Fluorescent / photo-thermal dual-mode sensor constructed on basis of entropy-driven DNA molecular machine and construction method and application of fluorescent / photo-thermal dual-mode sensor

Abstract

The invention provides a fluorescent / photo-thermal dual-mode sensor constructed based on an entropy-driven DNA molecular machine as well as a construction method and application of the fluorescent / photo-thermal dual-mode sensor, and belongs to the technical field of sensor construction and analytical testing. The fluorescent / photo-thermal dual-mode sensor is constructed on the basis of Ag (at) Au NPRs with good photo-thermal performance, CdTe QDs with strong fluorescence signals, a Fe3O4 (at) SiO2 nano material with superparamagnetism and an entropy-driven DNA molecular machine signal amplification strategy capable of being specifically combined with miRNA; the fluorescence detection range of the fluorescence / photo-thermal dual-mode sensor is 1 fM to 50 pM, the detection limit is 0.34 fM, the photo-thermal detection range is 1 pM to 1 nM, and the detection limit is 0.5 pM; the fluorescent / photo-thermal dual-mode sensor is simple in construction method, convenient and rapid in detection and high in selectivity, has very good practicability and has very good application in miRNA detection.

Description

Technical Field

[0001] The present invention belongs to the technical field of sensor construction and analytical testing, and particularly relates to a fluorescence / photothermal dual-mode sensor constructed based on an entropy-driven DNA molecular machine, and a construction method and application thereof. Background Art

[0002] DNA is the carrier of genetic information. It is a biological macromolecule with a double helix structure, composed of nucleotides, storing all the genetic information required to guide the development, survival, and reproduction of living organisms, and existing in the cells of almost all organisms. MicroRNA (miRNA) is a small molecule RNA transcribed from DNA and is a non-coding RNA that plays an important role in human physiological processes. More and more studies have shown that the dysregulation of miRNA expression is closely related to the imbalance of the human circuit and can lead to the occurrence of cancer. miRNA shows low-abundance expression and highly homologous dynamic changes in the living cell fluid, so it is very important to improve the sensitivity of miRNA detection.

[0003] With the progress of science and technology and the rapid development of various disciplines, the detection methods of miRNA have been greatly enriched and developed, and the detection accuracy and reliability have also made a qualitative leap. The detection methods of miRNA mainly include colorimetry, electrochemistry, photoelectrochemistry, high-performance liquid chromatography, Raman spectroscopy, immunoassay, etc. Among them, the colorimetric measurement method is simple to operate, does not require expensive equipment, and combined with nanotechnology, can achieve high-sensitivity detection and wide applicability. However, it may be affected by background interference, has weak quantification ability, and is only suitable for qualitative or semi-quantitative detection; the electrochemical method is a technology for detecting miRNA based on electrochemical signal changes, often using nucleic acid probes, electrode modification materials, etc. to achieve high-sensitivity and specific detection. It has an extremely low detection limit and can detect low-abundance miRNA molecules (usually in the fM or lower range). Combining signal amplification techniques (such as nucleic acid amplification, nanomaterial modification) can further improve the sensitivity. However, this method has the disadvantages of complex electrode preparation and limited anti-interference ability; the photoelectrochemical method specifically binds nucleic acid probes to target miRNA, affects the electron transfer efficiency of the photoelectrochemical system, and thus regulates the photocurrent signal. It has outstanding advantages such as high sensitivity, low background noise, and fast response. However, due to the strong dependence on the preparation of photosensitive materials and equipment, there are still certain limitations; high-performance liquid chromatography (HPLC) has versatility, high resolution, and relatively high sensitivity. However, after sample extraction, it needs to be labeled or modified, which may increase the operation steps and error sources. In addition, the above methods still have some obstacles in practical applications, such as the need for professional personnel to operate, expensive instruments, time-consuming processes, or technical complexity.

[0004] Currently, there is no method for detecting miRNA based on dual-signal detection, and there is still a technical gap. Therefore, it is necessary to construct a simple, highly sensitive, and highly specific dual-signal sensor for detecting miRNA. Summary of the Invention

[0005] In view of some deficiencies in the prior art, the present invention provides a fluorescence / photothermal dual-mode sensor constructed based on an entropy-driven DNA molecular machine, its construction method and application; the present invention is based on Ag@AuNPRs with good photothermal performance, CdTe QDs with strong fluorescence signals, and Fe with superparamagnetic properties 3 O 4 @SiO 2 nanomaterials and an entropy-driven DNA molecular machine signal amplification strategy capable of specifically binding to miRNA to construct a fluorescence / photothermal dual-mode sensor; the fluorescence / photothermal dual-mode sensor detects the target at low concentrations through two response signals, which is beneficial to eliminating environmental impacts and uncontrollable factors, and effectively improves the reliability and accuracy of the detection results; the fluorescence detection range of the fluorescence / photothermal dual-mode sensor is 1 fM - 50 pM, and the detection limit is 0.34 fM, and the photothermal detection range is 1 pM - 1 nM, and the detection limit is 0.5 pM; the construction method of the fluorescence / photothermal dual-mode sensor is simple, the detection is convenient and fast, the selectivity is strong, and it has good practicability and has good application in the detection of miRNA.

[0006] In order to achieve the above technical objectives, the present invention adopts the following technical means:

[0007] The present invention first provides a fluorescence / photothermal dual-mode sensor constructed based on an entropy-driven DNA molecular machine. The fluorescence / photothermal dual-mode sensor includes a photothermal detection unit Ag@Au-ssDNA with entropy-driven DNA molecular machine signal amplification, a fluorescence detection unit with entropy-driven DNA molecular machine signal amplification, and a superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA;

[0008] The photothermal detection unit Ag@Au-ssDNA is assembled by Ag@Au NPRs with DNA strands S1 and S2 modified with mercapto groups respectively;

[0009] The fluorescence detection unit is assembled by Ag@Au-ssDNA and CdTe QDs-pDNA; the CdTe QDs-pDNA is assembled by nanosheet-like CdTe QDs and DNA strand P modified with amino groups;

[0010] The superparamagnetic unit Fe 3 O 4@SiO 2 -eDNA is assembled from amino-functionalized Fe with a spherical core-shell structure 3 O 4 @SiO 2 and DNA strand E modified with carboxyl groups.

[0011] Preferably, the Ag@Au NPRs have a triangular core-shell structure; the nucleotide sequence of the DNA strand S1 modified with thiol groups is SH-TTTTTACACCTACACGTCTACTGAGAAAGCTACATC (SEQ ID NO:1); the nucleotide sequence of S2 is AATTCTCAGTAGACGTGTATTTTTT-SH (SEQ ID NO:2);

[0012] The nucleotide sequence of the DNA strand P modified with amino groups is NH 2 -TTTTTTCAGTAGACGTGTAGGTGT (SEQID NO:3);

[0013] The nucleotide sequence of the DNA strand E modified with carboxyl groups is COOH-TTTTTTTTTTCCAGATGTAGCTTTCTCAGTAGA (SEQ ID NO:4)).

[0014] The present invention also provides a method for constructing the above fluorescence / photothermal dual-mode sensor, and the construction method includes:

[0015] (1) Construction of the photothermal detection unit Ag@Au-ssDNA with entropy-driven DNA molecular machine signal amplification:

[0016] Mix water, polyvinylpyrrolidone (PVP), ascorbic acid (AA), NaOH and Na 2 SO 3 Mix them, add the gold growth solution to it, stir and mix evenly to obtain a mixed solution, add the Ag NPRs (silver nanoplates) solution to the mixed solution, stir and mix evenly, and then let it stand overnight to obtain Ag@Au NPRs;

[0017] Assemble Ag@Au NPRs with the DNA strand S1 modified with thiol groups on the surface to obtain Ag@Au-S1;

[0018] Assemble Ag@Au NPRs with the DNA strand S2 modified with thiol groups on the surface to obtain Ag@Au-S2;

[0019] Mix Ag@Au-S1 and Ag@Au-S2 to obtain the photothermal detection unit Ag@Au-ssDNA;

[0020] (2) Superparamagnetic unit Fe3 O 4 @SiO 2 Construction of -eDNA:

[0021] Mix Fe 3 O 4 @SiO 2 with ethanol and 3-aminopropyltriethoxysilane (APTES) by vigorous stirring until homogeneous to obtain a mixture, and carry out Reaction 1. After the reaction, centrifuge and wash to obtain amino-functionalized Fe 3 O 4 @SiO 2 , denoted as Fe 3 O 4 @SiO 2 -NH 2 ; Disperse Fe 3 O 4 @SiO 2 -NH 2 in water to obtain a Fe 3 O 4 @SiO 2 -NH 2 solution;

[0022] Activate the DNA strand E with a carboxyl group, and then add the Fe 3 O 4 @SiO 2 -NH 2 solution and carry out Reaction 2. After the reaction, perform magnetic separation and washing to obtain the superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA, and store it for later use;

[0023] (3) Construction of CdTe QDs-pDNA:

[0024] Activate the carboxyl groups on the surface of CdTe QDs, and then add the DNA strand P with an amino group and carry out an amidation reaction. After the reaction, centrifuge and wash to obtain CdTe QDs-pDNA, and store it for later use;

[0025] (4) Construction of the fluorescence / photothermal dual-mode sensor:

[0026] Assemble the photothermal detection unit Ag@Au-ssDNA, the superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA and CdTe QDs-pDNA to obtain the fluorescence / photothermal dual-mode sensor;

[0027] Among them, steps (1) to (3) are not in a sequential order.

[0028] In step (1), the dosage ratio of water, polyvinylpyrrolidone (PVP), ascorbic acid (AA), NaOH, and Na 2 SO 3 , the gold growth solution, and the Ag NPRs solution is 2.5 - 3 mL : 1 - 2 mL : 200 μL : 200 μL : 30 - 50 μL : 3 - 4 mL : 2 mL;

[0029] The concentration of the PVP is 5 wt%, and the molecular weight is Mw 30000;

[0030] The concentrations of AA and NaOH are both 0.4 - 0.6 M;

[0031] Na 2 SO 3 has a concentration of 0.1 M;

[0032] The concentration of the gold growth solution is 1.25 mM HAuCl 4 ;

[0033] The concentration of the Ag NPRs solution is 0.94*10 -5 M.

[0034] Preferably, the preparation method of the Ag NPRs solution includes:

[0035] Mix H 2 O, silver nitrate, trisodium citrate, and hydrogen peroxide evenly in sequence and heat them in a water bath. Add NaBH 4 under vigorous stirring conditions and react until the color does not change to obtain the Ag NPRs seed solution;

[0036] Fully mix water, silver nitrate, trisodium citrate, and citric acid to obtain the growth solution for standby; mix water, the obtained Ag NPRs seed solution, ascorbic acid, and trisodium citrate to obtain the reaction solution for standby;

[0037] Add the growth solution to the reaction solution to obtain the Ag NPRs solution;

[0038] The preparation method of the gold growth solution includes:

[0039] Fully mix H 2 O, HAuCl 4 , NaOH, and Na 2 SO 3 and leave it overnight at low temperature to obtain the gold growth solution.

[0040] Preferably, during the preparation of the Ag NPRs seed solution, H 2 O, silver nitrate, trisodium citrate, hydrogen peroxide, and NaBH4 The dosage ratio is 18 - 25 mL : 15 - 25 μL : 1 - 1.5 mL : 40 - 55 μL : 100 - 150 μL; among them, the concentration of silver nitrate is 0.1 M, the concentration of trisodium citrate is 0.075 M, the concentration of hydrogen peroxide is 30 wt%, and the concentration of NaBH 4 is 0.1 M; the temperature of the water bath heating reaction is 30 °C;

[0041] The growth solution contains 4 - 6 mL of water, 0.5 mL of silver nitrate with a concentration of 40 - 60 mM, 0.2 mL of trisodium citrate with a concentration of 0.1 - 0.3 mL, and 0.2 mL of citric acid with a concentration of 0.1 - 0.3 mL;

[0042] The reaction solution contains 1.5 - 3 mL of water, 1 - 2 mL of seed solution, 15 - 30 μL of ascorbic acid, and 20 - 40 μL of trisodium citrate; the concentrations of the ascorbic acid and trisodium citrate are 0.1 M

[0043] The dosage ratio of the growth solution and the reaction solution is 1 : 9.5;

[0044] During the preparation of the gold growth solution, the dosage ratio of H 2 O, HAuCl 4 , NaOH, and Na 2 SO 3 is 2.3 - 2.5 mL : 20 μL : 100 - 150 μL : 1 - 2 mL; among them, the concentration of HAuCl 4 is 0.2 - 0.3 M, the concentration of NaOH is 0.2 M, and the concentration of Na 2 SO 3 is 0.01 M.

[0045] Preferably, in step (2), the dosage ratio of Fe 3 O 4 @SiO 2 , ethanol, and 3 - aminopropyltriethoxysilane is 4 - 6 mg : 20 - 40 mL : 40 - 60 μL; the conditions of reaction 1 are: reacting at 80 °C for 2 - 4 h;

[0046] The activation step includes: adding EDC and NHS to the DNA strand E with a carboxyl group and reacting at 25 °C for 3 h for activation;

[0047] The dosage ratio of the activated DNA strand E with a carboxyl group and Fe 3 O 4 @SiO 2 -NH 2 is 50 μL : 1 mL, among which Fe 3 O 4 @SiO2 -NH 2 had a concentration of 5 mg / mL;

[0048] The conditions for the said Reaction 2 were: reaction at 25 °C for 4 h.

[0049] Preferably, in step (3), the dosage ratio of the activated CdTe QDs to the DNA strand P with an amino group was 500 μL:50 μL;

[0050] The conditions for the amidation reaction were: reaction at 25 °C for 3 h.

[0051] Preferably, in step (4), the dosage ratio of the photothermal detection unit Ag@Au-ssDNA, the superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA to CdTe QDs-pDNA was 1:1:1.

[0052] The present invention also provided the application of the above fluorescence / photothermal dual-mode sensor in detecting miRNA.

[0053] Preferably, the miRNA included miRNA-222.

[0054] Preferably, the application included:

[0055] Mix the photothermal detection unit Ag@Au-ssDNA and the superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA in the above fluorescence / photothermal dual-mode sensor, add Output DNA and the substrate strand Scaffold thereto, conduct photothermal detection on miRNA-222, and after the detection is completed, add CdTe QDs-pDNA thereto. The photothermal detection unit Ag@Au-ssDNA and CdTe QDs-pDNA are base complementary paired to conduct fluorescence detection on miRNA-222;

[0056] The sequence of the said Output DNA was ATTGTCAAATCTACTGAGAAAGCTACATCTGGCTAC (SEQ ID NO:5);

[0057] The sequence of the said substrate strand Scaffold was:

[0058] ACCCAGTAGCCAGATGTAGCTTTCGTAGCCAGATGTAGCTTTC (SEQ ID NO:6). Compared with the prior art, the beneficial effects of the present invention are as follows:

[0059] (1) The present invention constructs a fluorescence / photothermal dual-mode sensor based on Ag@Au NPRs with good photothermal performance, CdTe QDs with strong fluorescence signals, Fe 3 O 4 @SiO 2 nanomaterials and an entropy-driven DNA molecular machine signal amplification strategy capable of specifically binding to miRNA. When the target miRNA is present, the entropy-driven DNA molecular machine is triggered to start, and the amplification reaction releases the output DNA (Output DNA). Through strand displacement reaction, the DNA (S1) and DNA (E) on the photothermal detection unit Ag@Au-ssDNA and the superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA are opened, and new double-stranded E / Output is generated with the DNA modified on Fe 3 O 4 @SiO 2 to displace the Ag@Au NPRs. After magnetic separation and redispersion, it can be directly used for photothermal signal detection. Then DNA (S1) acts on the DNA (P) in the fluorescence detection unit CdTe QDs-pDNA to form a complementary double-stranded S1 / P, resulting in fluorescence quenching for fluorescence signal detection. As the target concentration increases, more Ag@Au NPRs are displaced, the temperature rises and the fluorescence weakens. Thus, the target miRNA can be quantitatively detected according to the linear relationship between the target concentration and the temperature increase amplitude and fluorescence decrease amplitude.

[0060] (2) The sensor of the present invention combines the entropy-driven DNA amplification strategy with noble metal nanomaterials. Ag@Au NPRs can effectively absorb light and convert it into heat, and the heat can be transferred to the surrounding environment and cause temperature increase. The local surface plasmon on the surface of Ag@Au NPRs interacts with the excited state of CdTe QDs, which will cause energy to transfer from QDs to metal particles, thus quenching the fluorescence of QDs. The present invention prepares triangular core-shell structure Ag@Au NPRs with regular size and good photothermal performance, Fe 3 O 4 @SiO 2 nanoparticles with superparamagnetism and CdTe QDs with uniform size and strong fluorescence signals. The present invention selects Ag@Au NPRs as photothermal beacons and CdTe QDs as fluorescence beacons, which can realize the detection of low-concentration target microRNA. The two response signals are beneficial to eliminating environmental impacts and uncontrollable factors, and effectively improving the reliability and accuracy of detection results.

[0061] (3) Compared with sensors with single-signal output, the dual-mode sensor can effectively overcome its limitations in accuracy and save the time cost required for verifying the results. This method has the characteristics of simplicity, easy operation, low cost, high sensitivity, and high selectivity. The fluorescence / photothermal sensor described in the present invention has the advantages of simple construction, high sensitivity, and high specificity, and has good applications in the detection of miRNA.

[0062] (4) The fluorescence detection limit of the high-selectivity fluorescence / photothermal dual-mode sensor constructed based on the entropy-driven DNA molecular machine described in the present invention is 0.35 fM, and the photothermal detection limit is 0.5 pM, which is significantly better than many reports. For example, colorimetry (detection limit 0.37 pM, detection range 1 - 20 pM), electrochemistry (detection limit 0.2 nM, detection range 1 nM - 1 μM), photoelectrochemistry (detection limit 8 pM, detection range 0.05 nM - 50 nM), surface-enhanced Raman scattering (detection limit 9.78 pM, detection range 200 pM - 2 nM), fluorescence (detection limit 1.7 pM, detection range 5 - 200 pM), photothermal (detection limit 38 pM, detection range 50 pM - 50 nM).

[0063] In addition, the fluorescence detection of the sensor described in the present invention covers a wide dynamic linear range of 5 orders of magnitude, and the photothermal detection also has a linear range of 3 orders of magnitude. By comparing the fluorescence and photothermal methods for detecting miRNA-222, it is found that the sensitivity of fluorescence detection is significantly higher than that of photothermal detection. However, for portable detection, photothermal detection has obvious advantages, even better than some fluorescence methods, electrochemical methods, and photoelectrochemical methods. This is because the effective use of all chains in the EDC circuit module reduces the DNA economic cost in the amplification system. Moreover, the dual-mode expression can self-confirm the detection results, which significantly improves the reliability of the biosensor. Brief Description of the Drawings

[0064] Figure 1 Schematic diagram of the fluorescence / photothermal dual-mode detection of miRNA-222 by the fluorescence / photothermal sensor described in the present invention.

[0065] Figure 2 For Fe 3 O 4 @SiO 2 High-resolution transmission electron microscope images of particles (A), CdTe QDs (B), Ag NPRs (C), and Ag@Au NPRs (D).

[0066] Figure 3For the electrophoretic characterization of the entropy-driven DNA amplification system; among them, lane M: reference lane (150 base pairs); lane 1: S1; lane 2: S2; lane 3: S1 + S2; lane 4: S1 + eDNA; lane 5: 2S1 + S2 + eDNA; lane 6: Output + S1 + eDNA; lane 7: S1 + pDNA; lane 8: 2S1 + S2 + eDNA (the DNA volume in all lanes is 10 μL, and the DNA concentration of Output is 2 μmol L -1 , and the DNA concentration of other lanes is 2 μmol L -1 .).

[0067] Figure 4 For the characterization of each material in the construction of the fluorescence / photothermal sensor; among them, A is the ultraviolet-visible absorption spectra of Ag NPRs seeds (a), AgNPRs (b), and Ag@Au NPRs (c); B is the ultraviolet-visible (d) and fluorescence (e) spectra of CdTe quantum dots and the corresponding photos; C is 10 μmol L -1 The ultraviolet absorption spectra of DNA S1 (f) and the supernatant after centrifugal washing of Ag@Au-S1 (g); D is 10 μmol L -1 The ultraviolet absorption spectra of DNA S2 (h) and the supernatant after centrifugal washing of Ag@Au-S1 (i); E is 10 μmol L -1 The ultraviolet absorption spectra of DNA P (j) and the supernatant after centrifugal washing of CdTe QDs-pDNA (k); F is the electrochemical impedance spectra of Fe 3 O 4 @SiO 2 (l) and Fe 3 O 4 @SiO 2 -E (m).

[0068] Figure 5 For the performance investigation of the fluorescence / photothermal sensor; among them, A is the fluorescence response of the fluorescence / photothermal sensor in the presence of 0 (a) and 50 pmol L -1 (b) target; B is the fluorescence response of the fluorescence / photothermal sensor in the presence of 0, 1, 5, 10, 50, 100, 500 fmol L -1 , 1, 5, 10, 50, 100, 500 pmol L -l target; C is the fluorescence linear calibration curve of the fluorescence / photothermal sensor; D is the temperature change of the fluorescence / photothermal sensor in the presence of 0 (c) and 1 nmol L -1 (d) target; E is the fluorescence / photothermal sensor in 0, 1, 5, 10, 50, 100, 500 pmol L -l; 1, 5, 10 nmol L -1 Photothermal response in the presence of the target; F is the photothermal linear calibration curve of the fluorescence / photothermal sensor.

[0069] Figure 6 Shows the stability and specificity of the fluorescence / photothermal sensor; where A is 50 fmol L -1 Fluorescence stability of the fluorescence / photothermal sensor triggered by the presence of the target; B is 10 pmol L -l Photothermal stability of the fluorescence / photothermal sensor triggered by the presence of the target; C is 50 fmol L -1 0 - 4 week fluorescence response of the fluorescence / photothermal sensor triggered by the presence of the target; D is 10 pmolL -1 0 - 4 week photothermal curve of the fluorescence / photothermal sensor triggered by the target; E and F are respectively the fluorescence (E) and photothermal (F) interference tests of the fluorescence / photothermal sensor in the presence of 500 - fold interferents and 100 - fold mixed interferents in the target. -1 Interference tests of fluorescence (E) and photothermal (F) of the fluorescence / photothermal sensor after adding 500 - fold interferents and 100 - fold mixed interferents to the target. Detailed implementation manners

[0070] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited thereto. The technical solutions of the embodiments of the present invention are clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the described embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention.

[0071] Unless otherwise defined, the technical terms or scientific terms used herein shall have the ordinary meaning as understood by those of ordinary skill in the art to which the present invention pertains.

[0072] In the following embodiments, the nucleotide sequence of S1 is SH - TTTTTACACCTACACGTCTACTGAGAAAGCTACATC (SEQ ID NO:1);

[0073] The nucleotide sequence of S2 is AATTCTCAGTAGACGTGTATTTTTT - SH (SEQ ID NO:2);

[0074] The nucleotide sequence of P is NH 2 -TTTTTTCAGTAGACGTGTAGGTGT (SEQ ID NO:3);

[0075] The nucleotide sequence of E is COOH-TTTTTTTTTTCCAGATGTAGCTTTCTCAGTAGA (SEQ ID NO:4);

[0076] The nucleotide sequence of Output DNA is ATTGTCAAATCTACTGAGAAAGCTACATCTGGCTAC (SEQ ID NO:5);

[0077] The nucleotide sequence of the substrate chain Scaffold is: ACCCAGTAGCCAGATGTAGCTTTCGTAGCCAGATGTAGCTTTC (SEQ ID NO:6);

[0078] The nucleotide sequence of the Fuel is GAAAGCTACATCTGGCTACGAAAGCTACATCTGGCTAC (SEQ ID NO:7);

[0079] The nucleotide sequence of the miRNA-222 is AGCUACAUCUGGCUACUGGGU (SEQ ID NO:8);

[0080] All of the above DNA strands were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0081] The fluorescence / photothermal dual-mode detection principle of the fluorescence / photothermal dual-mode sensor described in the present invention for miRNA-222 is as Figure 1 shown. It can be seen from the figure that when the target miRNA-222 is present, the entropy-driven DNA molecular machine is triggered to start, and the amplified reaction releases the output DNA (Output DNA). Through the strand displacement reaction, the DNA (S1) and DNA (E) on the photothermal detection unit Ag@Au-ssDNA and the superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA are opened, and new double-stranded E / Output is generated with the DNA modified on Fe 3 O 4 @SiO 2 , thereby displacing the Ag@Au NPRs. After magnetic separation and redispersion, it can be directly used for the detection of photothermal signals. Then, DNA (S1) acts on the DNA (P) in the fluorescence detection unit CdTe QDs-pDNA to generate complementary double-stranded S1 / P, resulting in fluorescence quenching for the detection of fluorescence signals. As the target concentration increases, more Ag@Au NPRs are displaced, the temperature rises and the fluorescence weakens. Therefore, according to the linear relationship between the concentration of the target, the temperature increase amplitude, and the fluorescence decrease amplitude, miRNA-222 can be quantitatively detected.

[0082] Example 1: Construction of fluorescence / photothermal dual-mode sensor based on entropy-driven DNA molecular machine

[0083] (1) Construction of the photothermal detection unit Ag@Au-ssDNA for entropy-driven DNA molecular machine signal amplification:

[0084] S11. Preparation of Ag NPRs seed solution:

[0085] Add 18 mL of H 2 O, 15 μL silver nitrate (0.1 M), 1 mL trisodium citrate (0.075 M) and 40 μL hydrogen peroxide (30 wt%) were mixed and reacted thoroughly. During the mixing process, the mixture was heated in a water bath at 30°C. After each reactant was added, the mixture was reacted for 5 min before the next reactant was added. After all reactants were added and mixed evenly, 100 μL NaBH 4 (0.1 M) was quickly added to the reaction solution, and the reaction solution instantly turned yellow, orange, red, purple, and blue. The reaction was completed after 30 minutes without changing color. The obtained solution was used as the seed solution of silver nanoplates (Ag NPRs).

[0086] S12. Preparation of Ag NPRs solution:

[0087] 1.5 mL of water, 1 mL of seed solution, 15 μL of ascorbic acid (0.1 M) and 20 μL of trisodium citrate (0.1 M) were added to a glass bottle in sequence to form a reaction solution for preparing Ag NPRs; 4 mL of water, 0.5 mL of silver nitrate (40 mM), 0.1 mL of trisodium citrate (0.1 M) and 0.1 mL of citric acid (0.1 M) were fully mixed by a pipette (5 μL / min) to obtain a growth solution.

[0088] The obtained growth solution and the obtained reaction solution are mixed. Different sizes of Ag NPRs can be obtained by adding different growth solutions. If Ag NPRs with an absorption peak at 800 nm are to be obtained, about 300 μL of growth solution is added.

[0089] S13. Preparation of gold growth solution:

[0090] Add 2.3 mL of H 2 O, and then 20 μL HAuCl 4 (0.2M), 100μL NaOH (0.2M), 1mL Na 2 SO 3 (0.01 M), mix thoroughly to obtain the gold growth solution, place in a refrigerator at 4°C overnight and leave it undisturbed before use.

[0091] Preparation of S14.Ag@Au NPRs:

[0092] Centrifuge the Ag NPRs to remove the supernatant, and then redisperse them in 2 mL of water to obtain an Ag NPRs solution for standby.

[0093] Take 2.5 mL of water, 1 mL of PVP (5 wt%, Mw 30000), 200 μL of AA (0.4 M), 200 μL of NaOH (0.4 M), and 30 μL of Na 2 SO 3 (0.1 M) and place them in a small glass bottle. Add 3 mL of gold growth solution, stir for 5 min, then combine with the Ag NPRs solution to initiate seed growth. After stirring for 2 min, let it stand and place it in an oven for overnight reaction at 30 °C. After the reaction is completed, Ag@Au NPRs are obtained.

[0094] Assembly of S15.Ag@Au-ssDNA:

[0095] Take 1 mL and 2 mL of the prepared Ag@Au NPRs respectively and mix them overnight at 37 °C with the thiol-modified DNA strand S2 (10 μmol L -1 , 50 μL) and the thiol-modified DNA strand S1 (10 μmol L -1 , 100 μL) to form Ag@Au-S1 and Ag@Au-S2.

[0096] Mix Ag@Au-S1 and Ag@Au-S2 to obtain the Ag@Au-ssDNA.

[0097] (2) Construction of superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA:

[0098] Preparation of S21.Fe 3 O 4 @SiO 2 :

[0099] Mix PAA (0.188 g), ferric chloride (0.065 g, 98%) and 15 mL of DEG evenly and react at 220 °C for 1 h. Subsequently, add 1.8 mL (0.2 mol L -1 ) NaOH / DEG solution and continue to react for 1 h. After the reaction is completed, add 30 mL of ethanol for centrifugal washing and disperse it in 3 mL of water to obtain the reaction solution.

[0100] 1 mL of ammonia water and 50 μL of TEOS were added to 15 mL of ethanol and the reaction solution obtained by the above centrifugation. The reaction was carried out at room temperature for 30 min. After the reaction, centrifugal washing was performed three times with ethanol and water, and finally, it was fixed in 4 mL of ethanol to obtain Fe 3 O 4 @SiO 2 。

[0101] S22. Preparation of amino-functionalized Fe 3 O 4 @SiO 2 :

[0102] 4 mg of Fe 3 O 4 @SiO 2 , 20 mL of ethanol and 40 μL of APTES were vigorously stirred for 5 min. After the stirring, the reaction was carried out at 80 °C for 2 h. After the reaction, the solid was collected by centrifugation and washed to obtain Fe 3 O 4 @SiO 2 -NH 2 particles, which were redispersed in 2 mL of water for standby.

[0103] S23. Assembly of Fe 3 O 4 @SiO 2 -eDNA:

[0104] 50 μL (10 μmol L -1 ) of the DNA strand (E) with a carboxyl group was taken, and 25 μL (0.1 mol L -1 ) of EDC and 25 μL (0.1 mol L -1 ) of NHS were added thereto and reacted at 25 °C for 3 h to obtain the activated DNA strand E with a carboxyl group. Then, 1 mL of Fe 3 O 4 @SiO 2 -NH 2 particles were added thereto and reacted at 25 °C for 4 h to obtain superparamagnetic units, denoted as Fe 3 O 4 @SiO 2 -eDNA, which was washed by magnetic separation and stored in 1 mL of Tris-HCl buffer solution with a pH of 7.4 for standby.

[0105] (3) Construction of CdTe QDs-pDNA:

[0106] S31. Preparation of CdTe QDs:

[0107] 62 mg of NaBH 438 mg of Te powder was dissolved in 1.5 mL of anaerobic water. The bottle mouth was quickly sealed, and then the reaction was carried out at 4 °C for 12 h to obtain a transparent light purple NaHTe solution. The pH value of the NaHTe solution was adjusted to 9 with 1 mol / L -1 NaOH, and then N 2 was introduced for 30 min to remove the dissolved O 2 . Under the protection of N 2 , a condensation reflux device was established. 0.5 mL of the NaHTe solution was quickly injected into the three-necked flask within 2 s. Under vigorous stirring, the solution immediately changed from colorless to orange-yellow, and then refluxed at 100 °C for 16 h to obtain a blood-red transparent CdTe QDs solution, which was stored in the dark at 4 °C for later use.

[0108] S32. Preparation of CdTe QDs-pDNA:

[0109] 10 μL (0.1 mol / L -1 ) EDC and 10 μL (0.1 mol / L -1 ) NHS solution were added to 500 μL of the obtained CdTe QDs solution to activate the carboxyl groups on the surface of CdTe QDs. Then, 50 μL of DNA strand P with an amino group at a concentration of 10 μmol / L -1 was added. The reaction was carried out at 25 °C for 3 h to couple the activated carboxyl groups with the amino groups on the DNA strand through amidation reaction. After the reaction, ethanol was added for centrifugal washing to obtain CdTe QDs-pDNA, which was stored in 500 μL of Tris-HCl buffer solution with pH = 7.4 at 4 °C for later use.

[0110] (4) Construction of the fluorescence / photothermal dual-mode sensor:

[0111] The photothermal detection unit Ag@Au-ssDNA, the superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA and CdTe QDs-pDNA were assembled to obtain the fluorescence / photothermal dual-mode sensor.

[0112] As can be seen from Figure 2 , Figure 2 the Fe 3 O 4 @SiO 2 particles in A showed relatively uniform size and good dispersibility, with dark clusters as the core and bright shells, which can be explained by the fact that the atomic number of iron element is higher than that of silicon element. Figure 2As shown in B, the diameter of the obtained CdTe quantum dots is about 3.24 nm, and the lattice spacing is 0.38 nm, corresponding to the CdTe (002) plane. This indicates that the CdTe quantum dots have been successfully prepared. Figure 2 As can be seen in C, the sizes of the Ag NPRs are uniform, with an average size of about 75 nm. It can be clearly seen that all the sizes are triangular, and the yield is very high. Figure D shows that uniform Ag@Au NPRs are obtained, with an average size of 100 nm for the side length of the triangle. The image shows a gray triangular area in the center and a black edge area, which is attributed to the Ag core and Au shell.

[0113] From Figure 3 As can be seen, the solid line marks are all the bands corresponding to the target products, indicating the feasibility of constructing the cascade amplification system. The dotted part is the non-target band formed by the reduction of mercapto groups to form disulfide bonds.

[0114] From Figure 4 As can be seen, for the UV absorption spectrum of Ag NPs, after growing Ag NPs into Ag NPRs, the absorption peak undergoes a red shift and appears at 800 nm. In this process, the morphology of Ag NPs changes from triangular - circular - hexagonal - triangular. When Au is grown on Ag NPRs to obtain Ag@Au NPRs, the UV absorption peak continues to red shift and appears at 840 nm ( Figure 4 A). Figure 4 (B) The UV - visible absorption spectrum and fluorescence spectrum prove the successful synthesis of CdTe QDs. Figure 4 (C) - (F) Verify the coupling of Ag@Au NPRs, CdTe QDs and Fe 3 O 4 @SiO 2 with DNA strands. Curves f, h, j are the absorbances of 10 μM S1 DNA, S2DNA, pDNA at 260 nm. Curves g, i, k measure the absorbances of the supernatants after centrifugation and washing of Ag@Au NPRs and CdTe QDs coupled with DNA strands at 260 nm. The disappearance of the absorption peaks of curves f, h, j at 260 nm indicates that the DNA strands have been successfully modified onto the surfaces of Ag@Au NPRs and CdTe QDs. The impedance of curve m increases by 900 Ω compared to curve l, indicating that Fe 3 O 4 @SiO 2 surfaces have been successfully modified with DNA strands.

[0115] Example 2: Construction of a fluorescence / photothermal dual - mode sensor based on an entropy - driven DNA molecular machine

[0116] (1) Construction of the photothermal detection unit Ag@Au-ssDNA for entropy-driven DNA molecular machine signal amplification:

[0117] S11. Preparation of Ag NPRs seed solution:

[0118] Add 20 mL of H 2 O, 20 μL of silver nitrate (0.1 M), 1.2 mL of trisodium citrate (0.075 M), and 48 μL of hydrogen peroxide (30 wt%) into a glass bottle in sequence and mix them thoroughly. During the mixing process, heat in a water bath at 30 °C. After adding each reactant, mix for 5 min and then add the next reactant. After all reactants are added and mixed evenly, quickly add 120 μL of NaBH 4 (0.1 M) to the reaction solution. After adding, the reaction solution instantly turns yellow, orange, red, purple, and blue. Wait for 30 min until the color does not change, and the reaction is completed. The resulting solution is used as the seed solution of silver nanoplates (Ag NPRs).

[0119] S12. Preparation of Ag NPRs solution:

[0120] Add 2 mL of water, 1.5 mL of the seed solution, 20 μL of ascorbic acid (0.1 M), and 30 μL of trisodium citrate (0.1 M) into a glass bottle in sequence to form the reaction solution for preparing Ag NPRs; mix 5 mL of water, 0.5 mL of silver nitrate (50 mM), 0.2 mL of trisodium citrate (0.1 M), and 0.2 mL of citric acid (0.1 M) thoroughly with a pipette (5 μL / min) to obtain the growth solution.

[0121] Mix the obtained growth solution and the obtained reaction solution. Different sizes of Ag NPRs can be obtained by adding different growth solutions. If you want to obtain Ag NPRs with an absorption peak at 800 nm, about 375 μL of the growth solution is added.

[0122] S13. Preparation of gold growth solution:

[0123] Add 2.36 mL of H 2 O into a small glass bottle, and then add 20 μL of HAuCl 4 (0.25 M), 120 μL of NaOH (0.2 M), and 1.5 mL of Na 2 SO 3 (0.01 M) in sequence. After mixing thoroughly, obtain the gold growth solution, store it in the refrigerator at 4 °C overnight, and do not disturb it before use.

[0124] S14. Preparation of Ag@Au NPRs:

[0125] The Ag NPRs were centrifuged to remove the supernatant, and then redispersed in 2 mL of water to obtain an Ag NPRs solution for standby.

[0126] Take 2.55 mL of water, 1 mL of PVP (5 wt%, Mw 30000), 200 μL of AA (0.5 M), 200 μL of NaOH (0.5 M), and 50 μL of Na 2 SO 3 (0.1 M) and place them in a small glass bottle. Add 4 mL of gold growth solution, stir for 5 min, then combine with the Ag NPRs solution to initiate seed growth. After stirring for 5 min, let it stand and place it in an oven for overnight reaction at 30 °C. After the reaction, Ag@AuNPRs are obtained.

[0127] S15. Assembly of Ag@Au-ssDNA:

[0128] Take 1 mL and 2 mL of the prepared Ag@Au NPRs and mix them with the thiol-modified DNA strand S2 (10 μmol L -1 , 50 μL) and the thiol-modified DNA strand S1 (10 μmol L -1 , 100 μL) overnight at 37 °C to form Ag@Au-S1 and Ag@Au-S2.

[0129] Mix Ag@Au-S1 and Ag@Au-S2 to obtain the Ag@Au-ssDNA.

[0130] (2) Construction of superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA:

[0131] S21. Preparation of Fe 3 O 4 @SiO 2 :

[0132] Mix PAA (0.288 g), ferric chloride (0.065 g 98%) and 17 mL of DEG evenly and react at 220 °C for 1 h. Then add 1.8 mL (0.25 mol L -1 ) NaOH / DEG solution and continue to react for 1 h. After the reaction, add 37 mL of ethanol, centrifuge, wash and disperse in 3 mL of water to obtain a reaction solution.

[0133] Take 1 mL of ammonia water and 60 μL of TEOS and add them to 20 mL of ethanol and the reaction solution obtained by the above centrifugation. React at room temperature for 30 min. After the reaction, centrifuge and wash three times with ethanol and water, and finally make up the volume to 4 mL of ethanol to obtain Fe 3 O4 @SiO 2 。

[0134] S22. Amino-functionalized Fe 3 O 4 @SiO 2 Preparation:

[0135] Add 5 mg of Fe 3 O 4 @SiO 2 , 30 mL of ethanol and 50 μL of APTES, stir vigorously for 5 min. After stirring, react at 80 °C for 3 h. After the reaction, centrifuge to collect the solid, wash it to obtain Fe 3 O 4 @SiO 2 -NH 2 particles, redisperse them in 2 mL of water for later use.

[0136] S23. Assembly of Fe 3 O 4 @SiO 2 -eDNA:

[0137] Take 50 μL (10 μmol L -1 ) of the DNA strand (E) with a carboxyl group, add 25 μL (0.1 mol L -1 ) of the EDC and NHS mixture, and react at 25 °C for 3 h to obtain the activated DNA strand E with a carboxyl group. Then add 1 mL of Fe 3 O 4 @SiO 2 -NH 2 suspension, react at 25 °C for 4 h to obtain superparamagnetic units, denoted as Fe 3 O 4 @SiO 2 -eDNA, wash it by magnetic separation, and store it in 1 mL of Tris-HCl buffer solution with a pH of 7.4 for later use.

[0138] (3) Construction of CdTe QDs-pDNA:

[0139] S31. Preparation of CdTe QDs:

[0140] Dissolve 72 mg of NaBH 4 and 48 mg of Te powder in 2 mL of anaerobic water, quickly seal the bottle mouth, and then react at 4 °C for 12 h to obtain a transparent light purple NaHTe solution. Adjust the pH value of the NaHTe solution to 9 with 2 molL -1 NaOH, and then pass N 2 for 30 min to remove the dissolved O2 , under the protection of N 2 , a condensation reflux device was established. 1 mL of NaHTe solution was quickly injected into the three-necked flask within 2 s. Under vigorous stirring, the solution instantly changed from colorless to orange-yellow, and then refluxed at 100 °C for 18 h. The obtained blood-red transparent CdTe QDs solution was stored in the dark at 4 °C for later use.

[0141] S32. Preparation of CdTe QDs-pDNA:

[0142] 10 μL (0.1 mol L -1 ) of EDC and NHS solution was added to 500 μL of the obtained CdTe QDs solution to activate the carboxyl groups on the surface of CdTe QDs, and then 50 μL of DNA strand P with amino groups at a concentration of 10 μmol L -1 was added. The reaction was carried out at 25 °C for 3 h to couple the activated carboxyl groups with the amino groups on the DNA strand through an amidation reaction. After the reaction, ethanol was added for centrifugal washing to obtain CdTe QDs-pDNA, which was stored in 500 μL of Tris-HCl buffer solution with pH = 7.4 at 4 °C for later use.

[0143] (4) Construction of the fluorescence / photothermal dual-mode sensor:

[0144] The photothermal detection unit Ag@Au-ssDNA, the superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA and CdTe QDs-pDNA were assembled to obtain the fluorescence / photothermal dual-mode sensor.

[0145] Example 3: Construction of a fluorescence / photothermal dual-mode sensor based on an entropy-driven DNA molecular machine

[0146] (1) Construction of the photothermal detection unit Ag@Au-ssDNA with signal amplification by an entropy-driven DNA molecular machine:

[0147] S11. Preparation of the Ag NPRs seed solution:

[0148] 25 mL of H 2 O, 25 μL of silver nitrate (0.1 M), 1.5 mL of trisodium citrate (0.075 M), and 55 μL of hydrogen peroxide (30 wt%) were successively added to a glass bottle and mixed thoroughly. During the mixing process, it was heated in a water bath at 30 °C. After each reaction was added and mixed for 5 min, the next reactant was added. After all were added and mixed evenly, 150 μL of NaBH 4(0.1 M) was quickly added to the reaction solution. After addition, the reaction solution immediately turned yellow, orange, red, purple, and blue. After reacting for 30 min without color change, the reaction was completed, and the resulting solution was used as the seed solution for silver nanoplates (Ag NPRs).

[0149] S12. Preparation of Ag NPRs solution:

[0150] In a glass bottle, 3 mL of water, 2 mL of the seed solution, 30 μL of ascorbic acid (0.1 M), and 40 μL of trisodium citrate (0.1 M) were added in sequence to form a reaction solution for preparing Ag NPRs; 6 mL of water, 0.5 mL of silver nitrate (60 mM), 0.3 mL of trisodium citrate (0.1 M), and 0.3 mL of citric acid (0.1 M) were thoroughly mixed by a pipette (5 μL / min) to obtain a growth solution.

[0151] The obtained growth solution and the obtained reaction solution were mixed. Different sizes of Ag NPRs could be obtained by adding different growth solutions. If Ag NPRs with an absorption peak at 800 nm were desired, approximately 500 μL of the growth solution was added.

[0152] S13. Preparation of gold growth solution:

[0153] 2.5 mL of H 2 O was added to a small glass bottle, and then 20 μL of HAuCl 4 (0.3 M), 150 μL of NaOH (0.2 M), and 2 mL of Na 2 SO 3 (0.01 M) were added in sequence. After thorough mixing, the gold growth solution was obtained, stored in the refrigerator at 4 °C overnight, and left undisturbed before use.

[0154] S14. Preparation of Ag@Au NPRs:

[0155] The Ag NPRs were centrifuged to remove the supernatant, and then redispersed in 2 mL of water to obtain an Ag NPRs solution for standby.

[0156] 3 mL of water, 2 mL of PVP (5 wt%, Mw 30000), 200 μL of AA (0.6 M), 200 μL of NaOH (0.6 M), and 50 μL of Na 2 SO 3 (0.1 M) were placed in a small glass bottle, 5 mL of the gold growth solution was added, stirred for 5 min, then combined with the Ag NPRs solution to initiate seed growth. After stirring for 5 min, it was left standing in an oven and reacted overnight at 30 °C. After the reaction was completed, Ag@Au NPRs were obtained.

[0157] Assembly of S15.Ag@Au-ssDNA:

[0158] Take 1 mL and 2 mL of the prepared Ag@Au NPRs respectively, and mix them with the DNA strand S2 (10 μmol L -1 , 50 μL) modified with thiol on the surface and the DNA strand S1 (10 μmol L -1 , 100 μL) modified with thiol on the surface at 37 °C overnight to form Ag@Au-S1 and Ag@Au-S2.

[0159] Mix Ag@Au-S1 and Ag@Au-S2 to obtain the Ag@Au-ssDNA.

[0160] (2) Construction of superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA:

[0161] Preparation of S21.Fe 3 O 4 @SiO 2 :

[0162] Mix PAA (0.388 g), ferric chloride (0.075 g, 98%) and 20 mL of DEG evenly, react at 220 °C for 1 h, then add 2 mL (0.25 mol L -1 ) NaOH / DEG solution and continue to react for 1 h. After the reaction, add 47 mL of ethanol, centrifuge, wash and disperse in 3 mL of water to obtain the reaction solution.

[0163] Take 1 mL of ammonia water and 70 μL of TEOS, add them to 20 mL of ethanol and the reaction solution obtained by the above centrifugation, react at room temperature for 30 min. After the reaction, centrifuge and wash three times with ethanol and water, and finally make up the volume to 4 mL of ethanol to obtain Fe 3 O 4 @SiO 2 .

[0164] Preparation of S22. Amino-functionalized Fe 3 O 4 @SiO 2 :

[0165] Mix 6 mg of Fe 3 O 4 @SiO 2 , 40 mL of ethanol and 60 μL of APTES, stir vigorously for 5 min. After the stirring, react at 80 °C for 4 h. After the reaction, centrifuge to collect the solid and wash to obtain Fe 3 O 4 @SiO 2-NH 2 The particles were redispersed in 2 mL of water and kept for later use.

[0166] S23.Fe 3 O 4 @SiO 2 Assembly of -eDNA:

[0167] Take 50 μL (10 μmol L -1 ) of the DNA strand (E) with a carboxyl group and add 25 μL (0.1 mol L -1 ) of the EDC and NHS mixture and react at 25 °C for 3 h to obtain the activated DNA strand E with a carboxyl group. Then add 1 mL of Fe 3 O 4 @SiO 2 -NH 2 particles and react at 25 °C for 4 h to obtain superparamagnetic units, denoted as Fe 3 O 4 @SiO 2 -eDNA, wash by magnetic separation, and store in 1 mL of Tris-HCl buffer at pH 7.4 for later use.

[0168] (3) Construction of CdTe QDs-pDNA:

[0169] S31. Preparation of CdTe QDs:

[0170] Dissolve 82 mg of NaBH 4 and 58 mg of Te powder in 3 mL of anaerobic water, quickly seal the bottle mouth, and then react at 4 °C for 15 h to obtain a transparent light purple NaHTe solution. Adjust the pH value of the NaHTe solution to 9 with 3 molL -1 NaOH, then pass N 2 for 30 min to remove the dissolved O 2 , and establish a condensation reflux device under the protection of N 2 . Quickly inject 2 mL of the NaHTe solution into the three-necked flask within 2 s. Under vigorous stirring, the solution immediately turns from colorless to orange-yellow, and then reflux at 100 °C for 20 h to obtain a blood-red transparent CdTe QDs solution, which is stored in the dark at 4 °C for later use.

[0171] S32. Preparation of CdTe QDs-pDNA:

[0172] Add 10 μL (0.1 mol L -1 ) of the EDC and NHS solution to 500 μL of the obtained CdTe QDs solution to activate the carboxyl groups on the surface of CdTeQDs, and then add 50 μL of a solution with a concentration of 10 μmol L-1 The DNA strand P with an amino group reacts at 25 °C for 3 h, enabling the activated carboxyl group to couple with the amino group on the DNA strand through an amidation reaction. After the reaction, ethanol is added for centrifugation and washing to obtain CdTe QDs-pDNA, which is stored in 500 μL of Tris-HCl buffer at pH = 7.4 and 4 °C for standby.

[0173] (4) Construction of the fluorescence / photothermal dual-mode sensor:

[0174] The photothermal detection unit Ag@Au-ssDNA and the superparamagnetic unit Fe 3 O 4 @SiO 2 -eDNA and CdTe QDs-pDNA are assembled to obtain the fluorescence / photothermal dual-mode sensor.

[0175] Example 4:

[0176] This example also investigated the application of the fluorescence / photothermal dual-mode sensor prepared in Example 1 in the detection of miRNA. The specific steps are as follows:

[0177] (1) Mix 2.5 μL of 10 μmol L -1 Scaffold strand and 5 μL of 10 μmol L -1 Output strand, incubate at 95 °C for 5 min, cool to 4 °C within 1 min, and then react at room temperature for 2 h. After the reaction, the composite substrate Substrate is obtained. Mix 2 μL of miRNA-222 with different concentrations with the above composite substrate Substrate solution and react at 37 °C for 2 h. There is a single-stranded sticky end on the Scaffold strand, denoted as domain a*. When domain a of miRNA-222 binds to domain a*, it initiates a strand displacement reaction between domain b on miRNA-222 and domain b on the Scaffold. miRNA-222 binds completely to the Scaffold, releasing Output and generating a metastable triple-stranded complex M2.

[0178] (2) Mix 2.5 μL of 10 μmol L -1The Fuel strand was mixed with the resulting metastable triple-stranded complex M2 and reacted at 37 °C for 2 h. Through the binding of domain c on the Fuel strand to the exposed domain c* on the triple-stranded complex M2, two strand displacement reactions occurred, generating the quadruple-stranded complex M3. At this time, miRNA-222 and Output were released from the metastable complex M3, along with the complex formed by the substrate and the fuel. The released miRNA-222 triggered the next round of entropy-driven DNA molecular machine signal operation. After multiple cycles, the reaction solution containing a large amount of Output was mixed with 200 μL of Ag@Au NPRs-S1 and Fe 3 O 4 @SiO 2 -eDNA and reacted at room temperature for 1 h to obtain the Fe 3 O 4 @SiO 2 -eDNA and Output complex. The reaction solution was magnetically separated to remove the precipitate, and the Ag@Au NPRs-S1 solution was obtained.

[0179] (3) Take 200 μL of the Ag@Au NPRs-S1 solution after the above reaction and place it in a 1.5 mL vial. Irradiate it with 808 nm near-infrared light (power density of 1.5 W cm -2 ) for 8 min, and the distance between the light source and the sample is 10 cm. At the same time, use a near-infrared imager to synchronously collect the temperature signal.

[0180] Mix 200 μL of the Ag@Au NPRs-S1 solution after the above reaction with 100 μL of CdTe QDs-pDNA (0.19 mmol L -1 ) solution and react at room temperature for 1 h. Take 200 μL of the solution after the above reaction and place it in a cuvette with a volume of 300 μL for fluorescence detection.

[0181] The investigation results are as Figure 5 shown. It can be seen from the figure that in the absence of miRNA-222, the fluorescence intensity after EDC entropy-driven amplification reaches 108 cps (a), and the photothermal temperature is 34.7 °C (c). When the target concentration is 50 pmol L -1 or 1 nmol L -1 , the intensity of the CdTe QDs quantum dots decreases to 15 cps (b), and the temperature rises to 48.4 °C ( Figure 5 A and Figure 5 D). As the concentration of miRNA-222 increases, the fluorescence signal gradually weakens. A linear relationship is established between the decrease in fluorescence intensity and the logarithm of the miRNA-222 concentration. The fluorescence intensity changes with lg C. At 1 fmol L -1~50 pmol / L -1 showed a linear relationship. The linear regression equation was ΔF = 18.628 lg C + 6.888, and its correlation coefficient was 0.994( Figure 5 B and 5C). As the concentration of miRNA-222 increased, the temperature gradually increased. A linear relationship was established between the temperature increment and the logarithm of the miRNA-222 concentration. The temperature changed with lg C. At 1 pmol / L -1 ~1 nmol / L -1 showed a linear relationship. The linear regression equation was ΔT = 4.025 lg C + 1.383, and its correlation coefficient was 0.991( Figure 5 E and 5F).

[0182] It can be seen that the greater the concentration of the target miRNA-222, the more Ag@Au NPRs are displaced, and the more obvious the temperature rise. At 1 pmol / L -1 ~1 nmol / L -1 showed a linear relationship, and the fluorescence intensity was weaker. At 1 fmol / L -1 ~50 pmol / L -1 showed a linear relationship. Therefore, the fluorescence / photothermal dual-mode sensor described in the present invention established a dual-mode fluorescence / photothermal detection method, in which the fluorescence quantitative analysis reached 5 orders of magnitude, the detection limit was 0.35 fM, the photothermal quantitative analysis reached 3 orders of magnitude, and the detection limit was 0.5 pM, which was superior to other detection methods in the prior art.

[0183] By comparing the two methods of fluorescence and photothermal for detecting miRNA-222, it was found that the sensitivity of fluorescence detection was significantly higher than that of photothermal detection. However, for portable detection, photothermal detection had obvious advantages, even superior to some fluorescence methods, electrochemical methods, and photoelectrochemical methods. This was because the effective use of all chains in the EDC circuit module reduced the DNA economic cost in the amplification system. In addition, the dual-mode expression could self-confirm the detection results, which significantly improved the reliability of the biosensor.

[0184] In this example, the standard addition method was also used for detection (repeatedly tested 4 times). Serum (provided by the Third People's Hospital of Yancheng City) was selected as the test sample, and the application of the fluorescence / photothermal dual-mode sensor in the actual detection of miRNA-222 in serum samples was investigated by the above method. The investigation results are shown in Table 1.

[0185] Table 1. Detection of miRNA-222 in serum samples by the fluorescence / photothermal sensor (n = 4)

[0186]

[0187] As can be seen from Table 1, when the standard addition method was used for detection, the average spiked recovery rate of the fluorescence test was 97% - 106.66%, and the relative standard deviation was 2.3% - 4.81%. The average spiked recovery rate of the photothermal test was 97.31% - 105%, and the relative standard deviation was 2.37% - 6.49%. This indicates that the designed sensor has good accuracy and precision in the detection of actual samples.

[0188] Example 5:

[0189] In this example, the stability and specificity of the fluorescence / photothermal dual-mode sensor prepared by the method described in Example 1 were also investigated during the detection of miRNA. The specific steps are as follows:

[0190] (1) Investigation of short-term stability:

[0191] In the presence of 50 fmol / L -1 miRNA-222, the fluorescence signal of the fluorescence / photothermal dual-mode sensor prepared by the method described in Example 1 was investigated through 5 consecutive tests using the method described in Example 4. Then, in the presence of 10 pmol / L -1 miRNA-222, the temperature was investigated through 5 consecutive "on-off" irradiations (heating for 8 min and cooling for 10 min). The investigation results are as Figure 6 shown.

[0192] As can be seen from Figure 6 A, the intensity of the fluorescence signal of 50 fmol / L -1 miRNA-222 remained almost unchanged, indicating that the designed fluorescence biosensor is stable. In addition, in this step, the temperature signal of 10 pmol / L -l miRNA-222 was recorded by continuously switching the 808 nm near-infrared laser 5 times to investigate the stability of the sensor. From the investigation results, the temperature of the sensor did not change significantly, indicating that the sensor has good short-term stability.

[0193] (2) Investigation of long-term stability:

[0194] Based on the method for investigating short-term stability, fluorescence and photothermal tests were performed every week for four consecutive weeks. The investigation results are as Figure 6 shown.

[0195] As can be seen from Figure 6 , the fluorescence signal and temperature remained basically unchanged after 4 weeks, indicating that the fluorescence / photothermal sensor has good long-term stability.

[0196] (3) Investigation of selectivity:

[0197] At 5 pmol / L -1 Using miRNA-222 as the experimental group, and miRNA-21, miRNA-155, miRNA-141, miRNA-122, miRNA-let-7a (all purchased from Sangon Biotech (Shanghai) Co., Ltd.) and their mixture as the control group, the fluorescence intensity and temperature were continuously measured 3 times, and the test results are as Figure 6 shown.

[0198] It can be seen from the figure that when a single interfering substance or a mixture is added, the maximum changes in fluorescence intensity and temperature do not exceed 8%. This indicates that the dual-mode biosensor has good specificity and good feasibility in practical applications.

[0199] In summary, the present invention constructs a fluorescence / photothermal dual-mode sensor based on Ag@Au NPRs with good photothermal properties, CdTe QDs with strong fluorescence signals, Fe 3 O 4 @SiO 2 nanomaterials and an entropy-driven DNA molecular machine signal amplification strategy capable of specifically binding to miRNA; the fluorescence / photothermal dual-mode sensor detects low concentrations of target substances through two response signals, which is beneficial to eliminating environmental impacts and uncontrollable factors, and effectively improving the reliability and accuracy of detection results; the fluorescence detection range of the fluorescence / photothermal dual-mode sensor is 1 fM - 50 pM, the detection limit is 0.34 fM, the photothermal detection range is 1 pM - 1 nM, and the detection limit is 0.5 pM; the construction method of the fluorescence / photothermal dual-mode sensor is simple, the detection is convenient and fast, the selectivity is strong, it has good practicability, and has good application in detecting miRNA.

[0200] The above embodiments are the preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Without departing from the essence of the present invention, any obvious improvements, substitutions or variations that those skilled in the art can make all belong to the protection scope of the present invention.

Claims

1. A fluorescence / photothermal dual-mode sensor based on entropy-driven DNA molecular machine, characterized in that: The fluorescence / photothermal dual-mode sensor includes a photothermal detection unit Ag@Au-ssDNA for entropy-driven DNA molecular machine signal amplification, a fluorescence detection unit for entropy-driven DNA molecular machine signal amplification, and a superparamagnetic unit Fe3O4@SiO2-eDNA; The photothermal detection unit Ag@Au-ssDNA is assembled by Ag@Au NPRs and thiol-modified DNA chains S1 and S2 respectively; The fluorescence detection unit is assembled from Ag@Au-ssDNA and CdTe QDs-pDNA; the CdTe QDs-pDNA is assembled from nanosheet-shaped CdTe QDs and a DNA chain P modified with amino groups; The superparamagnetic unit Fe3O4@SiO2-eDNA is assembled from amino-functionalized Fe3O4@SiO2 of a spherical core-shell structure and a DNA chain E modified with a carboxyl group.

2. The fluorescence / photothermal dual-mode sensor based on entropy-driven DNA molecular machine according to claim 1, characterized in that: The Ag@Au NPRs present a triangular core-shell structure, and the nucleotide sequence of the thiol-modified DNA chain S1 is SH-TTTTTACACCTACACGTCTACTGAGAAAGCTACATC (SEQ ID NO: 1); the nucleotide sequence of S2 is AATTCTCAGTAGACGTGTATTTTTT-SH (SEQ ID NO: 2); The nucleotide sequence of the amino-modified DNA chain P is NH2-TTTTTTCAGTAGACGTGTAGGTGT (SEQ ID NO: 3); The nucleotide sequence of the carboxyl-modified DNA chain E is COOH-TTTTTTTTTTCCAGATGTAGCTTTCTCAGTAGA (SEQ ID NO: 4).

3. The method for constructing the fluorescence / photothermal dual-mode sensor according to claim 1 or 2, characterized in that: The construction method comprises: (1) Construction of the photothermal detection unit Ag@Au-ssDNA for entropy-driven DNA molecular machine signal amplification: Mix water, polyvinyl pyrrolidone (PVP), ascorbic acid (AA), NaOH and Na2SO3, add gold growth solution thereto, stir and mix to obtain a mixed solution, add Ag NPRs (silver nanoplate) solution to the mixed solution, stir and mix to obtain a mixed solution, and then stand overnight to obtain Ag@Au NPRs; Ag@Au NPRs were assembled with DNA chain S1 with thiol groups modified on the surface to obtain Ag@Au-S1; Ag@Au NPRs were assembled with DNA chain S2 with thiol groups modified on the surface to obtain Ag@Au-S2; Mixing Ag@Au-S1 and Ag@Au-S2 to obtain the photothermal detection unit Ag@Au-ssDNA; (2) Construction of superparamagnetic unit Fe3O4@SiO2-eDNA: Fe3O4@SiO2, ethanol and 3-aminopropyltriethoxysilane (APTES) were vigorously stirred and mixed to obtain a mixture and reacted 1. After the reaction, the mixture was centrifuged and washed to obtain amino-functionalized Fe3O4@SiO2, which was recorded as Fe3O4@SiO2-NH2; Fe3O4@SiO2-NH2 was dispersed in water to obtain a Fe3O4@SiO2-NH2 solution; Activate the DNA chain E with carboxyl groups, then add Fe3O4@SiO2-NH2 solution to it and carry out reaction 2. After the reaction is completed, magnetic separation and washing are performed to obtain superparamagnetic unit Fe3O4@SiO2-eDNA, which is stored for later use; (3) Construction of CdTe QDs-pDNA: Activate the carboxyl groups on the surface of CdTe QDs, then add a DNA chain P with an amino group thereto and perform an amidation reaction. After the reaction is completed, centrifuge and wash to obtain a fluorescence detection unit CdTe QDs-pDNA, which is stored for later use; (4) Construction of fluorescence / photothermal dual-mode sensor: Assembling the photothermal detection unit Ag@Au-ssDNA, the superparamagnetic unit Fe3O4@SiO2-eDNA and CdTe QDs-pDNA to obtain the fluorescence / photothermal dual-mode sensor; Among them, steps (1) to (3) are not in any particular order.

4. The method for constructing a fluorescence / photothermal dual-mode sensor according to claim 3, characterized in that: In step (1), the usage ratio of water, polyvinyl pyrrolidone, ascorbic acid, NaOH and Na2SO3, gold growth solution and Ag NPRs solution is 2.5-3mL: 1-2mL: 200μL: 200μL: 30-50μL: 3-4mL: 2mL; The concentration of the PVP is 5wt% and the molecular weight is Mw 30000; The concentrations of AA and NaOH were both 0.4-0.6 M; The concentration of Na2SO3 is 0.1M; The concentration of the gold growth solution was 1.25 mM HAuCl4; The concentration of Ag NPRs solution is 0.94*10 -5 M.

5. The method for constructing a fluorescence / photothermal dual-mode sensor according to claim 3, characterized in that: In step (2), the dosage ratio of Fe3O4@SiO2, ethanol and 3-aminopropyltriethoxysilane is 4-6 mg: 20-40 mL: 40-60 μL; the conditions of reaction 1 are: reacting at 80°C for 2-4 hours; The activation step comprises: adding EDC and NHS to the DNA chain E with carboxyl groups and reacting at 25° C. for 3 hours for activation; The dosage ratio of activated carboxyl-containing DNA chain E and Fe3O4@SiO2-NH2 was 50 μL:1 mL, where the concentration of Fe3O4@SiO2-NH2 was 5 mg / mL; The conditions of reaction 2 are: reaction at 25° C. for 4 hours.

6. The method for constructing a fluorescence / photothermal dual-mode sensor according to claim 3, characterized in that: In step (3), the ratio of the activated CdTe QDs to the amino-containing DNA chain P is 500 μL:50 μL; The conditions for the amidation reaction were: reaction at 25°C for 3 h.

7. The method for constructing a fluorescence / photothermal dual-mode sensor according to claim 3, characterized in that: In step (4), the dosage ratio of the photothermal detection unit Ag@Au-ssDNA, the superparamagnetic unit Fe3O4@SiO2-eDNA and the CdTe QDs-pDNA is 1:1:

1.

8. Use of the fluorescence / photothermal dual-mode sensor according to claim 1 or 2 in detecting miRNA.

9. The use according to claim 8, characterized in that: The miRNA includes miRNA-222.

10. The use according to claim 9, characterized in that the application include: The photothermal detection unit Ag@Au-ssDNA and the superparamagnetic unit Fe3O4@SiO2-eDNA in the above-mentioned fluorescence / photothermal dual-mode sensor are mixed, and the Output DNA and the substrate chain Scaffold are added thereto to perform photothermal detection of miRNA-222. After the detection, CdTe QDs-pDNA is added thereto, and the photothermal detection unit Ag@Au-ssDNA and the CdTe QDs-pDNA bases are complementary paired to perform fluorescence detection of miRNA-222. The sequence of the Output DNA is ATTGTCAAATCTACTGAGAAAGCTACATCTGGCTAC (SEQ ID NO: 5); The sequence of the substrate chain Scaffold is: ACCCAGTAGCCAGATGTAGCTTTCGTAGCCAGATGTAGCTTTC (SEQ ID NO: 6).

Images