MFS gene mutant, recombinant vector, recombinant bacterium and application of MFS gene mutant

Abstract

The invention provides an MFS gene mutant, a recombinant vector, a recombinant bacterium and application of the MFS gene mutant, and belongs to the technical field of bioengineering. According to the MFS gene mutant disclosed by the invention, site mutation is carried out on an MFS gene, nucleotide A at the 686th site of a nucleotide molecule is mutated into C, and a nucleotide sequence is shown as SEQ ID NO.1 after site-specific mutagenesis. According to the present invention, the recombinant bacterium for expressing the mutant MFSA686C gene is constructed through homologous recombination, and the recombinant bacterium containing the MFS gene mutant can significantly improve the yield of L-arginine.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering, and particularly relates to a MFS gene mutant, recombinant vector, recombinant bacterium and their applications. Background Art

[0002] L-arginine is a conditionally essential amino acid, but for birds, carnivores and young mammals with insufficient ability to synthesize L-arginine by themselves, arginine is an essential amino acid. L-arginine is widely involved in cell metabolism and is closely related to body functions, such as hormone secretion, circulation regulation, immune regulation, wound healing and intestinal mucosal barrier maintenance.

[0003] The main production methods of L-arginine are hydrolysis method and microbial fermentation method. The hydrolysis method is to hydrolyze some animal protein raw materials rich in L-arginine, such as hair, animal blood and pigskin, with acid (usually hydrochloric acid) and then separate and purify to obtain L-arginine. However, this method requires the use of a large amount of hydrochloric acid and has serious pollution hazards. The microbial fermentation method is the main method for the production of L-arginine at present, which can be divided into direct fermentation and fermentation with added precursors. Both methods use microorganisms to convert common cheap industrial raw materials into target products. Compared with the hydrolysis method, the microbial fermentation method not only has a relatively simple production process and less environmental impact, but also the separation and purification of fermentation products are easier than those of the hydrolysis method. However, for the production of L-arginine by fermentation, due to the low acid production level of strains and unstable fermentation performance, it is still a key research project. The major facilitator superfamily ( MFS ) is the largest known secondary active transporter superfamily. MFS There is no relevant report on the application of gene mutation in improving the fermentation production of L-arginine. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a MFS gene mutant, recombinant vector, recombinant bacterium and their applications, and the strain containing the MFS gene mutant can significantly increase the yield of L-arginine.

[0005] To solve the above technical problems, the present invention provides the following technical solutions: The present invention provides a MFS gene mutant, and the nucleotide sequence of the MFS gene mutant is shown in SEQ ID NO.1. Compared with the gene with the nucleotide sequence of SEQ ID NO.2, the MFS A at the 686th position of the MFS gene mutant mutates to C.

[0006] The present invention provides the one obtained from the MFSThe protein encoded by the gene mutant has an amino acid sequence as shown in SEQ ID NO.13.

[0007] The present invention provides a recombinant vector, wherein the recombinant vector contains MFS Gene mutants.

[0008] Preferably, the preparation of the recombinant vector comprises the following steps: using the recombinant plasmid PK18mobsacB- MFS For template amplification, mutation sites were introduced to obtain the recombinant vector PK18mobsacB- MFS A686C .

[0009] Preferably, the primers used to introduce the mutation site are MFS A686C -F and MFS A686C -R, the nucleotide sequences are shown in SEQ ID NO.11 and SEQ ID NO.12 respectively.

[0010] The present invention provides a recombinant bacterium, wherein the recombinant bacterium contains MFS Gene mutant or the recombinant vector.

[0011] Preferably, the starting strain of the recombinant bacteria includes Corynebacterium glutamicum.

[0012] Preferably, the Corynebacterium glutamicum includes Corynebacterium glutamicum ATCC 13032 or Corynebacterium glutamicum CICC 23604.

[0013] The present invention provides the MFS Application of the gene mutant, the protein, the recombinant vector or the recombinant bacteria in increasing the yield of L-arginine.

[0014] The present invention also provides a method for producing L-arginine by fermentation, comprising the following steps: fermenting the recombinant bacteria, collecting the fermentation liquid, and obtaining L-arginine.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention is MFS The gene was subjected to site mutation, and the base A at position 686 in the nucleotide sequence was mutated to C. The nucleotide sequence obtained by site-directed mutagenesis was as shown in SEQ ID NO.1 MFS Gene mutants. The present invention constructs expression MFS The engineered strain of Corynebacterium glutamicum with gene mutations has been verified by experiments to contain MFSThe engineered Corynebacterium glutamicum with gene mutations can significantly increase the yield of L-arginine, save fermentation time and cost, and reduce the probability of contamination. Description of the Drawings

[0016] Figure 1 It is the agarose gel electrophoresis pattern of positive bacteria. Among them, M is the 5000bp Marker, and 1 is MFS the gene amplification fragment.

[0017] Figure 2 It is the verification map of positive clone sequencing. Detailed Implementation Modes

[0018] The present invention provides a MFS gene mutant, and the MFS nucleotide sequence of the gene mutant is shown as SEQ ID NO.1. Compared with the gene with the nucleotide sequence of SEQ ID NO.2, the MFS A at the 686th position of the gene mutant mutates to C. The protein encoded by the gene mutant of the present invention has an amino acid sequence shown as SEQ ID NO.13. MFS The MFS gene mutant

[0019] The present invention also provides a recombinant vector, and the recombinant vector contains the MFS gene mutant. The preparation of the recombinant vector of the present invention includes the following steps: amplifying with the recombinant plasmid PK18mobsacB- MFS as a template, introducing mutation sites, and obtaining the recombinant vector PK18mobsacB- MFS A686C . The primers used for introducing mutation sites in the present invention are MFS A686C -F and MFS A686C -R, and the nucleotide sequences are shown as SEQ ID NO.11 and SEQ ID NO.12 in sequence.

[0020] In the present invention, the recombinant plasmid PK18mobsacB- MFS is obtained by connecting the MFS gene fragment with the upstream homologous fragment and the downstream homologous fragment through a seamless cloning kit and inserting them into the linearized vector. The MFS gene fragment is obtained by PCR amplification using the genomic DNA of Corynebacterium glutamicum as a template and MFS -F, MFS -R as primers; the MFS -F and MFSThe nucleotide sequence of -R is shown in SEQ ID NO.9 and SEQ ID NO.10. The upstream homologous fragment of the present invention is obtained by PCR amplification using the genomic DNA of Corynebacterium glutamicum as a template and UP-F and UP-R as primers; the nucleotide sequences of UP-F and UP-R are shown in SEQ ID NO.5 and SEQ ID NO.6. The downstream homologous fragment of the present invention is obtained by PCR amplification using the genomic DNA of Corynebacterium glutamicum as a template and DOWN-F and DOWN-R as primers; the nucleotide sequences of DOWN-F and DOWN-R are shown in SEQ ID NO.7 and SEQ ID NO.8. The linearized vector of the present invention is PK18mobsacB.

[0021] The present invention also provides a recombinant bacterium, which contains the MFS gene mutant or the recombinant vector. The starting strain of the recombinant bacterium of the present invention includes Corynebacterium glutamicum. The Corynebacterium glutamicum of the present invention preferably includes Corynebacterium glutamicum ATCC 13032 or Corynebacterium glutamicum CICC 23604. The present invention transforms the recombinant vector PK18mobsacB- MFS A686C into the original Corynebacterium glutamicum by electroporation and cultures it, and positively screens out the engineered Corynebacterium glutamicum C.glu - MFS A686C .

[0022] The present invention also provides the application of the MFS gene mutant or the protein or the recombinant vector or the recombinant strain in increasing the yield of L-arginine.

[0023] The present invention also provides a method for fermentatively producing L-arginine, which includes the following steps: fermenting the recombinant bacterium and collecting the fermentation broth to obtain L-arginine.

[0024] In the present invention, unless otherwise specified, all components or reagents or culture media are commercially available products well-known to those skilled in the art.

[0025] Next, the technical solutions in the present invention will be clearly and completely described in conjunction with the examples in the present invention. Obviously, the described examples are only a part of the examples of the present invention, rather than all the examples. All other examples obtained by those of ordinary skill in the art based on the examples in the present invention without creative efforts shall fall within the protection scope of the present invention.

[0026] The Corynebacterium glutamicum used in the examples of the present invention ( Corynebacterium glutamicum), sourced from the American Type Culture Collection with the strain number ATCC 13032; Corynebacterium glutamicum ( Corynebacterium glutamicum ), sourced from the China Center for Industrial Culture Collection with the strain number CICC 23604.

[0027] Example 1 Construction of Engineered Corynebacterium glutamicum C.glu - MFS A686C Construction 1. Amplification of upstream homologous arm UP: Using the genomic DNA of Corynebacterium glutamicum as a template, and UP-F and UP-R as primers, perform PCR amplification to obtain the upstream homologous arm UP nucleotide sequence as shown in SEQ ID NO.3. The nucleotide sequences of the PCR amplification primers are: UP-F: CTATGACATGATTACGAATTCAATTCCTCCTCGATGGAAACCA (SEQ ID NO.5); UP-R: GGCATGTTGGAAATTTCCGGTAAGTGTCCTTAATCTTGAGAGAAAACG (SEQ ID NO.6). The reaction system for PCR amplification is: The total system is 50 μL: 2×Phanta Max Master Mix 25 μL, UP-F (10 μmol / L) 2 μL, UP-R (10 μmol / L) 2 μL, template 2 μL, ddH 2 O 19 μL; The PCR amplification program is: Pre-denaturation at 95°C for 3 min; Denaturation at 95°C for 15 sec, annealing at 56°C for 15 sec, extension at 72°C for 30 sec, for 32 cycles; Extension at 72°C for 5 min, store at 4°C.

[0028] 2. Amplification of downstream homologous arm DOWN: Using the genomic DNA of Corynebacterium glutamicum as a template, and DOWN-F and DOWN-R as primers, perform PCR amplification to obtain the downstream homologous arm DOWN nucleotide sequence as shown in SEQ ID NO.4. The nucleotide sequences of the PCR amplification primers are: DOWN-F: CATCGAGGAGGAATTCGGAAATTTCCAACATGCCT (SEQ ID NO.7), DOWN-R: TCACTCGACGACGCAGCGATGT (SEQ ID NO.8). Except for the different primers, the PCR amplification system and amplification program are the same as in step 1.

[0029] 3. MFS Obtaining of gene fragment: Using the genomic DNA of Corynebacterium glutamicum as a template, MFS -F and MFS -R as primers, perform PCR amplification to obtain MFSGene fragment, the nucleotide sequences of the PCR amplification primers are as follows: MFS -F: ATCGCTGCGTCGTCGAGTGACCCCACCCGCTCGC (SEQ ID NO.9), MFS -R: CTTGCATGCCTGCAGGTCGACTCACAGTTGGACCACCTTGTATAAG (SEQ ID NO.10). Except for the different primers, the PCR amplification system and amplification program are the same as those in step 1.

[0030] 4. Recombinant plasmid PK18mobsacB- MFS Construction Connect the gene fragment with the upstream homologous arm UP and the downstream homologous arm DOWN through a seamless cloning kit and insert them into the linearized vector to obtain the recombinant plasmid PK18mobsacB- MFS MFS

[0031] Among them, the multi-fragment seamless cloning system is as follows: the total system is 10 μL: 2 μL of linearized vector PK18mobsacB (Miaoling Biology), 1 μL of upstream homologous arm UP, 1 μL of downstream homologous arm DOWN, MFS 1 μL of gene fragment and 5 μL of 2×ClonExpress Mix; the multi-fragment seamless cloning program is: multi-fragment recombination reaction, 50 °C, 15 min; cool to 4 °C or immediately place on ice.

[0032] 5. Obtaining of the recombinant vector PK18mobsacB- MFS A686C Mutation primer design: Using PK18mobsacB- MFS as the starting vector, according to the principle of inverse overlapping extension PCR, introduce mutation sites through a one-step method, and design a pair of mutation primers MFS A686C -F and MFS A686C -R, where the lowercase letter part in the primer is the mutation site, corresponding to the 686th DNA sequence. The primers are as follows: MFS A686C -F: AGCTAGTCACCGCTCTTCGTGATGGCGTGGAG (SEQ ID NO.11), MFS A686C -R: AAGAGCGGTGACTAGCTTATTGGTTGCTTCACC (SEQ ID NO.12).

[0033] PCR amplification: Using the recombinant plasmid PK18mobsacB- constructed in step 4 MFS ​​​For the mutant site primers of the template and design, PCR amplification was carried out. The reaction system for PCR amplification was as follows: The total system was 50 μL: 2×Phanta Max Master Mix 25 μL, MFS A686C -F (10 μmol / L) 2 μL, MFS A686C -R (10 μmol / L) 2 μL, template 2 μL, dNTP Mix (10 mM) 1 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, and ddH 2 O 17 μL; The PCR amplification program was: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 sec, annealing at 56 °C for 15 sec, extension at 72 °C for 3 min, for 32 cycles; extension at 72 °C for 5 min, and preservation at 4 °C.

[0034] The amplified product was digested with Dpn I: The system was 50 μL of the amplified product and 1 μL of Dpn I. After gently pipetting and mixing, it was placed in a constant temperature reaction at 37 °C for 1 - 2 h. The amplified product was digested with Dpn I to remove the methylated template plasmid.

[0035] Recombination reaction: The amplified product after Dpn I digestion can efficiently recombine the site to be mutated under the catalysis of Exnase II, realizing the in vitro circularization of PK18mobsacB- MFS A686C The operation was carried out on ice. The specific steps were as follows: The recombination reaction system was: The total system was 20 μL: 200 ng of the Dpn I digestion product, 4 μL of 5×CE II Buffer, 2 μL of Exnase II, and ddH 2 O 14 μL. Use a pipette to gently pipette and mix, and briefly centrifuge to collect the reaction solution to the bottom of the tube. After a 30-min water bath at 37 °C; immediately place it on ice to cool.

[0036] 6. Recombinant product PK18mobsacB- MFS A686C Transformation: Thaw the cloned DH5α competent cells on ice, and take 10 μL of the recombinant product PK18mobsacB- MFS A686CAdd it to 100 μL of DH5α competent cells, flick the tube wall gently to mix (do not mix by shaking), and let it stand on ice for 30 min. After heat shock in a 42 °C water bath for 45 sec, immediately place it on ice to cool for 2 - 3 min. Add 900 μL of LB liquid medium, shake the bacteria at 37 °C for 1 h at a rotation speed of 220 rpm. Preheat the LB solid medium plate in a 37 °C incubator, centrifuge at 5000 rpm for 5 min, and discard 900 μL of the supernatant. Resuspend the bacterial cells with the remaining medium, and spread them on the LB solid medium plate preheated in a 37 °C incubator using a sterile spreading rod. Incubate it upside down in a 37 °C incubator for 12 - 16 h.

[0037] 7. Extract the recombinant vector PK18mobsacB - MFS A686C : Perform plasmid extraction of PK18mobsacB - MFS A686C from the positive colonies grown after transformation and plating of the recombinant product in step 6, and operate using the Novoprotein plasmid extraction kit.

[0038] 8. Obtain the Corynebacterium glutamicum engineered strain C.gLu - MFS A686C of (1) Preparation and transformation of competent cells (i) Pick a single colony of Corynebacterium glutamicum, culture it in the seed medium until the cell concentration OD 600 is 0.7 - 0.9, place it on ice to cool, centrifuge after cooling, wash the bacterial cells 3 - 5 times with pre - cooled electroporation buffer, and resuspend the bacterial cells with the electroporation buffer to obtain competent cells; (ii) Transform the recombinant vector PK18mobsacB - MFS A686C extracted in step 7 into the competent cells prepared in step (i) by high - voltage electroporation at 2200 V for 5 ms, and spread it on the kanamycin - resistant seed medium plate, and culture it at 28 - 32 °C for 12 - 16 h.

[0039] Among them, the seed medium contains, per liter: 8 - 12 g of peptone, 4 - 6 g of yeast powder, 8 - 12 g of sodium chloride, 4 - 6 g of glucose, and the balance of water. The electroporation buffer contains, per liter: 85 - 96 g of sorbitol, 85 - 96 g of mannitol, 95 - 105 mL of glycerol, and the balance of water.

[0040] (2) Screening of positive bacteria The single colonies growing on the kanamycin - resistant plate in step (1) are the strains that have undergone the first homologous recombination. Pick a single colony growing on the kanamycin - resistant plate and culture it in the seed liquid medium for 1 d, then spread it on the LB solid medium plate containing 10% sucrose. The single colonies that grow are the strains that have undergone the second homologous recombination.

[0041] Pick a single colony that grows only on an LB solid medium plate containing 10% sucrose (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 10 g / L sucrose, 2 g / L agar powder, and the balance water). Extract the DNA of this colony as a template, and perform PCR amplification using UP-F (SEQ ID NO.5) and DOWN-R (SEQ ID NO.8) as primers. The amplified product is verified by agarose gel electrophoresis. The PCR amplification system is 20 μL, including 10 μL of 2×Phanta Max Master Mix, 1 μL of UP-F (10 μmol / L), 1 μL of DOWN-R (10 μmol / L), 1 μL of template, and 7 μL of ddH 2 O. The PCR amplification program is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 56°C for 15 sec, extension at 72°C for 1 min, for 32 cycles; extension at 72°C for 5 min, and preservation at 4°C.

[0042] The PCR product was examined by agarose gel electrophoresis. The results showed that a specific gene band could be amplified using the primers UP-F and DOWN-R, which was close to the theoretical value of 1776 bp. Then sequencing was performed, and the result showed that the sequence was correct, indicating MFS the gene replacement was successful, and the Corynebacterium glutamicum engineered strain was obtained C.glu - MFS A686C .

[0043] Example 2 The difference from Example 1 is that Corynebacterium glutamicum is defined as Corynebacterium glutamicum ATCC 13032, and the obtained engineered strain is C . glu- ATCC-13032- MFS A686C . The PCR product of the positive bacterium was examined by agarose gel electrophoresis. The results showed that a specific gene band could be amplified using the primers UP-F and DOWN-R, with a size of approximately 1700 bp, as shown in Figure 1 , which was close to the theoretical value of 1776 bp. Then sequencing was performed, as shown in Figure 2 , and the sequence was correct, indicating MFS the gene replacement was successful, and the Corynebacterium glutamicum engineered strain was obtained C . glu- ATCC-13032- MFS A686C .

[0044] Example 3 The difference from Example 1 is that Corynebacterium glutamicum is defined as Corynebacterium glutamicum CICC 23604, and the obtained engineered strain isC . glu- CICC-23604- MFS A686C 。

[0045] Example 4 L-arginine fermentation experiment The Corynebacterium glutamicum engineered strains prepared in Example 2 and Example 3 and their corresponding original strains were respectively inoculated into 100 mL of LBG medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 5 g / L glucose and the balance water), and seed cultured at 30 °C with 220 rpm for 16 h. Then, they were respectively inoculated into 100 mL of fermentation medium (20 g / L glucose, (NH 4 ) 2 SO 4 20 g / L, 5 g / L urea, 2 g / L KH 2 PO 4 2 g / L, 1.35 g / L MgSO 4 ·7H 2 O, 0.02 g / L FeSO 4 ·7H 2 O, 0.04 g / L MnSO 4 ·H 2 O, 0.008 g / L nicotinamide, 0.001 g / L biotin and the balance water) for fermentation culture for 50 h. Samples of the fermentation broth were taken, and immediately centrifuged at 12,000 rpm for 2 min after sampling. The supernatant of the centrifuged bacterial liquid was taken, and the content of L-arginine in the fermentation broth was determined by Agilent high performance liquid chromatography. The average value was taken from three fermentation measurements, and the calculation results of the content of L-arginine are shown in Table 1.

[0046] Table 1 Yields of L-arginine produced by Corynebacterium glutamicum engineered strains and original strains

[0047] The results showed that compared with the original strains, at 48 h of fermentation, the content of L-arginine in the fermentation broth of the Corynebacterium glutamicum engineered strains C . glu- ATCC-13032- MFS A686C and C . glu -CICC-23604- MFS A686C reached 2.35 g / L and 2.14 g / L respectively, while the content of L-arginine in the fermentation broth of the original strains at 48 h was 1.02 g / L and 0.99 g / L respectively. The Corynebacterium glutamicum engineered strains C . glu-ATCC-13032- MFS A686C and C . glu -CICC-23604- MFS A686C The L-arginine fermentation yields of these strains were increased by 56.6±0.2% and 53.7±0.2% respectively compared with the original strain. Moreover, compared with the original strain, the L-arginine yields of the two engineered strains reached 1.56 and 1.48 g / L at 24 h, and the fermentation time was saved by about 12 h. This indicates that MFS The gene mutant replaces Corynebacterium glutamicum MFS After the gene, the L-arginine fermentation acid production level of Corynebacterium glutamicum can be improved.

[0048] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A MFS A gene mutant, characterized in that Said MFS The nucleotide sequence of the gene mutant is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.

2. MFS Compared with the MFS The A at position 686 of the gene mutant mutated to C.

2. According to claim 1 MFS The protein encoded by the gene mutant is characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

13.

3. A recombinant vector, characterized in that: The recombinant vector contains the MFS Gene mutants.

4. The recombinant vector according to claim 3, characterized in that The preparation of the recombinant vector comprises the following steps: using the recombinant plasmid PK18mobsacB- MFS For template amplification, mutation sites were introduced to obtain the recombinant vector PK18mobsacB- MFS A686C .

5. The recombinant vector according to claim 4, characterized in that The primers used to introduce the mutation site are MFS A686C -F and MFS A686C -R, the nucleotide sequences are shown in SEQ ID NO.11 and SEQ ID NO.12 respectively.

6. A recombinant bacterium, characterized in that: The recombinant bacteria contains the MFS A gene mutant or a recombinant vector according to any one of claims 3 to 5.

7. The recombinant bacterium according to claim 6, characterized in that The starting strain of the recombinant bacteria includes Corynebacterium glutamicum.

8. The recombinant bacterium according to claim 7, characterized in that The Corynebacterium glutamicum includes Corynebacterium glutamicum ATCC 13032 or Corynebacterium glutamicum CICC 23604.

9. As claimed in claim 1 MFS Use of the gene mutant or the protein according to claim 2 or the recombinant vector according to any one of claims 3 to 5 or the recombinant bacteria according to any one of claims 6 to 8 in increasing the production of L-arginine.

10. A method for producing L-arginine by fermentation, characterized in that: The method comprises the following steps: fermenting the recombinant bacteria according to any one of claims 6 to 8, collecting the fermentation liquid, and obtaining L-arginine.

Images