Vineyard hansenula polymorpha HV-26 and application of vineyard hansenula polymorpha HV-26 in wine brewing

Abstract

The invention relates to the technical field of microorganisms. The invention particularly relates to vineyard hansenula polymorpha and application of the vineyard hansenula polymorpha in wine brewing. The vineyard hansenula polymorpha HV-26 is preserved in the China General Microbiological Culture Collection Center on January 14, 2025, the preservation date is January 14, 2025, and the preservation number is CGMCC No.33403. The invention further discloses a preparation method of the vineyard hansenula polymorpha HV-26. The vineyard hansenula polymorpha HV-26 and saccharomyces cerevisiae QA23 are mixed to inoculate and ferment the Guixiang wine, the content of esters and phenethyl alcohol in the wine can be greatly increased, the concentration of bad flavor volatile acid is reduced, and therefore the flower and fruit fragrance of the Guixiang wine is enhanced, the problem that the fragrance is single when commercial saccharomyces cerevisiae is inoculated and fermented independently is solved, and the wine quality is improved. The hansenula polymorpha HV-26 is more complex in fragrance and more prominent in layering sense and style, and has good industrial application potential in wine brewing.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology. Specifically, the present invention relates to a Hanseniaspora vineae HV-26 and its application in improving the aroma quality of wine. Background Art

[0002] As one of the "Seven Major Grape Coasts in the World", Penglai production area in Shandong relies on the geographical advantages of the 37°N golden wine-making belt (at the same latitude as well-known production areas such as Bordeaux, France). With a mild maritime climate, sufficient sunlight, gravel soil rich in minerals, and a relatively long grape growth cycle, it promotes the full accumulation of aroma substances, polyphenols such as tannins in grapes, and slow sugar-acid conversion, resulting in high-quality wines with balanced body, elegant fruity aroma, delicate tannins, and outstanding storage capacity. However, in the current brewing process, there is an over-reliance on imported commercial yeasts. Restricted by differences in ecological types and process conditions, the products show a "homogenization" trend. Especially in the production of white wines, single-yeast fermentation is difficult to meet the market's demand for flavor complexity. Facing challenges such as climate change and consumption upgrading, it is urgent to select excellent local yeast strains and innovate multi-strain co-fermentation technologies to build a "terroir-variety-technology" trinity brewing system to strengthen the expression of production area characteristics and enhance competitiveness in the high-end market.

[0003] In the initial stage of the natural fermentation process of wine, not only Saccharomyces cerevisiae exists, but also a large number of non-Saccharomyces yeasts exist. In recent years, researchers have found that non-Saccharomyces yeasts have many advantages such as improving the aroma and taste of wine. For example, Hanseniaspora vineae. Research shows that this yeast can efficiently synthesize acetate esters (such as phenethyl acetate, isoamyl acetate) and ethyl esters (such as ethyl hexanoate, ethyl octanoate) through the synergistic action of the glycolysis pathway and the pentose phosphate pathway in the early stage of alcoholic fermentation (logarithmic growth phase), which can significantly improve the aroma quality of wine. However, there is relatively little research on this type of yeast in the domestic wine industry, and the reserve of related strains is very insufficient. There is an urgent need to obtain Hanseniaspora vineae strains that can be applied to actual production. Summary of the Invention

[0004] The purpose of the present invention is to provide a Hanseniaspora vineae HV-26 that can significantly enhance the aroma of wine and has practical application potential.

[0005] Another purpose of the present invention is to provide the application of the above-mentioned Hanseniaspora vineae HV-26 in the brewing of Gewürztraminer wine.

[0006] In order to achieve the above purposes, the present invention provides the following technical solutions:

[0007] A Hanseniaspora uvarum HV-26 from vineyards is preserved in the China General Microbiological Culture Collection Center. The preservation date is January 14, 2025, and the preservation number is CGMCC No. 33403.

[0008] The colony characteristics of the Hanseniaspora uvarum HV-26 from vineyards are round, with a diameter of 2-4 cm, the center color is grass green, the outer edge is white, the surface is smooth, protruding on the surface of the solid medium and the edge is neat and smooth.

[0009] The Hanseniaspora uvarum HV-26 from vineyards can maintain a certain growth activity in an environment with an alcohol content (% v / v) of 24%.

[0010] The Hanseniaspora uvarum HV-26 from vineyards can grow in an environment with a high sulfur dioxide concentration of more than 200 mg / L.

[0011] The Hanseniaspora uvarum HV-26 from vineyards has a low H 2 S production;

[0012] The β-glucosidase activity of the Hanseniaspora uvarum HV-26 from vineyards is comparable to that of Saccharomyces cerevisiae D254.

[0013] An application of Hanseniaspora uvarum HV-26 from vineyards in winemaking.

[0014] The wine is Gewürztraminer wine, and it is fermented by mixed inoculation of Hanseniaspora uvarum HV-26 from vineyards and Saccharomyces cerevisiae. The inoculation methods include delayed inoculation and simultaneous inoculation. Delayed inoculation means inoculating Hanseniaspora uvarum HV-26 first and then inoculating Saccharomyces cerevisiae two days later. Simultaneous inoculation means inoculating Hanseniaspora uvarum HV-26 and Saccharomyces cerevisiae at the same time.

[0015] The said application can improve the aroma of the wine.

[0016] The Hanseniaspora uvarum HV-26 from vineyards can increase the content of ester aroma substances and aromatic compounds in Gewürztraminer wine.

[0017] The Saccharomyces cerevisiae is commercial Saccharomyces cerevisiae QA23;

[0018] In this application, the Hanseniaspora uvarum HV-26 from vineyards enhances the aroma of Gewürztraminer wine by increasing acetate and ethyl ester substances.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] The Hanseniaspora uvarum HV-26 of the present invention has high alcohol and SO 2Tolerance, specifically manifested as being able to maintain a certain growth activity in an environment with an alcohol content (% v / v) of 24% and an SO 2 concentration of 200 mg / L; and it has strong aroma-producing ability, especially ester aroma, and low volatile acid production, and can be used for wine fermentation. The examples of the present invention specifically provide the application of the mixed fermentation of this strain and commercial Saccharomyces cerevisiae QA23 in Gewürztraminer wine.

[0021] The Hanseniaspora vineae HV-26 provided by the present invention can, to a certain extent, improve the final aroma of wine, enhance the floral and fruity aromas of wine, and thus improve the sensory quality of wine.

[0022] Biological deposit description

[0023] HV26, Hanseniaspora vineae, was deposited on January 14, 2025, at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the deposit number CGMCC No. 33403. Description of the drawings

[0024] Figure 1 It is the colony morphology of the Hanseniaspora vineae HV-26 of the present invention on the WLN medium;

[0025] Figure 2 It is the growth situation of the strain in the single fermentation experiment of the Hanseniaspora vineae HV-26 of the present invention in Chardonnay grape juice;

[0026] Figure 3-1 It is the specific gravity change of the mixed fermentation of the Hanseniaspora vineae HV-26 of the present invention and Saccharomyces cerevisiae in Gewürztraminer wine;

[0027] Figure 3-2 It is the sensory evaluation diagram after the alcoholic fermentation of the mixed fermentation of the Hanseniaspora vineae HV-26 of the present invention and Saccharomyces cerevisiae in Gewürztraminer wine; Detailed implementation manners

[0028] The present invention will be further described below in conjunction with examples and drawings.

[0029] Unless otherwise specified, the methods used in the following examples are all conventional methods. The test materials used are all ordinary commercially available products and can be purchased in the market.

[0030] The composition of the culture medium components involved in the examples is as follows:

[0031] BIGGY agar medium: ammonium bismuth citrate, 5 g / L; sodium sulfite, 3 g / L; glucose, 10 g / L; glycine, 10 g / L; yeast extract powder, 10 g / L; agar, 1 g / L.

[0032] Yeast nutrient medium (YPD): yeast extract powder, 10 g / L; peptone, 20 g / L; glucose, 20 g / L; agar, 20 g / L.

[0033] WLN nutrient agar medium: tryptone, 5 g / L; yeast extract powder, 4 g / L; glucose, 50 g / L; potassium dihydrogen phosphate, 0.55 g / L; potassium chlorate, 0.425 g / L; calcium chloride, 0.125 g / L; magnesium chloride, 0.125 g / L; ferric trichloride, 0.0025 g / L; manganese sulfate, 0.0025 g / L; bromocresol green, 0.022 g / L; agar, 20 g / L.

[0034] pNPG screening medium: peptone 20 g / L, glucose 20 g / L, pNPG 10 g / L, yeast extract 10 g / L, agar powder 20 g / L.

[0035] The Hanseniaspora vineae HV-26 of the present invention is deposited with the China General Microbiological Culture Collection Center, with the deposit number CGMCC No. 33403 and the deposit date of January 14, 2025.

[0036] Example 1 Isolation, purification and identification of the Hanseniaspora vineae HV-26 strain

[0037] The Petit Verdot grapes provided by Penglai production area in Yantai, Shandong were crushed and subjected to natural fermentation for wine. A small amount of wine sample was taken every two days and diluted and spread on WLN nutrient agar medium (added with 100 mg / L chloramphenicol), and cultured in a constant temperature incubator at 28 °C for 48 - 72 h. Colonies with different morphologies were picked and purified by streaking to obtain the isolated strains. The identification of yeasts was carried out by 16S rDNA genome sequencing method. The method for extracting genomic DNA of the strains was as follows: A single colony obtained by streaking and pure culture was picked and centrifuged at 12,000 r for 1 min, and the supernatant was discarded. Then, the genomic DNA of the strains was extracted using a yeast DNA genomic extraction kit according to the instructions. The PCR amplification method for 16S rDNA gene was as follows: The extracted strain DNA was used to amplify the 16S rDNA gene region of the strain DNA using the forward primer NL1 (GCATATCAATAAGCGGAGGAAAA) and the reverse primer NL4 (GGTCCGTGTTTCAAGACGG) in a PCR amplifier. The PCR amplification system was: 1 μL of template DNA, 1 μL each of primers NL1 and NL4, 12.5 μL of 2×Pfu PCR Mix (with dye), and double-distilled water (dd H2O) was added to make up to 25 μL. The amplification product was detected by 1% agarose gel electrophoresis and a gel imaging system. A band of about 1500 bp was observed, indicating successful PCR. Then it was sent to Sangon Biotech in Shanghai for single-directional sequencing. The obtained 16S rDNA gene sequence of the strain was compared with the known bacterial gene sequences in the GenBank database on the NCBI website using the BLAST program. The isolated strain had a homologous similarity greater than 99% with Hanseniaspora guilliermondii, so it was identified as Hanseniaspora uvarum in the vineyard and named HV-26. For the successfully identified Hanseniaspora uvarum HV-26 in the vineyard, a single colony obtained by its streaking and pure culture was inoculated into YPD liquid medium and statically cultured for about 24 h until the mid-logarithmic phase. Using 50% glycerol as a cryoprotectant, the culture solution was mixed with 50% glycerol (1:1) and added to a preservation tube, and stored at -80 °C.

[0038] Preliminary Detection Experiment on the Strain Characteristics of Hanseniaspora uvarum HV-26 in the Vineyard

[0039] The control strain in this experiment was the commercial wine yeast D254.

[0040] The following preliminary detection experiments were carried out respectively, and the results in Table 1 were obtained:

[0041] 1. Screening for hydrogen sulfide production: The activated bacterial solution was spotted on BIGGY medium, with 3 replicates for each strain. The spotted BIGGY plates were cultured in an incubator at 28 °C for 2 d, and the colony colors were observed. According to the colony colors, they could be divided into 5 grades; the colony color was white, indicating that the strain did not produce H 2 S; the colony color was light brownish-tan, indicating that the strain produced low levels of H2 S; The colony color is brownish - brown, indicating that the strain produces H 2 S; When the colony color is dark brownish - brown or black, it indicates that the strain has high yield of H 2 S. Two biological replicates were set for each experimental group.

[0042] 2. Screening for sulfur dioxide tolerance: Potassium metabisulfite decomposes in grape juice to produce sulfur dioxide. After activating the strain, inoculate it at an inoculum concentration of 10 6 CFU / mL respectively. Take 20 μL of the sample and add 180 μL of YPD into the microplate. Incubate statically at 28 °C for 72 h, and use an ultraviolet - spectrophotometer to measure the OD 600nm value. The experiment was set with three replicates. The concentration gradients of added sulfur dioxide are 0, 50, 100, 150, 200 mg / L.

[0043] 3. Screening for alcohol tolerance: After activating the strain, inoculate it at an inoculum concentration of 10 6 CFU / mL respectively. Take 20 μL of the sample and add 180 μL of YPD into the microplate. Incubate statically at 28 °C for 72 h, and use an ultraviolet - spectrophotometer to measure the OD 600nm value. The experiment was set with three replicates. Add 0%, 3%, 6%, 9%, 24% alcohol.

[0044] 4. Preliminary determination of β - glucosidase activity (semi - quantitative colorimetric method): Add 200 μL of sterilized pNPG screening medium to each well of the 96 - well plate. After the medium solidifies, inoculate the purified bacterial solution onto the 96 - well plate, inoculating 20 μL per well. Inoculate 3 wells with each bacterial solution as parallel tests, and record the single - colony numbers corresponding to each well on the plate. After incubating the 96 - well plate in an incubator at 28 °C for 72 h, add 20 μL of 1 mol / L sodium carbonate solution to each well and let it stand for 10 min. The depth of yellow in the well reflects the level of β - glucosidase activity of the strain. Finally, select strains with high β - glucosidase activity from several strains on the 96 - well plate.

[0045] The semi - quantitative classification method is defined as: no activity (blank, -), weak activity (light yellow, +), medium activity (yellow, ++), high activity (bright yellow, +++).

[0046] 5. Detection of β - glucosidase activity (quantitative):

[0047] The β-glucosidase activity was determined by spectrophotometry. Take 1 mL of the yeast culture solution in the logarithmic growth phase, rinse it with 150 mM NaCl, resuspend it in 500 μL of 125 mM citrate-phosphate buffer (pH 5.0) containing 5 mM p-nitrophenyl-β-D-glucopyranoside (p-NPG), and incubate it at 25 °C for two hours. Dilute the sample with 1 mL of 0.2 M carbonate buffer (pH 10.2), centrifuge to clarify, and measure the absorbance of the supernatant at a wavelength of 400 nm. According to this measurement result, calculate the concentration of the released p-nitrophenol (p-NP) using the standard curve prepared with the standard p-nitrophenol solution.

[0048] Table 1 Comparison of the basic characteristics between HV-26 and Saccharomyces cerevisiae D254

[0049]

[0050] Note: D254 is a commercial Saccharomyces cerevisiae, and HV-26 is Hanseniaspora uvarum from vineyards.

[0051] As can be seen from Table 1, Hanseniaspora uvarum HV-26 can tolerate an alcohol content of 24% (v / v) and maintain a certain growth activity; it can grow in an environment with a high sulfur dioxide concentration of more than 200 mg / L; and it has a low H 2 S production and a high β-glucosidase activity. This strain meets the basic requirements of the strains in wine production.

[0052] Example 2 Single fermentation experiment of Hanseniaspora uvarum HV-26

[0053] To further determine the fermentation ability of Hanseniaspora uvarum HV-26 in grape juice, a single fermentation experiment was carried out using Chardonnay grape juice from Penglai production area in Shandong.

[0054] The control strains in this experiment were commercial Saccharomyces cerevisiae D254 and RX60.

[0055] Inoculate Hanseniaspora uvarum HV-26, commercial Saccharomyces cerevisiae D254, and RX60 separately into 100 mL shake flasks containing 50 mL of Chardonnay grape juice. After inoculation, inject 10 mL of sterile water into the fermentation stopper and seal it. During the alcoholic fermentation, detect the fermentation rate, and take the samples at the end of fermentation for the determination of volatile aroma and the analysis of main metabolites.

[0056] The fermentation situation was determined by the carbon dioxide weight loss method. When the weight change was less than 2 g / L for two consecutive days, the alcoholic fermentation was considered to be over.

[0057] The main metabolites in the fermentation broth were analyzed according to the following method.

[0058] After filtering the fermentation broth (PES, 0.22 μm), high performance liquid chromatography HPLC1200 (Agilent Technologies, Inc. Palo Alto, CA) was used to analyze the main metabolites of fermentation. The ion exchange column was HPX-87H Aminex ion-exchange column (300×7.8 mm, Bio-Rad Laboratories, USA), and the mobile phase was 5 mM H 2 SO 4 solution, isocratic elution, flow rate 0.6 mL / min.

[0059] For the determination of glucose, fructose, ethanol and glycerol, a refractive index detector (RID, refractive index detector, G1362A, Agilent, USA) was used. The injection volume was 20 μL, the column temperature was 45 °C, and the analysis time was 30 min; for the determination of organic acids (tartaric acid, malic acid, citric acid, lactic acid, succinic acid and acetic acid), a diode array detector (DAD, photodiode array detector, G1315D, Agilent, USA) was used. The injection volume was 10 μL, the column temperature was 60 °C, and the analysis time was 25 min.

[0060] The volatile aroma components of the fermentation broth were analyzed according to the following method: An Agilent 6890 gas chromatograph (GC) and an Agilent 5975 mass spectrometer (MS) (Agilent, USA) were used to detect the types and contents of various volatile aroma substances in the fermented wine obtained above. The specific conditions were as follows: The capillary column was HP-INNOWAX Polyethylene Glycol 60 m×0.25 mm×0.25 μm (J&W scientific, USA), the carrier gas was high-purity helium, and the flow rate was 1 mL / min; headspace solid-phase microextraction automatic injection was used, and the splitless mode was adopted. It was inserted into the injection port of the gas chromatograph, the injection port temperature was 250 °C, and the thermal desorption was 25 min. The temperature program of the column oven was: keep at 40 °C for 5 min, then increase the temperature to 200 °C at a rate of 3 °C / min and keep for 2 min. The mass spectrometry interface temperature was 280 °C, the ion source temperature was 230 °C, the ionization mode was EI, the ion energy was 70 ev, and the mass scanning range was 20-350 m / z.

[0061] Add 5 mL of the fermentation sample into a 15 mL sample vial. Meanwhile, add 1 g of NaCl and 10 μL of internal standard (4-methyl-2-pentanol), and then quickly tighten and seal the sample vial with a sample bottle cap equipped with a polytetrafluoroethylene (PTFE) septum. Under the constant temperature condition of 40 °C, equilibrate for 30 min at 180 r / min. After the gas-liquid aroma substances in the sample vial reach equilibrium, insert the activated or thermally desorbed polydimethylsiloxane / carboxen / divinylbenzene (PDMS / CAR / DVB) extraction head into the headspace of the sample vial, and stir and extract at a constant temperature of 40 °C for 30 min to achieve gas-solid and gas-liquid equilibrium of the aroma substances in the sample vial. Then insert the extraction head into the GC-MS injection port, thermally desorb at 250 °C for 8 min, and inject without splitting.

[0062] Qualitative and quantitative analysis of aroma substances: Using the full ion scan (Scan) spectrum of the mass spectrometry, for substances with existing standards, based on the retention time, retention index, and mass spectrometry information of the compound under the same chromatographic conditions established in this experiment, conduct qualitative analysis, and make a standard curve of it in the simulated wine solution for quantification (the synthetic wine solution is an aqueous solution of 2 g / L glucose, 7 g / L tartaric acid, and 12% alcohol, and the pH is adjusted to 3.3 with NaOH. Prepare 15 gradients of the mixed aroma standard). For substances without standards, use the retention index of the compound under similar chromatographic conditions reported in the literature and the comparison results of the NIST 11 standard spectral library (NIST Chemistry WebBook) for semi-qualitative analysis.

[0063] (1) Fermentation rate as Figure 2 shown

[0064] In this invention, the carbon dioxide weight loss is selected to describe the simulated fermentation process. It can be seen from the curve that the commercial brewing yeast D254 and RX60 have a fast fermentation rate and complete the alcohol fermentation in 12 days; the HV-26 has a slow fermentation rate and completes the task of alcohol fermentation in 14 days. The above results indicate that the single fermentation ability of HV-26 is weak and the participation of brewing yeast is required to ensure the smooth completion of alcohol fermentation.

[0065] (2) Analysis of the main metabolites after the end of alcohol fermentation, as shown in Table 2.

[0066] Table 2 Contents of main metabolites in each experimental group after the end of alcohol fermentation

[0067] Substance (g / L) RX60 D254 HV-26 Citric acid 1.09±0.01b 1.51±0a 1.16±0.18b L-Malic acid 2.8±0.05b 2.84±0.05b 3.08±0.07a Tartaric acid 0.42±0.01a 0.43±0.01a 0.44±0.01a Succinic acid 3.88±0.04b 3.74±0.07b 5.53±0.08a Lactic acid 1.8±0.01b 2.04±0.07a 1.76±0.01b Acetic acid 0.33±0.03b 0.27±0.02b 0.47±0.03a D-Malic acid 5.11±0.35a 4.75±0.34a 4.99±0.36a Glucose 2.76±0.08b 2.79±0.09b 8.22±0.56a Fructose 2.63±0.11b 2.48±0.13b 32.71±1.06a Glycerol 6.34±0.19a 5.43±0.18a 5.17±0.72a Ethanol 13.82±0.11a 14.05±0.11a 11.89±0.22b

[0068] Note: RX60 and D254 are commercial brewing yeasts, and the data in the table are (mean ± relative standard deviation); use independent sample T-test for significant variance analysis, and different letters marked after the content of the same compound indicate significant differences between different treatment groups (p < 0.05).

[0069] As can be seen from the data in Table 2, the basic physical and chemical indexes of each fermentation experimental group are within the national standard control range and meet the requirements of various indexes of wine. Compared with the single fermentation of Saccharomyces cerevisiae RX60 and D254, Hanseniaspora uvarum HV-26 in the vineyard consumes less sugar and produces a lower ethanol content during single fermentation.

[0070] (3) To further analyze the effect of inoculation and fermentation of Hanseniaspora uvarum HV-26 in the vineyard on the quality of wine, we measured the types and contents of volatile aroma substances in the fermentation broth. As can be seen from Table 3, compared with the commercial Saccharomyces cerevisiae D254 and RX60, the prominent characteristic of the aroma of the fermentation broth inoculated with Hanseniaspora uvarum HV-26 alone is that it can significantly increase the content of ester substances, and to a certain extent improve the aroma intensity and complexity: the total ester content increased by 2.04 times and 1.92 times compared with D254 and RX60; ethyl acetate increased by 1.97 times and 1.92 times; phenethyl acetate increased by 80.70 times and 76.71 times. It gives a sweet and fruity aroma. In addition, the content of β-damascenone increases, giving the fermentation broth a rich floral and sweet aroma; the content of volatile acids decreases.

[0071] Table 3 Comparison of aroma substances at the end of alcoholic fermentation of Chardonnay grape juice inoculated with three different strains

[0072]

[0073]

[0074] Note: RX60 and D254 are commercial Saccharomyces cerevisiae, and HV-26 is Hanseniaspora uvarum in the vineyard. The data in the table (mean ± relative standard deviation); significant variance analysis was performed using independent sample T-tests. Different letters marked after the content of the same compound indicate significant differences between different treatment groups (p<0.05).

[0075] In summary, Hanseniaspora uvarum HV-26 in the vineyard can grow well in simulated grape juice and can successfully complete the task of alcoholic fermentation, and can increase the aroma substances such as esters and β-damascenone, and has the potential to improve the floral and fruity aromas of wine.

[0076] Example 3 Mixed fermentation experiment of Hanseniaspora uvarum HV-26 in the vineyard

[0077] After the above experiments, it was determined that Hanseniaspora uvarum HV-26 has excellent brewing characteristics and the potential to enhance the aroma of wine. However, further confirmation is needed on whether it can be applied to the actual wine production process. Therefore, the applicant conducted a pilot-scale fermentation experiment of Hanseniaspora uvarum HV-26 in Penglai, Yantai, Shandong. The fermenter used in the pilot-scale fermentation experiment was a 50L stainless steel fermenter. The grape variety used for winemaking was Riesling, and the inoculation methods used were delayed inoculation and simultaneous inoculation.

[0078] Since Hanseniaspora uvarum HV-26 is difficult to complete alcoholic fermentation alone, a process of mixed inoculation fermentation with Saccharomyces cerevisiae was adopted, including delayed inoculation and simultaneous inoculation. Delayed inoculation means first inoculating Hanseniaspora uvarum HV-26, and then inoculating Saccharomyces cerevisiae QA23 after two days of fermentation; simultaneous inoculation means simultaneously inoculating Hanseniaspora uvarum HV-26 and Saccharomyces cerevisiae QA23 to ensure the smooth completion of alcoholic fermentation; the changes in the main physicochemical and aroma indexes of the wine after fermentation were studied, with the single inoculation of commercial Saccharomyces cerevisiae QA23 as the control.

[0079] First, an appropriate amount of grape juice was pasteurized (79°C, 15 min). Hanseniaspora uvarum HV-26 stored at -80°C was inoculated into the above pasteurized grape juice for primary expansion culture. After the bacteria entered the logarithmic growth phase, they were transferred to the pasteurized grape juice for secondary culture. After the bacteria grew to the logarithmic phase, they were reserved as the seed liquid for use. Commercial Saccharomyces cerevisiae QA23 was activated with warm water at 37°C during inoculation and operated according to the procedures specified in the product to ensure the accuracy of the inoculation amount.

[0080] According to the inoculation amount of commercial Saccharomyces cerevisiae QA23 being 10 6 cfu / mL and the inoculation amount of Hanseniaspora uvarum HV-26 being 10 7 cfu / mL, they were inoculated into a 50L stainless steel fermenter filled with Chardonnay grape juice. A total of 3 experimental groups were set up, with each group repeated twice. Specifically:

[0081] Single fermentation experimental group: Commercial Saccharomyces cerevisiae QA23 was fermented alone (QA23)

[0082] Mixed fermentation experimental group 1: Hanseniaspora uvarum HV-26 and commercial Saccharomyces cerevisiae QA23 were sequentially inoculated and fermented at an interval of two days (HV-26(+QA23 / 2d)); that is, first inoculating Hanseniaspora uvarum HV-26, and then inoculating Saccharomyces cerevisiae QA23 after two days of fermentation.

[0083] Mixed fermentation experimental group 2: Hanseniaspora uvarum HV-26 and commercial Saccharomyces cerevisiae QA23 were simultaneously inoculated and fermented (HV-26+QA23).

[0084] The analysis method of the main metabolites in the fermentation broth is the same as that in the single fermentation experiment.

[0085] The analysis method of the volatile aroma substances in the fermentation broth is the same as that in the single fermentation experiment.

[0086] Sensory evaluation method: Twelve panelists (7 females, 5 males, aged between 22 and 32 years old) from the sensory panel of the Center for Viticulture and Enology (CFVE) received aroma training before the formal evaluation, covering the identification, classification, and intensity rating of various aromas in wine. The sensory evaluation index consists of two parts: aroma quality and taste quality.

[0087] (1) Influence of mixed inoculation fermentation on the quality of Gewürztraminer wine

[0088] Initial data of grape juice: Initial sugar concentration 204 g / L, sulfur dioxide concentration 42 mg / L, pH = 3.25. It was statically cultured at 24 °C, and the fermentation situation was judged by observing the specific gravity change. When the specific gravity was lower than 0.994, the alcoholic fermentation was judged to be over.

[0089] As Figure 3-1 shown, when the yeast was first inoculated, the fermentation rates of Hanseniaspora uvarum HV-26 and commercial Saccharomyces cerevisiae QA23 in the vineyard almost coincided, indicating that it has a strong ability to adapt to the fermentation environment; after the commercial Saccharomyces cerevisiae QA23 was inoculated 2 days later, the fermentation rate of the mixed fermentation group was faster than that of the commercial Saccharomyces cerevisiae QA23 in single fermentation. The alcoholic fermentation was completed in 8 days, while the control group needed 10 days. Overall, the mixed fermentation can accelerate the fermentation process and shows good brewing potential.

[0090] Table 3 Contents of main metabolites in each experimental group after the alcoholic fermentation of Gewürztraminer wine

[0091] Substance (g / L) QA23 HV-26(+QA23 / 2d) HV6+QA23 Citric acid 1.04±0.02a 0.94±0.03a 0.93±0.05a Tartaric acid 2.35±0.06a 2.78±0.02a 3.1±0.51a L-Malic acid 2.76±0.06a 2.53±0.04a 2.85±0.22a Succinic acid 1.63±0.04b 1.82±0.03b 2.27±0.11a Lactic acid 0.29±0.02c 0.45±0.03b 0.62±0.01a Acetic acid 0.44±0a 0.27±0.02b 0.22±0.07b D-Malic acid 2.41±0.01c 3.4±0.03a 2.08±0.08b Glucose 2.9±0.13a 3.2±0.33a 3.4±0.58a Fructose 4.01±0.05a 3.47±0.2b 3.98±0.08a Glycerol 7.7±0.22b 8.41±0.24a 8.03±0.18ab Ethanol 13.71±0.29a 12.73±0.12a 12.96±0.48a

[0092] Note: QA23 is commercial Saccharomyces cerevisiae, HV-26(+QA23 / 2d) is Hanseniaspora uvarum HV-26 inoculated 2 days after the inoculation of commercial Saccharomyces cerevisiae QA23; HV-26 + QA23 is the simultaneous inoculation of commercial Saccharomyces cerevisiae QA23 and Hanseniaspora uvarum HV-26; the data in the table (mean ± relative standard deviation); independent sample T-test was used for significant variance analysis, and different letters marked after the content of the same compound indicate significant differences between different treatment groups (p < 0.05).

[0093] As can be seen from the data in Table 3, the basic physical and chemical indicators of each fermentation experimental group are within the national standard control range and meet the requirements of various indicators for wine. Compared with the single fermentation of Saccharomyces cerevisiae QA23, the alcohol content in the two mixed fermentation experimental groups with Hanseniaspora uvarum HV-26 involved has decreased to a certain extent, which better meets the needs of consumers for alcoholic beverages in recent years. In addition, the two experimental groups have lower acetic acid production and higher glycerol production, and there are no significant differences in other indicators compared with the single fermentation of Saccharomyces cerevisiae.

[0094] Table 4 Contents of aroma substances in each experimental group after the completion of alcoholic fermentation of Riesling wine

[0095]

[0096]

[0097]

[0098] Note: QA23 is a commercial Saccharomyces cerevisiae, HV-26(+QA23 / 2d) means inoculating Hanseniaspora uvarum HV-26 first and then inoculating commercial Saccharomyces cerevisiae QA23 after two days. HV-26 + QA23 means inoculating commercial Saccharomyces cerevisiae QA23 and Hanseniaspora uvarum HV-26 simultaneously; the data in the table (mean ± relative standard deviation); independent sample T-test is used for significant variance analysis, and different letters marked after the content of the same compound indicate significant differences between different treatment groups (p < 0.05), and bold letters indicate that the OAV value of the corresponding aroma substance > 0.1.

[0099] As shown in Table 4, compared with the single fermentation of Saccharomyces cerevisiae QA23, the mixed fermentation experiments with Hanseniaspora uvarum HV-26 involved can all increase the content of ester substances. The total ester content (except ethyl acetate) of delayed inoculation and simultaneous inoculation increased by 18.21% and 21.96% respectively compared with the single fermentation group of QA23. Among them, phenethyl acetate (fruity, floral) increased by 77.89% and 80.09%; hexyl acetate (apple, cherry aroma) increased by 52.55% and 7.30%; isoamyl acetate (banana, pear aroma) increased by 82.74% and 65.56%; ethyl laurate (fruity, floral) increased by 56.97% and 57.01%, thus enhancing the fruity and floral aromas of Riesling wine.

[0100] Higher alcohols are crucial for improving the aroma quality of white wine. Among them, phenethyl alcohol is an important type of higher alcohol, which can endow wine with floral and honey aromas. Compared with the single fermentation of Saccharomyces cerevisiae QA23, the content of phenethyl alcohol increased by 36.41% when Hanseniaspora uvarum HV-26 and commercial Saccharomyces cerevisiae QA23 were inoculated simultaneously.

[0101] In addition, mixed fermentation of vineyard spore-forming Hansen yeast HV-26 and commercial brewer's yeast QA23 significantly reduced the concentration of volatile acids with bad flavors, and the total amount of volatile acids in delayed inoculation and simultaneous inoculation decreased by 28.81% and 17.68%, respectively.

[0102] Isoamyl acetate, phenylethyl acetate, etc. are the characteristic aromas of Guirenxiang wine. The mixed fermentation with the participation of Hansen's yeast HV-26 in the vineyard can significantly increase these aroma substances, giving the wine a richer floral and fruity aroma. In summary, the mixed fermentation of HV-26 and QA23 significantly improved the aroma composition of Guirenxiang wine, enhanced the floral and fruity aroma of the wine, and reduced odors such as green. For the terpenes that contribute to the characteristic aroma of Guirenxiang wine, the mixed fermentation of Hansen's yeast HV-26 in the vineyard and the commercial brewing yeast QA23 has little effect on their content. In the future, the content of terpenes can be increased by combining with high-yield β-glucosidase strains for mixed fermentation, thereby achieving complementary aroma characteristics.

[0103] In summary, the mixed fermentation of vineyard Hansenula HV-26 and commercial brewer's yeast QA23 can enhance the aroma of ester substances in Guirenxiang wine, reduce the production of volatile acids, and improve the aroma complexity of the product. In practical applications, it can be combined with commercial brewer's yeast to improve the aroma of white wine.

[0104] Sensory evaluation of Guirenxiang wine fermented by two inoculation methods of Hansenula spores HV-26 and commercial Saccharomyces cerevisiae QA23 Figure 3-2 It can be seen that the overall aroma intensity of the wine after simultaneous inoculation is better than that of commercial brewing yeast fermentation alone, adding aromas such as pineapple, apple, pear, rose, passion fruit, and citrus, making the overall aroma more intense and richer in layers, covering up the unpleasant odors produced during the wine fermentation process.

[0105] In summary, the vineyard spore-forming Hansenula HV-26 has good fermentation potential and excellent ester aroma production ability. It can significantly increase the ester content in Guirenxiang wine and can be used as a potential strain for mixed fermentation with brewer's yeast to improve the aroma quality of white wine.

[0106] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A vineyard spore Hanseniaspora (Hanseniaspora vineae) HV-26, deposited in the General Microbiological Center of China Microorganism Culture Collection Administration, with a deposit date of January 14, 2025 and a deposit number of CGMCC No.33403.

2. The vineyard spore-forming Hansen yeast HV-26 according to claim 1, characterized in that: The vineyard Hansen yeast HV-26 can maintain a certain growth activity in an environment with an alcohol content (% v / v) of 24%; The vineyard Hansen yeast HV-26 can grow in an environment with a high sulfur dioxide concentration of more than 200 mg / L; The vineyard spore Hansen yeast HV-26 has a lower H2S production; The β-glucosidase activity of the Hansenula sporangiophora HV-26 is comparable to that of Saccharomyces cerevisiae D254.

3. Use of the vineyard spore-forming Hansenula HV-26 according to claim 1 or 2 in improving the aroma quality of white wine.

4. The use according to claim 3, characterized in that: The wine is Guirenxiang wine.

5. The use according to claim 4, characterized in that: The mixed inoculation and fermentation of vineyard spore Hansenula HV-26 and cerevisiae yeast was adopted; the inoculation methods include delayed inoculation and simultaneous inoculation, delayed inoculation means first inoculating vineyard spore Hansenula HV-26, and then inoculating cerevisiae yeast QA23 2 days later; simultaneous inoculation means inoculating vineyard spore Hansenula HV-26 and cerevisiae yeast QA23 at the same time; The application can change the aroma composition of wine and improve the aroma of wine.

6. The use according to claim 5, characterized in that: The vineyard Hansenula sporangiophora HV-26 can increase the content of ester aroma substances in Guirenxiang wine; in the application, the vineyard Hansenula sporangiophora HV-26 enhances and improves the aroma of Guirenxiang wine by increasing the content of acetate and ethyl ester substances and reducing the production of volatile acids.

Images