SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 13 and related to right nipple number character and application of SNP molecular marker

Abstract

The invention belongs to the technical field of molecular biotechnology and molecular markers, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker located on a pig chromosome 13 and related to the right nipple number character and application. The site of the SNP marker is the 132654738th nucleotide site of the 132654738th nucleotide site of the 13th chromosome of the international pig reference genome version 11.1, and the basic group of the site is G or A. By optimizing the dominant alleles of the SNP, the frequency of the dominant alleles can be increased generation by generation, the number of right nipples of pigs can be increased, the lactation capacity of sows can be improved, the weaning survival rate of piglets can be increased, excellent breeding pigs with the characters can be bred, the genetic improvement progress of the pigs can be accelerated, and the economic benefits of breeding of the breeding pigs can be effectively improved.

Description

Technical Field

[0001] The present invention belongs to the fields of molecular biotechnology and molecular marker technology, and relates to an SNP molecular marker located on porcine chromosome 13 and related to the right teat number trait and its application. Background Art

[0002] Pork is an important source of meat for humans. Since the 1980s, pork has always been the main meat on the tables of urban and rural residents, and pork consumption has always accounted for more than 60% of meat consumption, occupying a dominant position.

[0003] The huge demand for pork is mainly because it can provide a large amount of essential proteins for humans. The reproductive performance of pigs is much higher than that of cattle and sheep, so the price of pork is relatively low. The high reproductive performance of pigs is mainly manifested by a large litter size. The average litter size has exceeded 11, while the average litter size of cattle and sheep is only 1-2.

[0004] PSY refers to the number of weaned piglets that each sow can provide per year, and it is an important indicator reflecting the production performance of sows and affecting the price of pork. In production, sows with more teats have higher production performance, can nurse more piglets, and their piglets have higher uniformity and weaning survival rate. Therefore, sows with more teats often have higher PSY and greater economic benefits. It is particularly important to deeply analyze the genetic mechanism of pig teat number.

[0005] The teat number of a sow refers to the total number of teats extending from the chest of the sow to the rear end of the abdomen, which can be divided into the left teat number and the right teat number. Generally, 1-2 days after the piglets are born, breeding enterprises will screen according to factors such as the teat number and weight of the piglets. Piglets with more teats and greater weight are reserved as breeding pigs, and the rest are used as commercial pigs.

[0006] The teat number is an important indicator reflecting the reproductive performance of sows. The more teats, the higher the reproductive performance, and vice versa. In recent years, due to the improvement of living standards, consumers' demand for high-protein meat has been increasing day by day, and the selection of pig teat number has been widely used in the genetic improvement of pig breeds. However, the teat number belongs to a quantitative trait controlled by multiple minor genes, and it is difficult to identify major genes. Molecular marker-assisted breeding has become a good choice for improving this trait.

[0007] At present, a number of candidate genes and QTLs related to teat number have been identified by using the candidate gene method and QTL mapping. The candidate genes include VRTN, SPRY4, FGF1, CPVL, etc. However, due to the certain randomness in the selection of candidate genes, they may be major genes or genes that indirectly affect the trait due to being in tight linkage disequilibrium with the actual QTL, which brings certain risks to livestock breeding.

[0008] In addition, the selection of the candidate gene method also has population heterogeneity; while the genetic distances of QTLs obtained by QTL mapping span a very large range, often containing hundreds of genes, which also greatly limits the application of QTL mapping methods in the genetic improvement of important economic traits in livestock.

[0009] Nowadays, Genome-wide Association Study (GWAS) has gradually shown unique advantages in the genetic improvement of complex traits, such as increasing the milk yield of dairy cows. Compared with the candidate gene method and QTL mapping, GWAS can more accurately locate and identify new genes, and can directly apply them to the genetic improvement of livestock animals, breaking through the bottleneck of molecular marker identification for important economic traits in pigs. Summary of the Invention

[0010] The object of the present invention is to overcome the deficiencies of the above-mentioned prior art, and provide an SNP molecular marker related to the right teat number trait located on porcine chromosome 13 and its application.

[0011] To achieve the above object of the invention, the present invention provides the following specific technical solutions:

[0012] In the first aspect, the present invention uses Genome-wide Association Study (GWAS) to screen and obtain an SNP molecular marker related to the right teat number trait located on porcine chromosome 13. The SNP locus of the SNP molecular marker corresponds to the G>A mutation at the 132,654,738th nucleotide site on chromosome 13 of the international porcine reference genome version 11.1, and the polymorphism of the base at this site affects the right teat number trait in pigs.

[0013] The SNP molecular marker can be named g.66 G>A.

[0014] Specifically, the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1. The 66th base M from the 5' end of the nucleotide sequence is G or A, resulting in differences in the right teat number in pigs.

[0015] Furthermore, the pigs in the present invention are Large White pigs and their synthetic lines; more preferably Danish Large White pigs and their synthetic lines.

[0016] In the second aspect, the present invention also provides the application of the SNP molecular marker, especially its application in identifying traits related to the right teat number in pigs.

[0017] The present invention further provides the application of the SNP molecular marker in pig genetic breeding, more specifically, its application in the genetic breeding of pig breeds with more right teat numbers, higher piglet nursing rates or higher piglet weaning survival rates.

[0018] In a third aspect, the present invention also provides a primer pair for detecting the SNP molecular marker, and the nucleotide sequences of the primer pair are as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0019] In a fourth aspect, the present invention also provides a kit for detecting the SNP molecular marker, which contains a primer pair with the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3, as well as necessary reagents for PCR amplification.

[0020] In a fifth aspect, the present invention provides a method for detecting traits related to the number of right nipples in pigs, which is to detect the SNP locus of the SNP molecular marker on porcine chromosome 13, and judge the traits related to the number of right nipples in pigs according to whether the single nucleotide at the SNP locus is G or A; among them, the average number of right nipples in pigs with the GG genotype is higher than that in pigs with the AG and AA genotypes.

[0021] In a sixth aspect, the present invention also provides a method for screening pig breeds with multiple right nipples, high piglet nursing rate or high piglet weaning survival rate by using the SNP molecular marker related to the number of right nipples on porcine chromosome 13, which is to detect the SNP molecular marker on porcine chromosome 13, and eliminate individuals with the AG and AA genotypes according to the SNP locus of the SNP molecular marker, and retain individuals with the GG genotype as breeding pigs.

[0022] The above method specifically includes the following steps:

[0023] 1) Extract the genomic DNA of the pig to be tested;

[0024] 2) Use the primer pair or the primer pair in the kit as amplification primers, and use the genomic DNA of the pig to be tested as template DNA for PCR amplification to obtain a PCR amplification product;

[0025] 3) Sequence the PCR amplification product to obtain a sequencing result;

[0026] 4) Based on the sequencing result, determine the SNP marker genotype of the pig to be tested.

[0027] In a seventh aspect, the present invention also provides a genetic improvement method for improving the reproductive performance of pigs, which is to determine the SNP molecular marker related to the number of right nipples on chromosome 13 of breeding pigs in the core breeding population, and make corresponding selections according to the molecular marker: select breeding pig individuals with the GG genotype at position 132654738 on chromosome 13 of the international pig reference genome version 11.1 in the core breeding population of breeding pigs, and eliminate breeding pig individuals with the AG or AA genotype at this locus, so as to gradually increase the frequency of allele G at this locus and increase the number of right nipples of the offspring pigs.

[0028] The breeding pigs described above include Yorkshire pigs and their synthetic lines.

[0029] The present invention has studied and determined SNP molecular markers located on the nucleotide sequence of porcine chromosome 13 that affect traits related to the number of right nipples in pigs, verified their effects on the number of right nipples, and established an efficient and accurate molecular marker-assisted breeding technology, which is applied to the genetic improvement of increasing the number of right nipples in breeding pigs, improving the lactation ability of offspring pigs and the weaning survival rate of piglets.

[0030] Using the primer pair and kit for detecting the SNP molecular marker constructed by the present invention, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select and breed for the number of right nipples trait, accelerating the breeding process.

[0031] By preferentially selecting the dominant alleles of the SNP molecular marker, the present invention can gradually increase the frequency of dominant alleles, increase the number of right nipples in breeding pigs, breed excellent breeding pigs with the trait of multiple right nipples, accelerate the progress of pig genetic improvement, and thus effectively improve the economic benefits of pig breeding. Description of the Drawings

[0032] Figure 1 It is a Manhattan plot of single-locus genome-wide association analysis (GWAS) using the GCTA software for the trait of the number of right nipples on chromosome 13 of Danish Yorkshire pigs; wherein: x The x-axis represents the chromosome number of the pig; y The y-axis represents -log 10 P P value.

[0033] Figure 2 It is a Manhattan plot of multi-locus genome-wide association analysis using the FASTmrMLM model in the mrMLM software for the trait of the number of right nipples on chromosome 13 of Danish Yorkshire pigs; wherein: x The x-axis represents the chromosome number of the pig; the main y The y-axis represents -log 10 P P value, and the secondary y y-axis represents the LOD value.

[0034] Figure 3 It is a Manhattan plot of multi-locus genome-wide association analysis using the FASTmrEMMA model in the mrMLM software for the trait of the number of right nipples on chromosome 13 of Danish Yorkshire pigs; wherein: x The x-axis represents the chromosome number of the pig; the main y The y-axis represents -log 10 P P value, and the secondary y y-axis represents the LOD value.

[0035] Figure 4 It is a diagram for analyzing the phenotypic differences in the number of right nipples of pigs with different genotypes. Embodiment

[0036] The following further describes in detail the specific embodiments of the present invention in conjunction with the accompanying drawings and examples. The following examples are only used to more clearly illustrate the technical solutions of the present invention, so that those skilled in the art can well understand and utilize the present invention, rather than limiting the protection scope of the present invention.

[0037] In the embodiments of the present invention, for the production processes, experimental methods or detection methods involved, unless otherwise specified, they are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the art, and are very clear and definite in the relevant application fields. Those skilled in the art can understand the conventional process steps according to the names and apply the corresponding equipment, and implement them under conventional conditions or the conditions recommended by the manufacturer.

[0038] For various instruments, equipment, raw materials or reagents used in the embodiments of the present invention, there are no special restrictions on the sources. They are all conventional products that can be obtained through regular commercial channels, and can also be prepared according to the conventional methods well-known to those skilled in the art.

[0039] The number of nipples is an important indicator reflecting the reproductive performance of breeding pigs, and the selection of the number of nipples in breeding pigs is widely used in the genetic improvement of pig breeds. The present invention uses genome-wide association study (GWAS) to detect the genetic marker polymorphisms of an experimental pig population at the genome-wide level to obtain genotypes, and conducts population-level statistical analysis with phenotypes, and screens the SNP loci most likely to affect the nipple number trait according to significance tests.

[0040] After screening, the present invention discovers a nucleotide polymorphism locus located on porcine chromosome 13 corresponding to position 132654738 of the 11.1 version of the international pig reference genome, where a G>A mutation occurs. The right nipple number of pig individuals with the GG genotype at this locus is higher than that of pig individuals with other genotypes.

[0041] Based on this, the embodiments of the present invention disclose an SNP molecular marker related to the trait of porcine right nipple number, including a nucleotide sequence formed by a single nucleotide polymorphism with a G>A mutation at position 132654738 on chromosome 13 of the 11.1 version of the international pig reference genome.

[0042] More specifically, the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, where M in the sequence is G or A.

[0043] An embodiment of the present invention also discloses a primer pair for detecting the SNP molecular marker. The primer pair comprises primer P001-F and primer P002-R, and their nucleotide sequences are as follows:

[0044] P001-F: 5'-GGAAGACACAGCTACAGG-3',

[0045] P002-R: 5'-TTATGAGCAGCGAAACTTG-3'.

[0046] An embodiment of the present invention also discloses a kit, which contains the above-mentioned primer pair and necessary reagents for PCR amplification.

[0047] In the following embodiments of the present invention, the SNP molecular marker is used for genetic breeding improvement of pigs. Specifically, genomic DNA of pig individuals is extracted, and the genomic DNA is subjected to PCR amplification and sequencing using the primer pair. Based on the sequencing results, the genotype at nucleotide position 132654738 on chromosome 13 of the international pig reference genome version 11.1 is determined. Individuals with the GG genotype are selected as breeding pigs, and individuals with the AG or AA genotype are eliminated to gradually increase the frequency of allele G at this locus and improve the number of right nipples in offspring pigs. Example

[0048] Example 1: Phenotypic determination of experimental objects and collection of DNA samples

[0049] 1) Experimental animals

[0050] The experimental pig population used in this experiment is the core population of Danish Large White sows of a company in Shaanxi. A total of 560 Danish Large White sows in this core population are selected, and the pedigree records of the population are detailed.

[0051] The pigs in this experimental population are fed and watered freely, and the feeding methods, breeding conditions, etc. are conventional methods and remain consistent all the time.

[0052] 2) Phenotypic determination

[0053] The number of right nipples of 560 Danish Large White sows is determined manually on-site. The number of right nipples is the total number of right nipples.

[0054] 3) Collection of pig tissue samples

[0055] To extract DNA, ear samples of the above 560 Danish Large White sows are collected and stored in a -80°C refrigerator for subsequent whole-genome resequencing.

[0056] Example 2: Whole-genome resequencing and genome-wide association analysis

[0057] I. Whole-genome resequencing

[0058] The whole-genome resequencing data of 560 Danish Large White pigs were all completed by BGI Shenzhen Co., Ltd. The specific methods and steps include:

[0059] 1) Send the ear samples of 560 Danish Large White sows in Example 1 to BGI Shenzhen Co., Ltd. to extract DNA;

[0060] 2) Construct a library: Randomly break the qualified DNA for fragmentation; then through steps such as DNA fragment end repair, addition of the 3' end of ployA, configuration of sequencing adapters, and amplification by PCR instrument, a sequencing library is obtained;

[0061] 3) Sequencing on the machine: Perform whole-genome resequencing on the DNBSEQ-T7 platform of BGI. The average sequencing depth is 15.6×, and the original sequencing data in the FASTQ format is obtained.

[0062] II. Analysis of whole-genome resequencing data

[0063] 1) Use the Fastp software (version 0.20.1) to perform quality control on the original sequencing data obtained in Step 1, including deleting low-quality sequences, etc., to obtain the quality-controlled sequencing data in the FASTQ file format;

[0064] 2) Use the BWA-mem module in the BWA software (version 0.7.15) to align the quality-controlled sequencing data to the Sscrofa 11.1 pig reference genome to obtain the aligned SAM file;

[0065] 3) Use the Germline module of the Clara Parabricks software (version 4.0.1) to sort, mark duplicate sequences, re-correct base quality values, detect mutations, and perform mutation quality control on the aligned SAM file to obtain the final mutation result VCF file, which contains 678,204 SNP mutation sites.

[0066] III. Single-locus genome-wide association (GWAS) analysis

[0067] Select the GCTA software developed by Professor Jian Yang et al. from the School of Life Sciences, Westlake University for single-locus GWAS analysis. Specifically, the following univariate mixed linear model is used for GWAS between mutation sites and traits:

[0068] y =a + b x + g + e

[0069] Among them, y is the phenotype, a is the mean term, b is the additive effect (fixed effect) of the candidate SNP to be tested for association,x It is an SNP genotype indicator variable encoded as 0, 1, or 2, g is the polygenic effect (random effect), that is, the cumulative effect of all SNPs (captured by the GRM calculated using all SNPs), and e is the residual.

[0070] For ease of calculation, the genetic variance var(g) is estimated based on the null model, that is y = a + g + e, and then it is fixed when testing the association between each SNP and the trait.

[0071] The specific single-locus genome-wide association (GWAS) analysis method is as follows:

[0072] 1) Use PLINK 2.0 to convert the VCF file containing the final variant results obtained in the second step into the PLINK format (.fam,.bim,.bed);

[0073] 2) Use the GCTA software to convert the PLINK format file into the GRM format as the genotype file, and extract the number of right nipples in the original phenotype file as the phenotype file; use the GCTA software, select the --pca parameter, input the genotype file in the GRM format, calculate the PCA and take the first three principal components, and extract the gender, batch of the individuals corresponding in the original record, and the first three principal components of the calculated PCA as the covariance file;

[0074] 3) Prepare the genotype, phenotype, and covariance files in the format required by the GCTA software, and input them into the software to obtain the significant locus results; among them, the genome-wide significant threshold is 0.05 divided by the total number of SNP loci, that is, the genome-wide significant level threshold is 0.05 / 678204, that is, 7.37E-08; the chromosome-level significant threshold is 1 divided by the total number of SNP loci, that is, the chromosome-level significant level threshold is 1 / 678204, that is, 1.47E-06.

[0075] The results of the single-locus GWAS analysis are as Figure 1 shown. It can be seen from the figure that there are SNP loci on chromosome 13 of Danish Large White pigs that significantly affect the number of right nipples, corresponding to the G>A mutation at position 132654738 on chromosome 13 of the reference sequence of the international pig reference genome version 11.1 (g.66 G>A at nucleotide 66 in SEQ ID NO.1, named g.66 G>A) (p-value is 8.14E-08).

[0076] IV. Multi-locus GWAS analysis

[0077] The FASTmrMLM and FASTmrEMMA models from the mrMLM software package developed by Professor Yuan-Ming Zhang of Huazhong Agricultural University were selected for multi-locus GWAS analysis. The specific methods are as follows:

[0078] 1) Use PLINK2.0 to convert the VCF file containing the final variant results obtained in step 2 into PLINK format (.fam,.bim,.bed) as the genotype file;

[0079] 2) Extract the number of right nipples in the original phenotype file as the phenotype file, and extract the gender, batch of the individuals corresponding in the original records, and the first three principal components of PCA calculated by the GCTA software as the covariance file;

[0080] 3) Prepare the genotype, phenotype, and covariance files in the format required by the software, and input them into the software to obtain the significant locus results. Among them, the significant threshold is that the LOD value is equal to 3.

[0081] The results of the multi-locus GWAS analysis are as shown in Figure 2 and Figure 3 It can be seen from the figure that there is a SNP locus on chromosome 13 of Danish Large White pigs that significantly affects the number of right nipples, corresponding to the G>A mutation at position 132654738 on chromosome 13 of the reference sequence of the international pig reference genome version 11.1 (g.66 G>A at the 66th nucleotide in SEQ ID NO.1, named g.66 G>A) (the LOD value of FASTmrMLM is 3.9897, and the LOD value of FASTmrEMMA is 16.4596).

[0082] V. Association analysis between different genotypes and the phenotype of the number of right nipples

[0083] Further combining the results of the above single-locus GWAS and multi-locus GWAS analysis, retain the same mutation loci that significantly affect the number of right nipples trait in both the single-locus GWAS and multi-locus GWAS analysis results. The results show that there is a mutation locus g.66 G>A on chromosome 13 that significantly affects the number of right nipples trait, and this mutation locus is focused on.

[0084] According to the analysis in Table 1 (the results of the number of right nipples are expressed as mean ± standard deviation SD), it can be seen that the SNP locus g.66 G>A is extremely significantly correlated with the number of right nipples trait (P < 0.001), indicating that the molecular marker corresponding to this SNP locus significantly affects the number of right nipples trait in pigs. By means of assisted selection of this SNP locus in pigs, the number of right nipples in this population can be increased, thereby improving the survival rate of piglets at weaning.

[0085] In addition, it can also be seen from Table 1 that the average number of right nipples in GG type is higher than that in AG and AA types, indicating that the homozygous AA is the most unfavorable for the number of right nipples. By Figure 4 further understanding, there are extremely significant differences between the homozygous AA and AG, GG genotypes, further indicating that the homozygous AA is the most unfavorable for the number of right nipples.

[0086] The number of right nipples is an important trait for measuring the reproductive performance of sows. A low number of right nipples means poor reproductive performance of sows and low weaning survival rate of piglets. Therefore, the reproductive performance of AA genotype sows is the worst. During the breeding process, AA and AG type breeding pigs need to be eliminated, and GG type breeding pigs need to be retained to gradually increase the frequency of allele G at this locus. At present, the frequency of the dominant allele in this population is only 2.77%, indicating that there is significant room for genetic improvement.

[0087]

[0088] Example 3: Amplification and sequencing of the target DNA sequence

[0089] 1) Primer design

[0090] Download the DNA sequence of SEQ ID NO.1 on chromosome 13 of pigs through the Ensembl website (http: / / asia.ensembl.org / index.html), and use the primer design software primer premier 6.0 to design primers, and entrust Sangon Biotech (Shanghai) Co., Ltd. to synthesize the primers.

[0091] The DNA sequences of the designed primers are as follows:

[0092] P001-F: 5’-GGAAGACACAGCTACAGG-3’ (SEQ ID NO.2);

[0093] P002-R: 5’-TTATGAGCAGCGAAACTTG-3’ (SEQ ID NO.3).

[0094] 2) PCR amplification

[0095] Add 1 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2×TagPCR StanMix with Loading Dye, and 0.3 μL of each of primers P001-F and P002-R to a 10 μL reaction system.

[0096] PCR reaction conditions: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 64.5°C for 30 s, extension at 72°C for 45 s, 35 cycles, and finally extension at 72°C for 5 min.

[0097] 3) DNA sequencing

[0098] The sequencing and identification of the DNA sequence was carried out by BGI Shenzhen. The gene fragment was sequenced in both forward and reverse reactions. The obtained sequence was compared with the NCBI genomic sequence to obtain the mutations at the corresponding SNP sites.

[0099] The sequencing results are as follows:

[0100] GGAAGACACAGCTACAGGTCTCTGACATCCATTCTCCCTTTCTATAGAGATATATCCATCCACCA M (G or A) GTTTCGCTGGGCATAATAAAGACTACATGTCCCTTTCTATAGAGATATATCCATCCACCAAGTTTCGCCGGCATAATAAAGACTACATGTCCCTTTCTATAGAGATATATCCATCCACCAAGTTTCGCTGCTCATAA (SEQ ID NO.1)

[0101] Note: The M marked in the sequence list is the mutation site, shown underlined (the mutated base is in parentheses, which is an allelic gene mutation), and the primer sequence positions are shown in bold at the beginning and end of the sequence.

[0102] Example 4: Analysis of the effect of SNP site g.66 G>A of molecular marker

[0103] According to Table 1 and Figure 4 It can be seen that for the number of right nipples, the effect of the dominant allele genotype (GG) of SNP site g.66 G>A is significantly higher than that of the AA genotype by an average of 0.87 nipples per head. The more nipples a sow has, the higher the uniformity of piglets, the nursing rate of piglets, the weaning survival rate, etc. will be. This will greatly reduce the economic losses in farming and create wealth for enterprises.

[0104] In the SNP molecular marker individuals of the present invention, by preferentially selecting the dominant allele (G) of this SNP in Danish Large White pigs, the economic benefits of commercial pigs can ultimately be improved and the enterprise income can be increased.

[0105] The present invention detects the mutation site of the 66th base in the SEQ ID NO.1 sequence and preliminarily applies the correlation analysis between its genotype and the trait of the number of right nipples in pigs, providing a new molecular marker for molecular marker-assisted selection in pigs.

[0106] The above embodiments of the present invention do not describe all details in detail, nor do they limit the present invention to only the above-described embodiments. All changes, modifications, substitutions, and variations made to these embodiments by those of ordinary skill in the art without departing from the principles and spirit of the present invention shall be included within the protection scope of the present invention.

Claims

1. A SNP molecular marker located on chromosome 13 of pigs and associated with the right nipple number trait, wherein the SNP site of the SNP molecular marker corresponds to the G>A mutation at the 132654738th nucleotide site of chromosome 13 of the international pig reference genome version 11.1, and the polymorphism of the base at this site affects the right nipple number trait of pigs.

2. The SNP molecular marker according to claim 1, wherein the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, and the 66th base M of the nucleotide sequence from the 5' end is G or A.

3. Use of the SNP molecular marker according to claim 1 or 2 in identifying traits related to the number of right nipples in pigs.

4. Use of the SNP molecular marker according to claim 1 or 2 in screening genetic breeding of pig breeds with more right nipples, higher piglet feeding rates or higher piglet weaning survival rates.

5. A primer pair for detecting the SNP molecular marker according to claim 1 or 2, wherein the nucleotide sequence of the primer pair is shown as SEQ ID NO.2 and SEQ ID NO.

3.

6. A kit for detecting the SNP molecular marker according to claim 1 or 2, comprising a primer pair of the nucleotide sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 according to claim 3.

7. A method for detecting traits related to the number of right nipples of a pig, comprising detecting the SNP site of the SNP molecular marker of claim 1 on chromosome 13 of the pig, and judging the traits related to the number of right nipples of the pig according to whether the single nucleotide at the SNP site of the SNP molecular marker is G or A; wherein: The average right teat number of GG genotype pigs was higher than that of AG and AA genotype pigs.

8. A method for screening pig breeds with more right nipples, higher piglet feeding rate or higher piglet weaning survival rate using the SNP molecular markers associated with the right nipple number trait located on pig chromosome 13 as claimed in claim 1 or 2, characterized in that Detect the SNP molecular marker described in claim 1 on pig chromosome 13, eliminate individuals with genotypes AG and AA according to the SNP site of the SNP molecular marker, and retain individuals with genotype GG as breeding pigs; wherein the average right nipple number of GG genotype pigs is higher than the average right nipple number of AG and AA genotype pigs.

9. The method according to claim 8, characterized in that The following steps are involved: 1) Extract genomic DNA from the pig to be tested; 2) using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 as amplification primers, and performing PCR amplification using the genomic DNA of the pig to be tested as template DNA to obtain a PCR amplification product; 3) sequencing the PCR amplification product to obtain a sequencing result; 4) Based on the sequencing results, determining the genotype of the SNP marker of claim 1 or 2 of the pig to be tested.

10. A genetic improvement method for improving pig reproductive performance, characterized in that Determine the SNP molecular marker associated with the right nipple number trait located on chromosome 13 as described in claim 1 of the breeding pigs in the breeding pig core group, and make corresponding selections based on the molecular markers: select breeding pig individuals with the GG genotype at position 132654738 on chromosome 13 of the international pig reference genome version 11.1 in the breeding pig core group, and eliminate breeding pig individuals with the AG or AA genotype at the position to increase the frequency of the allele G at the position from generation to generation, thereby increasing the right nipple number of offspring pigs; the breeding pigs include Large White pigs and their synthetic lines.

Images