to the essential gene CDC19, and the length of the spacer region (806bp) was <1000bp.

[0062] The 2-copy strain was based on the 1622b site and integrated at the 416d, 911b, 208a, 308a and 106a sites respectively. The results showed that the yield was best at the 416d site.

[0063] The 3-copy strain was integrated at the 911b, 208a, 308a and 106a sites respectively based on the 1622b and 416d sites. The results showed that the yield was best at the 911b site. The 3-copy strain was also transformed multiple times at the 106a site, but no transformants grew.

[0064] The 4-copy strain was integrated at the 208a, 308a and 106a sites respectively based on the 1622b, 416d and 911b sites. The results showed that the yield was best at the 208a site. The 4-copy strain was also transformed multiple times at the 106a site, but no transformants grew.

[0065] The 5-copy strain was integrated at the 308a and 106a sites based on the 1622b, 416d, 911b and 208a sites, respectively. The results showed that the yield was best at 308a.

[0066] Example 5 One round of integration of multiple copies of 2'-carbonyl-3'-deoxyadenosine reductase and 3'-adenosine monophosphate phosphohydrolase

[0067] To facilitate the construction of multi-copy strains, a CRISPR / Cas9 plasmid with multiple N20 targets was used to integrate multiple copies in one round. As a preliminary verification, a 5-copy strain was constructed, that is, the CRISPR / Cas9 plasmid had 5 sites of N20 sequence, which were integrated into 1622b, 416d, 911b, 208a and 308a sites in one round. The N20 sequence was as described in Example 1. The multi-target CRISPR / Cas9 plasmid and 5 homologous fragments were simultaneously transferred into the competent state of Saccharomyces cerevisiae by electroporation. The conversion mass ratio of the plasmid to the 5 homologous fragments was 300ng: 1500ng: 1500ng: 1500ng: 1500ng. During the verification, a single colony was verified using primers of 5 sites respectively, and a total of 5 colony PCRs were performed. The strain that was verified correctly was subjected to the fermentation method and detection method in Example 2. The results showed that the cordycepin yield of the recombinant strain reached 0.95g / L.

[0068] Example 6 Construction and fermentation of 6-10 copy strain

[0069] Using the one-round integration method in Example 5, taking the 6-copy strain as an example, the schematic diagram of the B6 strain is as follows Fig.10As shown, the construction method is as follows: a CRISPR / Cas9 plasmid with N20 sequences of sites 1622b, 416d, 911b, 208a and 308a and homologous fragments corresponding to the five sites are simultaneously transferred into the competent state of Saccharomyces cerevisiae, wherein the 1622b site has two sets of cns expression cassettes, and the construction method is as follows: the upper and lower homologous arms of the 1622b site are obtained as described in Example 2, using plasmid pG418 (cns) as a template, using primers 1622b-cns-F / cns-1-R to amplify cns expression cassette 1, using plasmid pG418 (cns) as a template, using primers cns-2-F / 1622b-cns-R to amplify cns expression cassette 2, and then using primers 1622b-up-F / 1622b-down-R, the four fragments are overlapped as templates to obtain two sets of cns expression cassettes containing homologous fragments of the 1622b site. The homologous fragments of the other four sites with double expression frames are also as described above. The 7, 8, 9 and 10 copy strains use homologous fragments with two sets of cns expression frames at sites 416d, 911b, 208a and 308a, respectively. In the same fermentation method and detection method as in Example 2, the cordycepin production of the recombinant strains was 1.03 g / L, 1.12 g / L, 1.17 g / L, 1.26 g / L and 1.35 g / L, respectively (the results are shown in Figure 8 shown).

[0070] Example 7 Construction and fermentation of 11-15 copy strains

[0071] Using the one-round integration method in Example 5, taking the 11-copy strain as an example, the schematic diagram of the B11 strain is as follows Fig.11As shown, the construction method is as follows: the CRISPR / Cas9 plasmid with the N20 sequence of sites 1622b, 416d, 911b, 208a and 308a and the homologous fragments corresponding to the five sites are simultaneously transferred into the competent state of Saccharomyces cerevisiae, wherein the 1622b site has three sets of cns expression cassettes, and the remaining five sites have two sets of cns expression cassettes. The construction method of three groups of cns expression frames of the 1622b site is as follows: the upper and lower homologous arms of the 1622b site are obtained as described in Example 2, using plasmid pG418 (cns) as a template, using primers 1622b-cns-F / cns-1-R to amplify cns expression frame 1, using plasmid pG418 (cns) as a template, using primers cns-2-F / cns-1-R to amplify cns expression frame 2, using primers cns-2-F / 1622b-cns-R to amplify cns expression frame 3, and then using primers 1622b-up-F / 1622b-down-R, the five fragments are overlapped as templates to obtain three groups of cns expression frames containing homologous fragments of the 1622b site. The homologous fragments of the double expression frames of the other four sites are also as described above. The 12, 13, 14 and 15 copy strains used homologous fragments with three sets of cns expression frames at the 416d, 911b, 208a and 308a sites, respectively. The 11-15 copy strains B11, B12, B13, B14 and B15 were obtained. The fermentation method and detection method were the same as those in Example 2. The cordycepin production of the recombinant strains was 1.27 g / L, 1.38 g / L, 1.32 g / L, 1.43 g / L and 1.49 g / L, respectively (the results are shown in Figure 8 shown).

[0072] Example 8 Optimization of glucose concentration in fermentation medium

[0073] according to Figure 8 As shown in the figure, the integration of more than 5 copies of the gene for synthesizing cordycepin affects the growth of the strain, so the subsequent related experiments were carried out using the recombinant strain B5 in Example 3, and the glucose concentration of the fermentation medium described in Example 2 was optimized. The fermentation medium used 10g / L, 20g / L, 40g / L, 50g / L, 80g / L, and 100g / L of glucose, respectively. The results showed that the use of 50g / L of glucose had the best effect (the results are shown in Fig.12 shown).

[0074] Example 9 Optimization of adenine concentration in fermentation medium

[0075] The recombinant strain B5 in Example 3 was used to optimize the concentration of precursor adenine in the fermentation medium optimized in Example 8. The fermentation medium used 0.1 g / L, 0.5 g / L, 1 g / L, 1.5 g / L, 2 g / L, 3 g / L and 5 g / L of adenine, respectively. The results showed that the use of 3 g / L of adenine had the best effect (the results are shown in FIG. Fig.13 shown).

[0076] Example 10 Recombinant strain B5 complements the defective gene of the chassis strain

[0077] The recombinant strain B5 in Example 3 was integrated and expressed with any one or a combination of orotidine-5'-phosphate decarboxylase (URA3), imidazole glycerol phosphate dehydrogenase (HIS3), 3-isopropylmalate dehydrogenase (LEU2) and L-aminoadipic acid-semialdehyde dehydrogenase (LYS2). Ura3 was back-patch to the 1309a site, lys2 was back-patch to the XI-3 site, his3 and leu2 were back-patch to the XII-1 site, and the above four genes were amplified using the genome of the CEN.PK530-1C strain (kindly donated by Mr. Huang Mingtao of South China University of Technology) as a template.

[0078] Primers 1309a-URA3-F / 1309a-URA3-R were used to amplify the ura3 expression cassette, primers 1309a-up-F / 1309a-up-R were used to amplify the upper homology arm at the 1309a site, primers 1309a-down-F / 1309a-down-R were used to amplify the lower homology arm at the 1309a site, and then primers 1309a-up-F / 1309a-down-R were used for overlap to obtain the ura3 expression cassette including the homologous fragment of the 1309a site.

[0079] The lys2 expression cassette was amplified using primers XI-3-LYS2-F / XI-3-LYS2-R, the upper homology arm at the XI-3 site was amplified using primers XI-3-up-F / XI-3-up-R, the lower homology arm at the XI-3 site was amplified using primers XI-3-down-F / XI-3-down-R, and then overlap was performed using primers XI-3-up-F / XI-3-down-R to obtain the lys2 expression cassette including the homologous fragment of the XI-3 site.

[0080] The his3 expression cassette was amplified using primers HIS3-F / HIS3-R, the leu2 expression cassette was amplified using primers LEU2-F / LEU2-R, the upper homology arm at the XII-1 site was amplified using primers XII-1-up-F / XII-1-up-R, the lower homology arm at the XII-1 site was amplified using primers XII-1-down-F / XII-1-down-R, and then the primers XII-1-up-F / XII-1-down-R were used to overlap to obtain the his3 and leu2 expression cassettes including the homologous fragment of the XII-1 site.

[0081] Then, the plasmid in Example 1 and the method in Example 2 were used to obtain recombinant strains B5U (repairing ura3 to 1309a site), B5U1 (repairing ura3 to 1309a site, lys2 repairing to XI-3 site), B5U2 (repairing ura3 to 1309a site, lys2 repairing to XI-3 site, his3 repairing to XII-1 site) and B5U3 (repairing ura3 to 1309a site, lys2 repairing to XI-3 site, his3 and leu2 repairing to XII-1 site), respectively. The fermentation method and detection method were the same as those in Example 3. The cordycepin yields of the recombinant strains B5U, B5U1, B5U2 and B5U3 were 2.61, 2.72, 2.79 and 2.92 g / L, respectively (the results are shown in Table 2). Fig.14 shown).

[0082] Table 1 Primer sequences

[0083]

[0084]

[0085]

[0086] Example 11 Stability verification of strain B5U3

[0087] The present invention uses multi-copy integration of cordycepin synthesis-related enzyme genes including 2'-carbonyl-3'-deoxyadenosine reductase gene and 3'-adenosine monophosphate phosphohydrolase gene. To increase the stability of the strain, the multi-copy integration method is that the integration site is the spacer length of the nearest essential gene ≥1kb. Therefore, in order to verify the stability of the recombinant strain B5U3, to simulate the environment of the fermentation tank, one generation is propagated every 24h, and the strain is fermented after 10 generations. The yield is slightly reduced, and the yield is 2.68g / L, which proves that this integration strategy can increase the effectiveness of strain stability.

[0088] Example 12 Production of cordycepin by fermentation in a 5L fermentation tank using engineered yeast Saccharomyces cerevisiae

[0089] The recombinant strain B5U3 was used for 5L fermentation tank fermentation. A single colony was picked in 5mL YPD liquid medium and placed in a 30℃ shaker at 220rpm for 18h. According to the inoculation ratio of 5% v / v, it was transferred to 200mL YPD liquid medium, placed in a 30℃ shaker at 220rpm for 16h, and then transferred to 2L fermentation medium. The formula of the fermentation medium was: 50g / L glucose, 10g / L yeast extract, 20g / L peptone, and 3g / L adenine. The parameters of the fermentation tank were controlled as follows: temperature was 28-30℃, stirring speed was 400-600rpm, ventilation was 6, liquid volume was 2L, pH was 5.5±0.1, and dissolved oxygen was maintained at about 30%. After 13h of fermentation, feeding was carried out, during which the glucose concentration in the fermentation tank was controlled below 1.0g / L, and fermentation was 144h. The feed medium was 400g / L glucose. The results showed that the cordycepin production of the engineered strain in a 5L fermentation tank was 7.5 g / L (results as shown in Fig.15 shown).

[0090] The present invention provides an engineering strain of Saccharomyces cerevisiae with high cordycepin production, a construction method, and an idea and method for its application. There are many methods and approaches to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be considered as the scope of protection of the present invention. All components not specified in this embodiment can be implemented using existing technologies.

Claims

1. A Saccharomyces cerevisiae strain for efficiently synthesizing cordycepin, characterized in that: The genome of the yeast strain contains multiple copies of a gene for an enzyme related to cordycepin synthesis integrated and expressed; Wherein, the cordycepin synthesis-related enzyme genes include 2'-carbonyl-3'-deoxyadenosine reductase gene and 3'-adenosine monophosphate phosphohydrolase gene; For the multi-copy integration, the integration site is an interval region with the nearest essential gene with a length of ≥1 kb.

2. The Saccharomyces cerevisiae strain according to claim 1, characterized in that The integration sites include any one or more combinations of 1622b, 416d, 911b, 208a, 308a, 1309a, YPRCδ15c, 1021b, 1014a, HIS3b, YOLCd1b, SAP155b, CAN1y, SAP155c, 1114a, 720a, 1414a, 511b, X-2, X-3, XI-2, XI-3, XII-1 and XII-5 of the Saccharomyces cerevisiae genome.

3. The saccharomyces cerevisiae strain according to claim 1, characterized in that The multiple copies are 2-30 copies.

4. The Saccharomyces cerevisiae strain according to claim 1, characterized in that 2'-carbonyl-3'-deoxyadenosine reductase and 3'-adenosine monophosphate phosphohydrolase are both derived from any one of Aspergillus hiratsukae, Penicillium fimorum, Aspergillus terricola var. indicus, Aspergillus similis, Aspergillus varians, Aspergillus nidulans, Aspergillus tetrazonus, Aspergillus nidulansvar. acristatus, Emericellopsis atlantica or Cordyceps militaris; Preferably, 2'-carbonyl-3'-deoxyadenosine reductase and 3'-adenosine monophosphate phosphohydrolase are both derived from Cordyceps militaris, and their NCBI accession numbers are XP_006669647 and XP_006669648, respectively.

5. The saccharomyces cerevisiae strain according to claim 1, characterized in that The 2'-carbonyl-3'-deoxyadenosine reductase gene and the 3'-adenosine monophosphate phosphohydrolase gene are both driven to express by any one of the promoters PGK1, TEF1, GPD, TPI1, ADH1, TDH3, CYC1, HXT1, GAL1, GAL7, GAL10, CUP1 or MET25.

6. The Saccharomyces cerevisiae strain according to claim 1, characterized in that The starting bacteria is any one of Saccharomyces cerevisiae BY4742, BY4741, W303-1A or CEN.PK2-1C.

7. The Saccharomyces cerevisiae strain according to claim 1, characterized in that The auxotrophic gene is integrated and expressed in the genome of the cerevisiae strain; the auxotrophic gene comprises any one or a combination of the genes of orotidine-5'-phosphate decarboxylase, imidazole glycerol phosphate dehydrogenase, 3-isopropylmalate dehydrogenase and L-aminoadipic acid-semialdehyde dehydrogenase; Among them, the NCBI accession numbers of orotidine-5'-phosphate decarboxylase, imidazole glycerol phosphate dehydrogenase, 3-isopropylmalate dehydrogenase and L-aminoadipate-semialdehyde dehydrogenase are NP_010893.3, NP_014845.1, NP_009911.2 and NP_009673.1, respectively.

8. A method for constructing a Saccharomyces cerevisiae strain capable of efficiently synthesizing cordycepin according to any one of claims 1 to 7, characterized in that: The steps include: (1) amplifying a gene expression cassette for a cordycepin synthesis-related enzyme, wherein the gene expression cassette for a cordycepin synthesis-related enzyme comprises a 2'-carbonyl-3'-deoxyadenosine reductase gene expression cassette and a 3'-adenosine monophosphate phosphohydrolase gene expression cassette; (2) Using Crispr / Cas9 technology, the gene expression frame of the cordycepin synthesis-related enzyme described in step (1) is integrated into one or more integration sites of the starting yeast genome of Saccharomyces cerevisiae for multi-copy expression.

9. The construction method according to claim 8, characterized in that: The construction method comprises step (3), wherein step (3) is to amplify an auxotrophic gene expression cassette and integrate it into the genome of the brewer's yeast obtained in step (2) by using Crispr / Cas9 technology; the auxotrophic gene expression cassette comprises any one or a combination of several of an orotidine-5'-phosphate decarboxylase gene expression cassette, an imidazole glycerol phosphate dehydrogenase gene expression cassette, a 3-isopropylmalate dehydrogenase gene expression cassette and an L-aminoadipic acid-semialdehyde dehydrogenase gene expression cassette.

10. Use of any one of the Saccharomyces cerevisiae strains capable of efficiently synthesizing cordycepin according to claims 1 to 7 in the production of cordycepin.

11. The use according to claim 10, characterized in that: Inoculating the Saccharomyces cerevisiae strain capable of efficiently synthesizing cordycepin into a fermentation medium and fermenting and culturing at 20 to 40° C. for 96 to 144 hours; The fermentation medium comprises 10-100 g / L of carbon source, 10-50 g / L of nitrogen source and 0.1-15 g / L of adenine.

Citation Information

Patent Citations

  • Recombinant yeast for increasing yield of L-menthol

    CN112175849A

  • Method for producing heterocannabinoid phenol by using saccharomyces cerevisiae

    CN112795495A

  • Engineered yeast for producing cordycepin and application

    CN115975828A

  • Recombinant yeast for producing cordycepin as well as construction method and application of recombinant yeast

    CN115976065A

  • Yeast engineering bacteria for high-yield cordycepin as well as construction method and application thereof

    CN118291291A

Cited By

  • The invention discloses a high-yield 3apos; genetic engineering strain of-deoxyadenosine and application thereof

    CN120173770A

  • The invention relates to a method for producing 2apos; engineering strain of-deoxyadenosine as well as preparation method and application of engineering strain

    CN120249164A

  • Method for improving cordycepin synthesized by bacterial strain through lipid droplet engineering modification and application

    CN120519534A

  • Method for improving synthesis of cordycepin by lipid droplet engineering of a strain and application thereof

    CN120519534B

  • The invention discloses a high-yield 3apos; genetic engineering strain of-deoxyadenosine and application thereof

    CN120944725A