Tree frog antibacterial peptide as well as gene and application thereof

Abstract

The invention discloses a tree frog antibacterial peptide as well as a gene and application thereof. The tree frog antibacterial peptide provided by the invention is a cyclic peptide consisting of 29 amino acids, the amino acid sequence of the tree frog antibacterial peptide is shown as SEQ ID NO.1, and the third cysteine and the seventh cysteine form an intramolecular disulfide bond. The invention also provides a nucleotide sequence for coding the tree frog antibacterial peptide, wherein the nucleotide sequence is shown as SEQ ID NO.2 or SEQ ID NO.9. The invention also provides a nucleotide sequence for coding the tree frog antibacterial peptide. The tree frog antibacterial peptide disclosed by the invention has very strong treatment functions of antibiosis, anti-inflammation, antioxidation and immunoregulation, has the characteristics of simple structure and convenience in artificial synthesis, and can be used for preparing medicines for treating pathogenic microorganism infection, autoimmune diseases and even sepsis.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to a brown-spotted tree frog antimicrobial peptide, its gene and applications. Background Art

[0002] Inflammation is the body's defense response to injury factors (such as bacteria, viruses, exogenous chemicals, and tissue damage, etc.). The inflammatory response is a complex regulatory process of tissue damage caused by inflammatory factors in the body. The typical local manifestations of the inflammatory response are redness, swelling, heat, pain, and dysfunction. The systemic responses are manifested as fever, increase or decrease in white blood cells, and parenchymal organ lesions, etc. Immune cells (such as lymphocytes, dendritic cells, and macrophages, etc.) participate in the immune response and immune response. Although macrophages can clear damaged tissues in the body and phagocytose pathogens during the inflammatory response, macrophages will also be stimulated to secrete a large number of inflammatory factors and pro-inflammatory mediators, including prostaglandin E2 (PGE2), tumor necrosis factor-α (TNF-α), nitric oxide (NO), interleukin 6 (IL-6), chemokine (MCP-1), interleukin-1β (IL-1β), and reactive oxygen species (ROS).

[0003] Lipopolysaccharide (LPS), also known as endotoxin, is the main component of the cell wall of Gram-negative bacteria. When the body is invaded by bacteria, the bacteria will continuously release endotoxin into the surrounding environment. In addition, when the bacteria are killed and disintegrated by antibiotics, a large amount of endotoxin is released, which activates immune cells (such as macrophages) to secrete a large number of inflammatory factors, further aggravating the inflammatory response and causing tissue damage.

[0004] Sepsis is a life-threatening systemic inflammatory response and organ dysfunction caused by immune dysregulation due to infection. More than 19 million people suffer from sepsis every year, and about 14 million people survive to discharge. However, among the discharged patients, half of the patients recover, one-third die in the following year, and one-sixth have severe persistent injuries. The course of sepsis progresses rapidly, with a high mortality rate and poor treatment effects. Therefore, timely use of broad-spectrum antibiotics and anti-inflammatory drugs has become the main means to improve the survival rate of patients. The use of broad-spectrum antibiotics, on the one hand, the killing of bacteria by antibiotics will release a large amount of endotoxin, leading to cytokine storm, further aggravating inflammation and reducing the survival rate of patients, and also seriously affecting the prognosis of the surviving patients. On the other hand, it accelerates the emergence of drug-resistant bacteria and speeds up the entry of humans into the "post-antibiotic era".

[0005] Therefore, for the above reasons, accelerating the development of new drugs is the ultimate choice to reduce the mortality rate of patients with infection-induced inflammatory diseases, improve the prognosis of patients, and avoid the emergence of bacterial drug resistance. Among the studies of many new antibiotic drugs, peptide drugs are considered to be the best choice to replace traditional antibiotics. Compared with traditional antibiotics, peptide drugs have the following advantages: (1) They are not easily resistant. Peptide drugs are not easily resistant due to their unique mechanism of action. For example, amphiphilic cationic peptides mostly bind to negatively charged LPS in the bacterial cell wall through electrostatic interaction, and then destroy the bacterial structure to kill bacteria; (2) Low toxicity. Because the bacterial membrane is different from the normal cell membrane components of mammals, peptide drugs have a certain targeting to the bacterial cell membrane and almost no toxicity to the normal cell membrane of mammals; (3) High activity. They can exert significant biological activity at low doses or low concentrations; (4) Small molecular weight, easy to synthesize and the structure is easy to modify.

[0006] Antimicrobial peptides (AMPs) are defensive peptides produced by the immune defense system and are the first line of defense to protect the host from the invasion of foreign pathogens. Amphibians are a rich source of antimicrobial peptides. The dark and humid habitats of amphibians are conducive to the growth of microorganisms. The bare skin of amphibians is directly in contact with various microorganisms. To protect the body from harm, the skin of amphibians is scattered with a large number of glands that secrete bioactive substances with different functions to cope with various harms, including polypeptide components with various functions, such as antimicrobial peptides, antioxidant peptides, and wound healing-promoting peptides, etc. Since bombinins it was discovered from Bombina varieqata, a large number of antimicrobial peptides have been identified from amphibians. Among them, Cathelicidin antimicrobial peptides belong to a family of amphiphilic cationic peptides and have a variety of biological activities such as antiviral, promoting wound healing, antioxidant, and anti-inflammatory. Currently, the discovered Cathelicidin antimicrobial peptides mainly come from mammals, and there are still insufficient reports on the study of Cathelicidin antimicrobial peptides from amphibians on sepsis or endotoxin shock. Sepsis is a systemic acute inflammatory disease that affects multiple organs. Amphibians are the richest source of antimicrobial peptides. Therefore, studying the therapeutic effect of antimicrobial peptides from amphibians on sepsis is of great significance and is conducive to enriching the treatment methods for sepsis. Summary of the Invention

[0007] To solve the deficiencies in the prior art, the present invention aims to provide a brown-spotted tree frog antimicrobial peptide, its gene, and its applications. The present invention uses genomic methods and pharmacological studies to obtain the gene encoding the brown-spotted tree frog antimicrobial peptide. Searching and comparing the gene encoding the brown-spotted tree frog antimicrobial peptide of the present invention in the gene database, no identical gene is found. The inventor searches and compares the full sequence structure of the brown-spotted tree frog antimicrobial peptide of the present invention in the protein database and finds no identical polypeptide. The novel brown-spotted tree frog antimicrobial peptide provided by the present invention has antimicrobial (including Gram-negative, Gram-positive bacteria, and fungi), anti-inflammatory, immunomodulatory, and sepsis treatment activities, and can be used to prepare therapeutic drugs for anti-infective and immune diseases.

[0008] To solve the above technical problems, the technical solution adopted by the present invention is:

[0009] The present invention provides a brown-spotted tree frog antimicrobial peptide, which is a cyclic polypeptide composed of 29 amino acids, and its amino acid sequence is: GKCNFMCKVKQKLRAIGSKTVIGTVVHKI (as shown in SEQ ID NO.1), and the third cysteine and the seventh cysteine form an intramolecular disulfide bond. The molecular weight of this brown-spotted tree frog antimicrobial peptide is 3186.89 Daltons, and the isoelectric point is 10.32.

[0010] The present invention also provides a nucleotide encoding the above brown-spotted tree frog antimicrobial peptide.

[0011] The gene encoding the amino acid sequence of the brown-spotted tree frog antimicrobial peptide is composed of 459 nucleotides, and its sequence from the 5' end to the 3' end is (SEQ ID NO.2):

[0012] atgaggacgtggcagtgcgtgttcttgctctctgtgctcacattgcacctggcacattgcacccgtcagtcaggacggatcaaagaggcgctggatgcctacaaccagagggaggatggagagttctactttaagctcatgtcgaatgtcccgggattgggattctttgtgcaggagaaggaaaactcctccagagtcatcttcttaatcaaggagacggagtgccgcaagactgaagacgttgacttggagcgatgcgactataggaaggatggggaggtgaggatgtgcgctctgtaccggaagggagagaaggtggaatgcatcagtctgaacaagaattctcgcaccaagcgagccagtaagaaaggaaagtgcaacttcatgtgcaaagtgaagcagaagctgcgagctatcggctccaaaaccgttatcgggaccgttgtccataaaatatagcgaatattatctataatttgctttgtcttcaatgcaatttcatccgaaccttcctctatctctgatctaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

[0013] The nucleotides at positions 370 - 455 in the gene sequence encoding the amino acid sequence of the antimicrobial peptide of the barking treefrog encode the functional mature antimicrobial peptide of the barking treefrog.

[0014] Furthermore, the nucleotide sequence encoding the antimicrobial peptide of the barking treefrog is as shown in SEQ ID NO.2 or SEQ ID NO.9.

[0015] The antimicrobial peptide of the barking treefrog of the present invention can be prepared by methods known to those skilled in the art (such as solid-phase synthesis methods), and can be isolated and purified by separation and purification methods known in the art (such as high-performance liquid chromatography).

[0016] The present invention also provides the application of the antimicrobial peptide of the barking treefrog or the nucleotide encoding the antimicrobial peptide of the barking treefrog in the preparation of the drugs described in any one of the following 1) - 5):

[0017] 1) Drugs for anti-bacterial or anti-fungal infections;

[0018] 2) Drugs for treating diseases or indications caused by bacterial or fungal infections;

[0019] 3) Anti-inflammatory drugs;

[0020] 4) Immunomodulatory drugs;

[0021] 5) Drugs for treating autoimmune diseases.

[0022] Furthermore, the inflammation to which the anti-inflammatory drug is applicable is inflammation caused by bacterial or fungal infection.

[0023] Furthermore, the bacterium is a Gram-positive bacterium or a Gram-negative bacterium;

[0024] Preferably, the Gram-positive bacterium includes Staphylococcus aureus and Bacillus subtilis;

[0025] Preferably, the Gram-negative bacterium includes Escherichia coli and Pseudomonas aeruginosa;

[0026] Preferably, the fungus includes Candida albicans.

[0027] The present invention also provides the application of the antibacterial peptide of the spotted tree frog or the nucleotide encoding the antibacterial peptide of the spotted tree frog in the preparation of drugs for preventing and / or treating sepsis.

[0028] The present invention also provides the application of the antibacterial peptide of the spotted tree frog or the nucleotide encoding the antibacterial peptide of the spotted tree frog in the preparation of drugs for preventing and / or treating psoriasis.

[0029] The present invention also provides the application of the antibacterial peptide of the spotted tree frog or the nucleotide encoding the antibacterial peptide of the spotted tree frog in the preparation of drugs for neutralizing lipopolysaccharide.

[0030] The present invention also provides a pharmaceutical composition, which includes the antibacterial peptide of the spotted tree frog or the nucleotide encoding the antibacterial peptide of the spotted tree frog.

[0031] Furthermore, the pharmaceutical composition further includes a pharmaceutically acceptable carrier.

[0032] The administration methods of the pharmaceutical composition of the present invention include: administration by injection, including intravenous injection, subcutaneous injection, intracavitary injection, etc.; mucosal administration, such as nasal administration; canal administration, such as rectal administration, with local onset or systemic effect after absorption. The preferred administration route among the above is intravenous administration.

[0033] The beneficial effects of the present invention are:

[0034] The antimicrobial peptide of the brown-spotted tree frog described in the present invention is a synthetic antimicrobial peptide derived from the skin of the brown-spotted tree frog, which can inhibit the growth of pathogenic microorganisms (such as bacteria and fungi), has a better inhibitory effect on infectious inflammation. Compared with traditional antibiotics, it is easily degradable and will not accumulate in the environment, thus causing pollution and harm to the environment. It also overcomes the medical problems caused by the abuse of traditional antibiotics. The antimicrobial peptide of the brown-spotted tree frog in this application can be produced by chemical synthesis technology, solving the source problem that cannot be obtained by extraction, and the produced polypeptide can maintain stable activity. In particular, the research results of the present invention show that the antimicrobial peptide of the brown-spotted tree frog shows good effects in the treatment of sepsis mice in the cecal ligation and puncture model (CLP) and has good stability. Specifically, the antimicrobial peptide of the brown-spotted tree frog in the present invention has the following functions:

[0035] 1. Inhibit the growth of pathogenic microorganisms.

[0036] By inhibiting bacteria, fungi, and viruses, etc., it reduces their infection of the body and enhances the body's resistance.

[0037] 2. Inhibit inflammation by regulating the expression of inflammatory cytokines.

[0038] When immune cells are stimulated, the antimicrobial peptide of the brown-spotted tree frog in the present invention controls the inflammatory response and plays an anti-inflammatory role by regulating the expression and secretion of nitric oxide and inflammatory cytokines such as TNF-α, IL-1β, and IL-6.

[0039] 3. Immunomodulatory activity.

[0040] Inflammatory cell infiltration is an important manifestation of the inflammatory response and is also the main link in the body's inflammatory defense response against exogenous stimulators. The antimicrobial peptide of the brown-spotted tree frog in the present invention can regulate inflammatory cells, prompting inflammatory cells to play an important defensive role in the regulation of local inflammatory responses through functions such as emigration, chemotaxis, and phagocytosis.

[0041] 4. Inhibit inflammation by neutralizing LPS.

[0042] LPS is the main component in the cell wall of Gram-negative bacteria. When bacteria die and dissolve, the released LPS can activate the immune system and cause an inflammatory response. The antimicrobial peptide of the brown-spotted tree frog prepared in the present invention can bind to LPS, inhibit the occurrence of inflammation, and regulate the immune level.

[0043] 5. Improve the survival rate of sepsis mice.

[0044] Sepsis is a severe clinical syndrome associated with the host's response to infection. Stimulated macrophages release various cytokines and pro-inflammatory mediators, which can cause fever, endotoxin shock, etc. LPS is an important initiator of the inflammatory cascade during the occurrence and development of sepsis and is the main cause of endotoxin shock. The antimicrobial peptide of the brown-spotted tree frog in the present invention can neutralize LPS and inhibit the excessive inflammatory response induced by pro-inflammatory factors in the early stage of sepsis, thereby improving the survival rate of model mice.

[0045] 6. High stability and low toxicity.

[0046] The instability of protein drugs is one of the main reasons affecting their direct application. The antimicrobial peptide of the brown-spotted tree frog has good tolerance to both high-salt and high-temperature environments. In addition, due to the difference in cell membrane components, bacteria have more negatively charged surfaces, while normal membranes are electrically neutral. The antimicrobial peptide of the brown-spotted tree frog in the present invention has electrostatic interaction with the negatively charged lipopolysaccharide on the bacterial surface. At the same time, the α-helical structure formed by the polypeptide is beneficial to stabilizing its own structure and also to inserting into the bacterial membrane structure, thereby destroying the bacterial cell membrane, while having relatively little impact on normal cells. The antimicrobial peptide of the brown-spotted tree frog has no significant cytotoxicity to a variety of normal cell lines and primary mouse spleen cells and no hemolytic toxicity to mouse red blood cells. Brief Description of the Drawings

[0047] Figure 1 It is the HPLC purification and identification result of the antimicrobial peptide of the brown-spotted tree frog in the present invention;

[0048] Figure 2 It is the mass spectrometry identification result of the antimicrobial peptide of the brown-spotted tree frog in the present invention;

[0049] Figure 3 It is the sterilization effect of the antimicrobial peptide of the brown-spotted tree frog in the present invention on Escherichia coli and Staphylococcus aureus;

[0050] Figure 4 It is the inhibitory effect of the antimicrobial peptide of the brown-spotted tree frog in the present invention on the proliferation activity of spleen cells induced by lipopolysaccharide (LPS);

[0051] Figure 5 It is the binding effect of the antimicrobial peptide of the brown-spotted tree frog in the present invention with chymotrypsin and thrombin;

[0052] Figure 6 It is the comparison chart of the polypeptide stability of the antimicrobial peptide of the brown-spotted tree frog in the present invention at high temperature and high salt concentration;

[0053] Figure 7 It is the survival curve of the antimicrobial peptide of the brown-spotted tree frog in the present invention for sepsis mice modeled by cecal ligation and puncture (CLP) surgery;

[0054] Figure 8Therapeutic effect of the antimicrobial peptide of the brown-spotted tree frog of the present invention on psoriasis model mice. Detailed implementation manners

[0055] The present invention will be further described below in conjunction with the detailed implementation manners, which is not a limitation of the present invention. According to the well-known prior art in the art, the implementation manners of the present invention are not limited thereto. Therefore, all equivalent substitutions in the art made in accordance with the disclosed content of the present invention fall within the protection scope of the present invention.

[0056] The present invention will be further described in detail below in conjunction with the accompanying drawings and the detailed implementation manners:

[0057] The antimicrobial peptide of the brown-spotted tree frog of the present invention is a cyclic polypeptide composed of 29 amino acids, with a molecular weight of 3186.89 Daltons and an isoelectric point of 10.32. The amino acid sequence is: GlyLysCysAsnPheMetCysLysValLysGlnLysLeuArgAlaIleGlySerLysThrValIleGlyThrValValHisLysIle (GKCNFMCKVKQKLRAIGSKTVIGTVVHKI) (as shown in SEQ ID NO.1), and the third cysteine and the seventh cysteine form an intramolecular disulfide bond. The gene sequence encoding the antimicrobial peptide of the brown-spotted tree frog is the nucleotide positions 370-455 of SEQ ID NO.2.

[0058] The preparation process and application of the antimicrobial peptide of the brown-spotted tree frog of the present invention and its gene include the following aspects:

[0059] Example 1: Cloning of the antimicrobial peptide gene of the brown-spotted tree frog

[0060] 1. Extraction of total RNA from the skin of the brown-spotted tree frog: The live brown-spotted tree frog was washed clean with water, quickly frozen in liquid nitrogen for 4 h, about 200 mg of skin tissue was taken, 10 mL of total RNA extraction buffer (Trizol solution, product of GIBCO BRL, USA) was added, and homogenized in a 20 mL glass homogenizer for 30 min. An equal volume of phenol / chloroform solution was added, mixed vigorously, left at room temperature for 10 min, centrifuged at 4°C and 12,000 rpm for 10 min, and the precipitate was discarded. An equal volume of isopropanol was added to the supernatant, left at room temperature for 10 min, centrifuged at 4°C and 12,000 rpm for 10 min, the precipitate was washed once with 75% ethanol, dried, and the precipitate at the bottom of the tube was the total RNA of the skin.

[0061] 2. Purification of the skin mRNA of the brown-spotted tree frog: The mRNA Isolation Systems kit from PROMEGA Corporation, USA was used for the isolation and purification of skin mRNA. The specific steps are as follows: Dissolve 500 μg of the total RNA of the brown-spotted tree frog skin in 500 μL of DEPC water, place it in a water bath at 65 °C for 10 min, add 3 μL of Oligo(dT) probe and 13 μL of 20×SSC solution, mix well, and let it cool to room temperature. This is called solution A. Gently flick the magnetic beads to mix well, place them on the magnetic stand for adsorption for 30 s, discard the supernatant, add 0.3 mL of 0.5×SSC, place it on the magnetic stand for adsorption for 30 s, and finally suspend it with 0.1 mL of 0.5×SSC. This is called solution B. Add solution A to solution B, let it stand at room temperature for 10 minutes, place it on the magnetic stand for adsorption for 30 sec, discard the supernatant, wash it 4 times with 0.1×SSC, finally discard the supernatant, suspend it with 0.15 mL of DEPC water, place it on the magnetic stand for adsorption for 30 sec, transfer the supernatant to a new test tube, add another 0.15 mL of DEPC water to resuspend it, place it on the magnetic stand for adsorption for 30 s, and transfer the supernatant to the above test tube. Then the supernatant contains the purified skin mRNA of the brown-spotted tree frog. Add 1 / 10 volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropanol, place it at -70 °C for 30 minutes, centrifuge at 4 °C and 12000 rpm for 10 min, discard the supernatant, and dissolve the precipitate in 10 μL of DEPC water to obtain the skin mRNA of the brown-spotted tree frog.

[0062] 3. Construction of the cDNA library of the brown-spotted tree frog skin: The CreatorTM SMARTTM cDNA Library Construction Kit plasmid cDNA library construction kit from CLONTECH Company was used.

[0063] A) Synthesis of the first strand of cDNA (mRNA reverse transcription): Add 1 μL of the skin mRNA of the brown-spotted tree frog, 1 μL of SMART IV oligonucleotide, and 1 μL of CDS III / 3’ PCR primer to a 0.5 mL sterile centrifuge tube, and add 2 μL of deionized water to make the total volume reach 5 μL. Mix the reagents in the centrifuge tube and centrifuge at 12000 rpm for 15 sec, and incubate at 72 °C for 2 min. Incubate the centrifuge tube on ice for 2 min. Add the following reagents to the centrifuge tube: 2.0 μL of 5× first strand buffer, 1.0 μL of 20 mM dithiothreitol, 1.0 μL of 10 mM dNTP mixture, and 1.0 μL of PowerScript reverse transcriptase. Mix the reagents in the centrifuge tube and centrifuge at 12000 rpm for 15 sec, and incubate at 42 °C for 1 h. Place the centrifuge tube on ice to terminate the synthesis of the first strand. Take 2 μL of the synthesized first strand of cDNA from the centrifuge tube for standby.

[0064] B) Amplify the second strand using the long terminal polymerase chain reaction (LD-PCR) method: Preheat the PCR instrument at 95°C. React the following in a centrifuge tube: 2 μL of the first strand of cDNA (mRNA reverse transcription), 80 μL of deionized water, 10 μL of 10× Advantage 2 PCR buffer, 2 μL of 50× dNTP mixture, 2 μL of 5’ PCR primer, 2 μL of CDS III / 3’ PCR primer, and 2 μL of E. coli polymerase. Amplify in the PCR instrument according to the following program: 95°C for 20 sec, 95°C for 5 sec, 68°C for 6 min, for 22 cycles. After the cycles end, extract the double-stranded cDNA synthesized in the centrifuge tube.

[0065] C) Extract and recover the PCR products using the SV Gel and PCR Clean-Up System kit from PROMEGA as follows: Add an equal volume of membrane-binding buffer to the double-stranded cDNA obtained by PCR, invert and mix well, then transfer the mixture into a centrifugal purification column, and let it stand at room temperature for 5 minutes to allow the DNA to fully bind to the silica gel membrane. Centrifuge at 12,000 rpm for 30 sec, and pour out the waste liquid in the collection tube. Add 700 μL of elution buffer (containing ethanol) to the centrifugal purification column, centrifuge at 12,000 rpm for 30 sec, and pour out the waste liquid in the collection tube. Repeat the above steps. Centrifuge at 12,000 rpm for 5 min. Place the centrifugal purification column in a new centrifuge tube. Add 30 μL of ultrapure water, let it stand at room temperature for 5 min. Centrifuge at 12,000 rpm for 30 sec, and the solution at the bottom of the tube is the purified double-stranded cDNA.

[0066] D) Digestion, ligation, and transformation of the ligation products: Add 1 μL of Takara pMD18-T vector and 4 μL of the double-stranded cDNA solution of the barking tree frog in a microcentrifuge tube, with a total volume of 5 μL. Add 5 μL of ligation enzyme buffer mixture. React at 16°C for 2 h. Add the total volume (10 μL) to 100 μL of DH5α competent cells, and place on ice for 30 min. Heat at 42°C for 90 Sec, then place on ice for 1 minute. Add 890 μL of LB medium incubated at 37°C, and culture slowly with shaking at 37°C for 60 min. Take 200 μL and spread it on LB medium containing XGal, IPTG, and Amp, and culture at 37°C for 16 h to form single colonies. Wash the colonies on each LB petri dish with 5 mL of LB liquid medium, and store them frozen with 30% glycerol. The constructed cDNA contains approximately 1×10 6 individual clones.

[0067] 4. Screening for the cloned barking tree frog antimicrobial peptide gene: The primer for the general nucleotide sequence encoding the cathelin domain (5'-WSCRCAGRYCTTCACCTCC-3') (SEQ ID NO.3), making it compatible with SMARTTM The 5' PCR primer (5'-AAGCAGTGGTATCAACGCAGAGT-3') (SEQ ID NO.4) in the cDNA library construction kit pairs and synthesizes the 5'-end nucleotide sequence of the brown-spotted tree frog antimicrobial peptide gene. The PCR procedure is as follows: treat at 95°C for 4 minutes; run 29 cycles: denature at 95°C for 30 s, anneal at 56°C for 30 s, and extend at 72°C for 1 minute. The final extension is carried out at 72°C for 10 minutes. The PCR product (~300 bp) is purified by gel electrophoresis and cloned into the pMD18-T vector (Takara Biotechnology, Dalian, China) for sequencing.

[0068] After obtaining the 5' sequence of the brown-spotted tree frog antimicrobial peptide, the primer sequence 5'TTATGAAGGTCTGGCAGTGCGCGCT-3' (SEQ ID NO.5) is synthesized and coupled with the 3' PCR primer CDSIII (5'-ATTCTAGAGGCCGAGGCGGCCGACATG-3') (SEQ ID NO.6). The complete gene of the brown-spotted tree frog antimicrobial peptide is obtained by transcribing the total cDNA diluted 100-fold. The PCR program is similar to the amplification of the 5' fragment, except that the annealing temperature in the cycling program is 52°C and the extension time is 45 s. After the final extension and purification, the PCR product is finally sequenced.

[0069] 5. Determination of the gene sequence of the brown-spotted tree frog antimicrobial peptide and results: The plasmid DNA is extracted and the nucleotide sequence is determined by the dideoxy method. The instrument used is the Applied Biosystems 373A automatic nucleotide sequencer from the United States. The sequencing primers are BcaBESTTM Sequencing Primer RV-M and BcaBESTTM Sequencing Primer M13-47. The sequence of BcaBESTTM Sequencing Primer RV-M: 5’GAGCGGATAACAATTTCACACAGG 3’ (SEQ ID NO.7), BcaBESTTM Sequencing Primer M13-47: 5’CGCCAGGGTTTTCCCAGTCACGAC 3’ (SEQ ID NO.8).

[0070] The gene sequencing result shows the sequence from the 5'-end to the 3'-end as shown in (SEQ ID NO.2).

[0071]

[0072] The nucleotide sequence listing of the antimicrobial peptide gene of the brown-spotted tree frog is as follows: sequence length is 459 bases; sequence type: nucleic acid; number of strands: single-stranded; topology: linear; sequence type: cDNA; source: the skin of the brown-spotted tree frog.

[0073] Based on the gene of the antimicrobial peptide of the brown-spotted tree frog, the deduced functional mature antimicrobial peptide is encoded by nucleotides 370 - 455 (SEQ ID NO.9), and the amino acid sequence is: GKCNFMCKVKQKLRAIGSKTVIGTVVHKI (see sequence SEQ ID NO.1).

[0074] The nucleotides of the antimicrobial peptide gene of the brown-spotted tree frog at positions 370 - 455 (SEQ ID NO.9):

[0075]

[0076] Example 2: Preparation of the antimicrobial peptide of the brown-spotted tree frog

[0077] 1. Preparation method of the antimicrobial peptide of the brown-spotted tree frog:

[0078] Based on the deduced amino acid sequence of the functional mature antimicrobial peptide from the gene of the antimicrobial peptide of the brown-spotted tree frog, the polypeptide is synthesized using an automatic polypeptide synthesizer. Desalting and purification are carried out by HPLC reverse-phase C18 column chromatography. The formation of disulfide bonds adopts the air oxidation method. Specifically, after dissolving the polypeptide at 0.1 mg / mL in 0.1% acetic acid solution in a flask, it is titrated to pH 7.8 with ammonium hydroxide, and then stirred at room temperature overnight. Desalting and purification are carried out by HPLC reverse-phase C18 column chromatography, and the detection wavelength is 220 nm. The purity of the purified antimicrobial peptide of the brown-spotted tree frog is identified by high-performance liquid chromatography (HPLC). As Figure 1 shown, the polypeptide appears at 7.227 minutes.

[0079] 2. Molecular weight determination is carried out by fast atom bombardment mass spectrometry (FAB-MS), using glycerol: m-nitrobenzyl alcohol: dimethyl sulfoxide (1:1:1, V:V:V, volume ratio) as the substrate, Cs + as the bombardment particle, the current is 1 μA, and the emission voltage is 25 Kv. As Figure 2 shown, the molecular weight calculated from the mass spectrum is 3186.89 Da.

[0080] 3. The brown-spotted tree frog antimicrobial peptide is a polypeptide encoded by the antimicrobial peptide gene of the Chinese amphibian brown-spotted tree frog. It is a polypeptide composed of 29 amino acids, with a molecular weight of 3186.89 Daltons and an isoelectric point of 10.32. The amino acid sequence is: GlyLysCysAsnPheMetCysLysValLysGlnLysLeuArgAlaIleGlySerLysThrValIleGlyThrValValHisLysIle (GKCNFMCKVKQKLRAIGSKTVIGTVVHKI), and the third cysteine and the seventh cysteine form an intramolecular disulfide bond.

[0081] Example 3: Determination of the ability of the brown-spotted tree frog antimicrobial peptide to inhibit bacterial growth

[0082] The minimum inhibitory concentration of the brown-spotted tree frog antimicrobial peptide was determined by the turbidimetric method. Take out the frozen bacterial liquid stored at -80 °C, place it in a 37 °C water bath for rapid thawing, add it to 5 mL of fresh broth medium, and incubate the activated bacteria in a constant temperature shaker at 37 °C and 220 rpm overnight. Take 0.5 mL of the activated bacterial liquid and add it to 5 mL of fresh broth medium, and continue to culture for 2 - 4 h until the logarithmic growth phase of the bacteria (OD 600 = 0.6 - 0.8). Centrifuge at 3000 rpm for 5 min to collect the bacteria, wash them twice with physiological saline, resuspend them in an equal volume, dilute the bacterial liquid 1000 times with fresh LB, and adjust the bacterial density to 1×10 6 -1×10 8 CFU / mL (1 OD 600 ≈ 1×10 8 CFU / mL). Prepare a sterile 96-well flat-bottom plate, and prepare a series of concentration gradient sample working solutions by the two-fold dilution method. Add 50 μL of the sample to be tested and 50 μL of the bacterial liquid to each well and mix evenly. The control group is an equal volume of physiological saline. The culture plate is statically cultured at 37 °C for 18 - 20 h, and each group is repeated at least three times. The results are shown in Table 1. The brown-spotted tree frog antimicrobial peptide has broad-spectrum growth inhibitory activity against all tested strains. Among them, the MIC value of the antimicrobial peptide against Escherichia coli ATCC 25922 is 3.125 μM, the MIC value against Pseudomonas aeruginosa ATCC 27853 is 100 μM, the MIC value against Staphylococcus aureus ATCC 6538 is 3.125 μM, the MIC value against Bacillus subtilis CMCC 63501 is 1.5625 μM, and the MIC value against Candida albicans is 12.5 μM.

[0083] Table 1. Minimum inhibitory concentrations (MICs) of the brown-spotted tree frog antimicrobial peptide against different microorganisms

[0084]

[0085]

[0086] Example 4: Effect of the antimicrobial peptide of the brown-spotted tree frog on bacterial membranes

[0087] Scanning electron microscopy was used to observe the potential mechanism of action of the antimicrobial peptide of the brown-spotted tree frog on Escherichia coli and Staphylococcus aureus. Log-phase Escherichia coli ATCC 25922 (1×10 6 CFU / mL) was treated with 1×MIC peptide at 37 °C for 1 h, and then the bacteria were collected by centrifugation at 4000 rpm for 5 min. The bacteria were fixed with 4% glutaraldehyde at room temperature for 1 h, and then fixed with 2.5% glutaraldehyde at 4 °C overnight. Subsequently, the samples were washed with 0.1 M PBS and dehydrated in a graded series of ethanol / aqueous solutions (30%, 50%, 70%, 85%, 90% ethanol). Finally, after dehydration with absolute ethanol for 10 min, tert-butanol was used for replacement, and after critical point drying, the samples were sputter-coated with gold using an ion sputtering instrument and visualized using a tabletop scanning electron microscope according to the standard procedure. As Figure 3 shown, the antimicrobial peptide of the brown-spotted tree frog was able to significantly disrupt the membrane integrity of both bacteria (Escherichia coli and Staphylococcus aureus), exerting a powerful bactericidal effect.

[0088] Example 5: Effect of the antimicrobial peptide of the brown-spotted tree frog on the proliferative activity of LPS-induced splenocytes

[0089] Spleens were aseptically obtained from 4- to 6-week-old female BALB / c mice. After removing the excess tissue adhering to the spleen, the splenocytes were dispersed using a 40-μm cell sieve. Erythrocyte lysate was added and incubated for 2 min, and then 8 mL of PBS was added and the mixture was filtered through a 70-μm cell sieve to remove flocculent substances. The filtered cell suspension was transferred to a centrifuge tube. The cells were centrifuged at 1500 rpm for 5 min, and the supernatant was discarded. The cells were resuspended in 6 mL of RPMI1640 medium (containing 10% FBS, 100 U / mL penicillin, and 100 μg / mL streptomycin) and counted, and then seeded in 96-well plates at a density of 200,000 cells / well. The CCK8 method was used to determine the cytotoxicity of the antimicrobial peptide of the brown-spotted tree frog on splenocytes. Six hours after cell plating, different concentrations of the antimicrobial peptide (0, 2.5, and 5 μM) were added to the cells in the presence of 5 μg / ml LPS, and the cells were further incubated at 37 °C for 48 h. Then, CCK8 reagent was added and the cells were incubated for another 2 h, and the absorbance at 450 nm was measured. As Figure 4 shown.

[0090] Example 6: Study on the binding of the antimicrobial peptide of the brown-spotted tree frog to chymotrypsin and thrombin

[0091] Surface plasmon resonance experiments were used to detect the binding of the brown-spotted tree frog antimicrobial peptide and two serine proteases. 2mM peptide samples were fixed to the test chip and blocked. PBS was used as the working solution to balance the system with a continuous flow system. In the experiment, different concentration gradients of chymosin or thrombin (12.5μM, 25μM, 50μM and 100μM) were replaced in turn, with a total volume of 700μL and a flow rate of 2μL·s -1 The binding reaction temperature was 22.8°C, the binding time was 300s, and the dissociation time was 300s. Regeneration solution was used to regenerate each group of samples. The data obtained were analyzed and monitored in real time on the PlexeraSPRi system using the SPRV3 version instrument. The separation rate and binding rate constant were calculated using the BIA evaluation software point-and-click. The equilibrium constant was calculated using the average of the binding rate and separation rate obtained at three target protein concentrations. Figure 5 As shown, the brown-spotted tree frog antimicrobial peptide can bind chymotrypsin and thrombin in a gradient-dependent manner.

[0092] Example 7: Study on the stability of antimicrobial peptides from Rana rufipogon var. brownii against salt concentration and temperature

[0093] Antimicrobial peptides (50 μM) were dissolved in 60 mM sodium dodecyl sulfate solution, and then mixed with different concentrations of sodium chloride (0, 100, 200 and 400 mM) and incubated at room temperature for 1 h before measurement. Peptide temperature stability experiment: Antimicrobial peptides (50 μM) were dissolved in 60 mM sodium dodecyl sulfate solution, and then the mixture was incubated at 25 ° C, 37 ° C, 50 ° C, 70 ° C and 90 ° C for 1 h before measurement.

[0094] The above samples were added to the test dishes respectively, and the instrument detection setting parameters were as follows: sample pool path length 0.1 cm, 25°C, 1 nm from the chromatographic column, scanning wavelength 180-260 nm, bandwidth 1 nm, response time 1 sec and scanning speed 100 nm / min.

[0095] like Figure 6 As shown in A, in different sodium chloride solutions, as the salt concentration increases, the large positive peak at 195 nm decreases and the proportion of α-helical conformation decreases slightly, as shown in Figure 6 As shown in Figure B, temperature changes have almost no effect on its circular dichroism results. Most polypeptide substances are prone to hydrogen bond breaking in high temperature environments, resulting in denaturation, and therefore are subject to many restrictions in production, storage and use. However, the brown-spotted tree frog antimicrobial peptide in the present invention can maintain structural stability in high temperature environments and high-salt solutions, which not only shows that the peptide is easy to preserve, but also indicates that the peptide is very likely to exert its original inhibitory activity after entering the organism. In addition, the high temperature resistance also allows it to perform more sterilization operations in clinical use to ensure the safety of the drug.

[0096] Example 8: Study on the treatment of mice with cecal ligation and puncture model (CLP) by the antimicrobial peptide of the brown-spotted tree frog

[0097] In this example, a sepsis model of CLP in mice was established, and the survival rates of the control group, model group, antimicrobial peptide group, and dexamethasone group of mice after cecal ligation were observed. Male BALB / c mice (18 - 25 g) were selected, adaptively fed for 3 days, fasted for 12 hours before surgery, and then a sepsis model of CLP was established. After anesthetizing the mice, they were fixed supine on the operating table, the hair at the abdominal surgical site was shaved off, disinfected with iodophor, and a longitudinal incision of about 1 cm was made along the position slightly to the right of the midline of the abdomen with a scalpel, avoiding cutting the abdominal blood vessels. The cecum was separated using sterile forceps, ligated with a No. 3 thread at the distal 1 / 2 position of the ileocecal valve, and then punctured twice with a 23G needle at the 1 / 2 position between the ligation site and the blind end of the cecum to extrude an appropriate amount of intestinal contents. The cecum was then returned to the abdominal cavity, and the abdominal cavity was closed and sutured layer by layer. In the control group, after separating the distal end of the cecum, no ligation and puncture were performed, and the abdominal cavity was directly closed and sutured layer by layer. After the operation, 1 mL of normal saline at 37 °C was injected subcutaneously to supplement body fluids and help with recovery. In the drug treatment group, the antimicrobial peptide of the brown-spotted tree frog was injected intraperitoneally 1 h after modeling, the positive control group was injected with dexamethasone solution, and the control group and the model group were respectively injected with the same volume of normal saline. Then, the survival rate of the mice within 72 hours and their pathological characteristics, such as: piloerection, tremors, squinting, increased eye corner secretions, and diarrhea, were observed. The results are as Figure 5 shown. Within 72 hours, no mice in the control group died, the mortality rate of the mice in the model group was as high as 90%, the survival rate of the mice in the antimicrobial peptide treatment group was 40%, and the survival rate of the mice in the dexamethasone treatment group was 30%. Both the antimicrobial peptide treatment group and the dexamethasone treatment group significantly increased the survival rate of septic mice compared with the model group, and the antimicrobial peptide treatment group had a better effect than the dexamethasone treatment group.

[0098] Example 9: Study on the therapeutic effect of the antimicrobial peptide of the brown-spotted tree frog on psoriasis model mice

[0099] After weighing female BALB / c mice at 8 - 10 weeks of age, they were randomly grouped. A hair clipper and depilatory cream were used to remove the hair on the middle back of the mice in an area of about 3 * 5 cm 2 range. On the second day after hair removal, except for the control group, 62.5 mg of imiquimod cream (Licojie, 3 g: 0.15 g) was applied to the backs of the other mice, and then the cream was applied with a cotton swab until the entire exposed area was evenly covered. After the ointment was absorbed, the mice were returned to the cage, and the control group was applied with an equal amount of vaseline. In the antimicrobial peptide treatment group, 2 mg / kg of the polypeptide (dissolved in normal saline) was injected subcutaneously into the back 6 hours later. The corresponding model group and control group were injected with an equal volume of normal saline. The steps of modeling and drug administration were repeated for 7 days.

[0100] From the first day of modeling, the mice were weighed and PASI scored every day. Based on the color and degree of psoriasis of the hairless area on the back of the control mice as the baseline value (0), the degree of erythema and the appearance of psoriasis on the back of all mice were scored respectively, with the score range of 0-4. In addition, a vernier caliper was used to measure the skin thickness of the hairless area on the back of the mice as the score of the skin infiltration degree of the mice. The test results are as Figure 8 shown.

[0101] It can be Figure 8 seen that after treatment with imiquimod cream, erythema and scales appeared on the back skin of the mice in the model group, and the skin thickness also increased significantly. While the antimicrobial peptide treatment group could effectively reverse the above skin lesion changes and reduce the skin thickness. The PASI score results of psoriasis were consistent with the above skin appearance changes.

[0102] Example 10: Study on the hemolytic toxicity of the antimicrobial peptide of the brown-spotted tree frog

[0103] Mouse whole blood was taken and an equal volume of sterile Alsever's solution was added, and then centrifuged at 2000 rpm for 5 minutes. After washing the cells with physiological saline until the supernatant was colorless, the packed red blood cells were diluted into a 2% red blood cell suspension. The red blood cell suspension was incubated with different concentrations of antimicrobial peptide (0-40 μM) at 37 °C for 30 minutes, and after standing for 2 hours, a photo was taken for recording. The hemolysis rate was calculated by the absorbance value at 540 nm: Hemolysis rate % = [(OD sample - OD negative) / (OD positive – OD negative)] × 100%, and 0.1% Triton X-100 and physiological saline were used as positive and negative controls respectively.

[0104] The experimental results showed that: the red blood cells in the control group formed red spots at the bottom of the U-shaped plate, the positive control induced hemolysis, and the supernatant was light red; there was no hemolysis or coagulation phenomenon in the red blood cells treated with antimicrobial peptide at a concentration of 40 μM or below, indicating that the antimicrobial peptide had low toxicity to red blood cells and had good safety (see Table 2).

[0105] Table 2. Hemolytic toxicity of the antimicrobial peptide of the brown-spotted tree frog to red blood cells

[0106] Concentration (uM) 40 20 10 5 2.5 1.25 0.625 Hemolysis Ratio 2.34±0.78 1.00±0.37 -0.13±0.47 3.06±0.16 4.21±1.78 1.40±0.67 0.35±0.95

[0107] Obviously, the above examples are only for illustration and are not intended to limit the implementation methods. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A brown-spotted tree frog antimicrobial peptide, characterized in that: The brown-spotted tree frog antimicrobial peptide is a cyclic polypeptide composed of 29 amino acids, and its amino acid sequence is shown in SEQ ID NO.

1. The third cysteine ​​and the seventh cysteine ​​form an intramolecular disulfide bond.

2. A nucleotide encoding the antimicrobial peptide of Rana nigra according to claim 1.

3. The nucleotide according to claim 2, characterized in that The nucleotide sequence encoding the brown-spotted tree frog antimicrobial peptide according to claim 1 is shown as SEQ ID NO.2 or SEQ ID NO.

9.

4. Use of the brown-spotted tree frog antimicrobial peptide according to claim 1 or the nucleotide according to claim 2 in the preparation of any one of the following 1)-5): 1) Drugs for bacterial or fungal infections; 2) Drugs for treating diseases or indications caused by bacterial or fungal infections; 3) Anti-inflammatory drugs; 4) Immunomodulatory drugs; 5) Drugs for the treatment of autoimmune diseases.

5. The use according to claim 4, characterized in that: The inflammation for which the anti-inflammatory drug is applicable is inflammation caused by bacterial or fungal infection.

6. The use according to claim 4 or 5, characterized in that: The bacteria are Gram-positive bacteria or Gram-negative bacteria; Preferably, the Gram-positive bacteria include Staphylococcus aureus and Bacillus subtilis; Preferably, the Gram-negative bacteria include Escherichia coli and Pseudomonas aeruginosa; Preferably, the fungus comprises Candida albicans.

7. Use of the brown-spotted tree frog antimicrobial peptide according to claim 1 or the nucleotide according to claim 2 in the preparation of a drug for preventing and / or treating sepsis.

8. Use of the antimicrobial peptide of Rana rufipogon japonicus according to claim 1 or the nucleotide according to claim 2 in the preparation of a medicament for preventing and / or treating psoriasis.

9. Use of the brown-spotted tree frog antimicrobial peptide according to claim 1 or the nucleotide according to claim 2 in the preparation of a lipopolysaccharide neutralizing drug.

10. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the brown-spotted tree frog antimicrobial peptide according to claim 1 or the nucleotide according to claim 2.

Images