Use of gamma-tocotrienols in treatment of non-alcoholic steatohepatitis and / or hepatic fibrosis

Abstract

The invention relates to application of gamma-tocotrienol in treatment of non-alcoholic fatty liver disease and / or hepatic fibrosis, in particular to the application of the gamma-tocotrienol in the treatment of the non-alcoholic fatty liver disease and / or hepatic fibrosis, specifically, the gamma-tocotrienol can remarkably relieve hepatic lipid accumulation and inflammation of non-alcoholic steatohepatitis (NASH) caused by high fat diet and can effectively inhibit carbon tetrachloride induced hepatic fibrosis.

Description

Technical Field

[0001] The present invention belongs to the field of pharmaceutical technology, and particularly relates to the use of γ-tocotrienol in the treatment of non-alcoholic steatohepatitis and / or liver fibrosis. Background Art

[0002] Liver fibrosis is a pathological process in which abnormal proliferation of connective tissue in the liver is caused by various chronic stimuli, leading to excessive deposition of extracellular matrix diffusely in the liver. Common diseases causing liver fibrosis include viral hepatitis, alcoholic liver disease, non-alcoholic steatohepatitis, cholestasis, etc. If not actively intervened, it can develop into cirrhosis and liver cancer. Currently, the main treatment methods for liver fibrosis are mainly for the primary disease and anti-fibrosis. Non-alcoholic steatohepatitis, also known as metabolic steatohepatitis, is a clinical syndrome with pathological changes similar to alcoholic hepatitis but without a history of excessive alcohol consumption. It is closely related to metabolic disorders such as obesity, insulin resistance, type 2 diabetes, hyperlipidemia, etc. Its main feature is macrovesicular steatosis of hepatocytes accompanied by hepatocyte injury and inflammation. In severe cases, it can develop into cirrhosis, and there is no special treatment measure. Long-term exposure to some chemical toxins such as carbon tetrachloride can also cause liver damage and then lead to liver fibrosis. Liver fibrosis is progressive and has a certain degree of reversibility. With treatment and intervention at an appropriate stage, the process of liver fibrosis can be effectively prevented or even reversed. The present invention uses two models of liver fibrosis induced by NASH and carbon tetrachloride to study the use of the natural product γ-tocotrienol in the treatment of liver fibrosis, in order to find new potential drugs for the treatment of liver fibrosis. Summary of the Invention

[0003] The present invention first relates to the application of γ-tocotrienol in the preparation of drugs for preventing and / or treating non-alcoholic steatohepatitis and / or liver fibrosis.

[0004] The chemical structural formula of the said γ-tocotrienol is:

[0005]

[0006] Furthermore, the dosage form of the said drug is an oral preparation, an injection, an inhalant or a topical preparation.

[0007] The beneficial effects of the present invention are as follows:

[0008] (1) γ-Tocotrienol significantly reduces hepatic lipid accumulation and inflammation in non-alcoholic steatohepatitis (NASH), and effectively inhibits carbon tetrachloride-induced liver fibrosis, showing strong anti-inflammatory and anti-fibrotic abilities.

[0009] (2) As a potential candidate drug for the treatment of NASH, γ-tocotrienol is expected to significantly reduce the risk of disease progression and bring new hope to NASH patients. Description of the Drawings

[0010] Figure 1 、γ-Tocotrienol treatment alleviates liver fibrosis in mice with non-alcoholic steatohepatitis. (A) Sirius red staining of the liver; (B) Statistical analysis of the fibrotic area by Sirius red staining; (C) and (D) mRNA levels of Col1a1 and Col3a1. Data were analyzed as mean ± SD, n = 6; *, P < 0.05.

[0011] Figure 2 、γ-Tocotrienol treatment alleviates carbon tetrachloride-induced liver fibrosis in mice. (A) Sirius red staining of the liver; (B) Statistical analysis of the fibrotic area by Sirius red staining; (C) and (D) mRNA levels of Col1a1 and Col3a1. Data were analyzed as mean ± SD, n = 6; *, P < 0.05; **, P < 0.01. Specific implementation manners

[0012] Experimental animals and methods

[0013] 8-week-old mice were purchased from Beijing Weishang Lide Biotechnology Co., Ltd. The experimental mice were housed in an spf-class environment with clean diet, appropriate temperature and humidity. All mice were maintained under specific pathogen-free conditions at the Beijing Institute of Heart, Lung and Blood Vessel Diseases and given free food and water. This experiment was approved by the Ethics Committee of Beijing Anzhen Hospital, Capital Medical University.

[0014] Sirius red staining: After collecting the mouse liver, paraffin sections were prepared. The sections were dewaxed to water, washed twice with PBS, stained with Sirius red by dropping for 30 minutes, differentiated with absolute ethanol, permeabilized with xylene, and sealed with neutral gum. Observation was performed under a microscope.

[0015] QPCR experiment: After collecting the mouse liver tissue, RNA was extracted, and reverse transcribed into cDNA using the Thermo Scientific TM RevertAid First Strand cDNA Synthesis Kit. Then, qPCR was performed to detect the mRNA expression levels of fibrosis-related genes: type I collagen a1 (collagen type Ⅰ alpha1, Col1a1) and type III collagen a1 (collagen type Ⅰ alpha3, Col3a1) genes.

[0016] Primer sequences:

[0017] Col1a1 upstream primer sequence: 5′-GCTCCTCTTAGGGGCCACT-3′, (SEQ ID NO.1)

[0018] Col1a1 downstream primer sequence: 5′-CCACGTCTCACCATTGGGG-3′; (SEQ ID NO.2)

[0019] Col3a1 upstream primer sequence: CTGTAACATGGAAACTGGGGAAA, (SEQ ID NO.3)

[0020] Col3a1 downstream primer sequence: CCATAGCTGAACTGAAAACCACC; (SEQ ID NO.4)

[0021] GAPDH upstream primer sequence: 5′-AGGTCGGTGTGAACGGATTTG-3′, (SEQ ID NO.5)

[0022] GAPDH downstream primer sequence: 5′-TGTAGACCATGTAGTTGAGGTCA-3′. (SEQ ID NO.6)

[0023] The primers were synthesized by Beijing Nuocai Gene Co., Ltd. The PCR reaction conditions were as follows:

[0024] Pre-denaturation at 95°C for 3 min;

[0025] 15 s at 95°C and 45 s at 60°C for a total of 45 cycles.

[0026] Using GAPDH as an internal reference, the gene expression level was calculated by the 2-ΔΔCt method.

[0027] Example 1, Establishment of liver fibrosis model in non-alcoholic steatohepatitis mice and treatment with γ-tocotrienol

[0028] Establishment of liver fibrosis model in non-alcoholic steatohepatitis mice: 8-week-old male C57BL / 6J mice were fed a choline-deficient, L-amino acid-defined high-fat diet (CDA-HFD, product number: A06071302i, Research Diets) for 7 weeks. The control group was fed a normal diet.

[0029] After 4 weeks of feeding with the choline-deficient, L-amino acid-defined high-fat diet, the mice began to receive treatment with 10 mg / kg of γ-tocotrienol or an equal volume of negative control (PBS), once every 3 days, by intraperitoneal injection, for a total of 3 weeks. There were 4 mice in the model control group, 5 mice in the PBS control group, and 6 mice in the γ-tocotrienol treatment group.

[0030] After 7 weeks of high-fat diet, the livers were harvested for qRT-PCR analysis, Sirius red staining, and immunohistochemical staining. The results were as Figure 1 shown

[0031] (1) A high-fat diet induced non-alcoholic steatohepatitis in mice.

[0032] (2) Mice treated with γ-tocotrienol were able to return to normal.

[0033] (3) After treatment with γ-tocotrienol, the proportion of Sirius red staining positive (red) in the liver tissue stroma and the expression levels of collagen-related genes Col1a1 and Col3a1 were significantly better than those in the control group given only PBS.

[0034] Example 2: Establishment of a carbon tetrachloride-induced liver fibrosis model in mice and treatment with γ-tocotrienol

[0035] Establishment of a carbon tetrachloride-induced liver fibrosis model in mice: C57BL / 6J mice (male, 10 - 12 weeks old) were given 200 μL of 10% CCl4 (CCl4∶olive oil = 1∶9) by intraperitoneal injection, twice a week for 4 weeks to establish a liver fibrosis model. The control group was given 200 μL of olive oil in the same dosing manner.

[0036] After the successful establishment of the carbon tetrachloride-induced liver fibrosis model in mice, they began to receive treatment with 10 mg / kg of γ-tocotrienol or an equal volume of negative control (PBS), twice a week by intraperitoneal injection for a total of 4 weeks. There were 4 mice in the model control group, 4 mice in the PBS control group, and 4 mice in the γ-tocotrienol treatment group.

[0037] After the administration ended, the livers were collected for qRT-PCR analysis, Sirius red staining, and immunohistochemical staining. The results are as Figure 2 shown.

[0038] (1) Carbon tetrachloride CCl 4 induced liver fibrosis in mice.

[0039] (2) Mice treated with γ-tocotrienol were able to basically return to normal.

[0040] (3) After treatment with γ-tocotrienol, the proportion of Sirius red staining positive (red) in the liver tissue stroma and the expression levels of collagen-related genes Col1a1 and Col3a1 were significantly better than those in the control group given only PBS;

[0041] Finally, it should be noted that the above examples are only used to help those skilled in the art understand the essence of the present invention and are not used to limit the protection scope of the present invention.

Claims

1. Use of γ-tocotrienol in the preparation of a drug for preventing and / or treating non-alcoholic steatohepatitis and / or liver fibrosis; the chemical structural formula of the γ-tocotrienol is:

2. The use according to claim 1, characterized in that: The dosage form of the drug is oral preparation, injection, inhalation or external preparation.

Images