Drug combined preparation of chlorbuconazole and pharmaceutically acceptable salt thereof and proline hydroxylase inhibitor

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a combined preparation of chlorbuconazole or pharmaceutically acceptable salt thereof and a proline hydroxylase inhibitor medicine. The combined use of the chlorbuconazole and the proline hydroxylase inhibitor drug can activate the expression of the downstream target gene of the HIF-2alpha, and a synergistic effect is shown. In a cisplatin-induced renal anemia model, the chlorprazole acid can enhance the effect of the proline hydroxylase inhibitor on treating renal anemia.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a pharmaceutical combination preparation of lofibazam and its pharmaceutically acceptable salts and prolyl hydroxylase inhibitors. Background Art

[0002] The target genes of HIF are very extensive and can affect the body's hematopoietic function, angiogenesis, iron ion transport, glucose utilization, resistance to oxidative stress, cell differentiation, cell survival and apoptosis, extracellular matrix homeostasis, and tumorigenesis. HIF is a heterodimer composed of α and β subunits. The α subunit belongs to the functional subunit, is very sensitive to changes in intracellular oxygen concentration and is highly regulated, and has the effect of regulating HIF activity; the β subunit is a structural subunit, also known as aryl hydrocarbon receptor nuclear transporter protein (ARNT), which is stably expressed in cells, and the mRNA transcription and protein expression levels are not affected by changes in oxygen concentration. Both the α and β subunits of HIF belong to the members of the basic helix-loop-helix transcription factor superfamily. There are three subtypes of human HIFα: HIF-1α, HIF-2α, and HIF-3α. Among them, HIF-2α is locally distributed and plays an important role in the process of gene expression and synthesis of EPO (erythropoietin) in renal tissue. In addition, it also improves the absorption of iron in the intestine by upregulating the expression of cytochrome and divalent metal transporter-1 in the duodenum, and has the effect of reducing the expression of hepatic bactericidal peptide, playing a leading role in the iron metabolism process. Therefore, HIF-2α plays a certain role in the hypoxic response process.

[0003] The HIF-2α subunit belongs to the Per-ARNT-Sim (PAS) subfamily in the basic helix-loop-helix (bHLH) family, mainly including the bHLH (DNA Bonding Domain, DBD, DNA binding region) at the N-terminus, and two adjacent PASA and PASB domains (Ligand Bonding Domain, LBD, ligand binding region); the C-terminus binds to transcriptional cofactors to regulate the transcription of downstream genes. It is found that there is a cavity of about inside the PASB domain of the HIF-2α subunit. After binding to the regulator, it can affect the formation of heterodimerization between the HIF-2α subunit and the ARNT subunit, thereby blocking or activating DNA binding and the transcription of target genes. The downstream target genes of HIF-2α such as vascular endothelial growth factor (VEGF), erythropoietin (EPO), cyclin (Cyclin1), and glucose transporter (GLUT1), etc., are related to kidney diseases, renal anemia, cardiovascular diseases, infections, cancers, etc.

[0004] In patients with kidney diseases, damaged kidney tissues can lead to EPO deficiency and insufficient iron homeostasis, thus causing renal anemia. Renal anemia not only severely reduces the quality of life of patients, but is also an important factor in the occurrence and increased mortality of cardiovascular diseases. Recombinant human erythropoietin (rHuEPO) or erythropoiesis-stimulating agents (ESAs) can treat renal anemia by increasing hemoglobin levels. However, a higher hemoglobin target in clinical trials is positively correlated with the risk of cardiovascular side effects. Currently, an emerging therapy for renal anemia is to pharmacologically inhibit prolyl hydroxylase PHD to stabilize HIF-2 protein, so as to stimulate the production of endogenous EPO in renal or non-renal tissues. However, the over-upregulated HIF-1α by PHD inhibitors promotes the inflammatory pathway, accelerates heart and kidney damage, and then leads to an increased risk of pulmonary hypertension and inflammation, while the activation of HIF-2α has a protective effect. Therefore, HIF-2α selective agonists may have more therapeutic advantages.

[0005] The typical pathological change of kidney disease is kidney fibrosis. Kyoung HK et al. found that long-term activation of HIF-2α helps to inhibit kidney fibrosis and improve renal function. Yu et al. found that in the early stage of administration of the PHD inhibitor L-mimosine, selectively activated HIF-1α would lead to an increase in the expression of the fibrosis factor CTGF and phosphorylated Smad, exacerbate macrophage infiltration and fibrosis in renal tissues; while in the middle and late stages, mainly activating HIF-2α upregulated the expression of EPO and VEGF and alleviated renal injury. Qu et al. confirmed that knocking out HIF-2α would lead to more severe kidney damage. To sum up, in acute and chronic kidney injuries, the over-activation of HIF-1α may exacerbate kidney damage, while HIF-2α plays a protective role.

[0006] Tafamidis (2-(3,5-dichlorophenyl)-1,3-benzoxazole-6-carboxylic acid) is a transthyretin stabilizer. Both Vyndamax and Vyndaqel are capsules for oral administration and contain tafamidis as the active ingredient. The U.S. Food and Drug Administration (FDA) has approved Vyndaqel and Tafamidis for the treatment of wild-type or hereditary transthyretin-mediated amyloid cardiomyopathy in adults to reduce cardiovascular mortality and cardiovascular-related hospitalizations. The EMA has approved Vyndaqel for the treatment of transthyretin amyloidosis in adult patients with stage I symptomatic polyneuropathy to delay peripheral nerve damage.

[0007] In 2001, it was found that prolyl hydroxylase (PHD) can use O2 and 2-OG as substrates to specifically hydroxylate the proline residues of HIFα, thereby regulating the biological activity of HIF. The catalytic cycle reaction of HIF-PHD starts when Fe 2+ and 2-OG are concentrated at the active site of PHD. Subsequently, PHD binds to the proline residue of HIFα and replaces the water molecule with O2 to complete hydroxylation. During the whole process, Fe 2+ , O2, and 2-OG are all indispensable factors. When the cells are in a hypoxic environment, the activity of PHD is inhibited due to the scarcity of O2. The undegraded HIF-1α and HIF-2α enter the nucleus and bind to HIF-β, act on HRE, and promote the expression of related genes.

[0008] Currently, there is no research on the combined use of lofibric acid and prolyl hydroxylase inhibitors. Summary of the Invention

[0009] Based on the discovery of the present invention, lofibric acid, as an HIF-2α agonist, promotes the formation of the HIF-2α / HIF-β dimer, can stabilize the binding of HIF-2α and HIF-β, shows an increase in the transcriptional activity of HIF-2α in cells, and further promotes the expression of target genes such as EPO and VEGF, thereby achieving the effect of treating diseases related to HIF-2α activity. The present invention proposes a drug combination of lofibric acid and its analogs or salts and prolyl hydroxylase (PHD) inhibitors. Through the combined use, it is found that the combination of the two (HIF-PHD) has a synergistic effect and can inhibit the degradation of HIF protein for the treatment of diseases mediated by HIF-2α.

[0010] On the one hand, the present invention provides a drug combination preparation, comprising lofibric acid or a pharmaceutically acceptable salt thereof and a prolyl hydroxylase inhibitor.

[0011] In some embodiments, the pharmaceutically acceptable salt of lofibric acid is an acid addition salt or a base addition salt.

[0012] In some embodiments, the pharmaceutically acceptable salt of lofibric acid is selected from at least one of the following structures:

[0013]

[0014]

[0015]

[0016] In some embodiments, the prolyl hydroxylase inhibitor includes one or more of roxadustat, daprodustat, vadadustat, enarodustat, and molidustat.

[0017] In some embodiments, the pharmaceutical combination further comprises a pharmaceutically acceptable excipient.

[0018] In some embodiments, in the pharmaceutical combination, the dosage ratio of lofibrazole to prolyl hydroxylase inhibitors is 1-20:10, preferably 2:1. In some embodiments, in the pharmaceutical combination, the dosage ratio of lofibrazole to prolyl hydroxylase inhibitors is 1:10, 2:10, 3:10, 4:10, 5:10, 6:10, 7:10, 8:10, 9:10, 10:10, 11:10, 12:10, 13:10, 14:10, 15:10, 16:10, 17:10, 18:10, 19:10 or 20:10.

[0019] In some embodiments, the pharmaceutical combination may further comprise cisplatin.

[0020] On the other hand, the present invention provides the use of the pharmaceutical combination as described above in the preparation of a medicament for preventing, alleviating or treating a disease associated with HIF-2α activity.

[0021] In some embodiments, the diseases associated with HIF-2α activity include hematopoietic disorders, anemia, local ischemic states and their sequelae related to surgery after surgery, wound healing of surgery, chronic kidney disease, cardiovascular disease, infection, inflammatory diseases, cancer, and damage to the health status occurring during cancer treatment, and sequelae of acute and prolonged focal cerebral ischemia states.

[0022] In some embodiments, the diseases associated with HIF-2α activity include renal anemia, primary anemia, anemia associated with tumor diseases, chemotherapy-induced anemia, anemia due to blood loss, iron deficiency anemia, vitamin deficiency anemia, hypoplasia and aplastic anemia, hemolytic anemia, anemia due to iron utilization disorders (iron refractory anemia) or due to other endocrine disorders (such as hypothyroidism), local ischemic states and their sequelae caused by cardiac interventions using cardiopulmonary machines (such as shunt surgery, cardiac valve transplantation), carotid artery interventions, aortic interventions, and interventions using instruments to open or penetrate the skull, primary glomerulonephritis, hypertensive renal arteriosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial lesions (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, hereditary nephropathy (polycystic kidney, hereditary nephritis), heart failure, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary, pulmonary and malignant hypertension, and peripheral arterial occlusive diseases, HIV infection, rheumatoid arthritis, diseases in the range of rheumatic forms and other disease forms regarded as autoimmune diseases after the use of cytostatic agents, antibiotics, and radiotherapy, and damage to the health status that occurs during the drug treatment of such diseases (such as stroke, birth asphyxia).

[0023] In some embodiments, the diseases associated with HIF-2α activity include anemia, ischemia, vascular diseases, angina pectoris, myocardial infarction, metabolic disorders, or cancer.

[0024] In some embodiments, the diseases associated with HIF-2α activity include renal anemia.

[0025] In some embodiments, the clobenic acid or its pharmaceutically acceptable salt, or the pharmaceutical combination preparation, prevents, alleviates, or treats diseases associated with HIF-2α activity by having an upregulating effect on the downstream genes regulated by HIF-2α.

[0026] In some embodiments, the downstream genes regulated by HIF-2α include vascular endothelial growth factor, erythropoietin, cyclin, and / or glucose transporter.

[0027] In some embodiments, the proline hydroxylase inhibitor is Roxadustat.

[0028] Beneficial effects:

[0029] Compared with the prior art, a certain embodiment of the present invention has at least one of the following beneficial effects:

[0030] The present invention's research found that in in vitro experiments, clobenic acid can effectively activate the transcription of HIF-2, EC50 was 1.11 μM, and the maximum activation efficiency was 225%.

[0031] In Hep3B, roxadustat can increase the expression of the erythropoietin (EPO) gene. When combined with the HIF-2α agonist, evofosfamide, evofosfamide can significantly increase the expression of the EPO gene with the increase in concentration.

[0032] Through a luciferase reporter gene assay, the present invention found that evofosfamide and its pharmaceutically acceptable salts, as HIF-2α agonists, promote the formation of a dimer of HIF-2α / HIF-β, can enhance the binding of HIF-2α and HIF-β, and have a significant effect of enhancing the transcriptional activity of HIF-2α. This activation effect may have potential therapeutic value for treating diseases such as ischemic diseases or anemia.

[0033] It was determined by RT-qPCR that evofosfamide has an upregulating effect on the downstream EPO gene regulated by HIF-2α, and shows a synergistic effect when combined with roxadustat. It indicates that evofosfamide and prolyl hydroxylase drugs can be combined to activate the expression of HIF-2α downstream target genes, and this activation effect may have potential therapeutic value for treating diseases such as ischemic diseases or anemia.

[0034] In the present invention, a rat model of renal anemia was induced by cisplatin. When 5 mg / kg / day roxadustat was administered for four weeks, compared with the cisplatin group, the increase in hemoglobin concentration (HGB) and red blood cell count (RBC) was not significant. When 10 mg / kg / day evofosfamide was simultaneously administered, HGB, RBC, and HCT (hematocrit) were all significantly increased. It shows that evofosfamide can further improve the symptoms of renal anemia when combined with roxadustat. In a cisplatin-induced renal anemia model, evofosfamide can enhance the effect of prolyl hydroxylase inhibitors in treating renal anemia, achieving an unexpected synergistic effect.

[0035] The present invention verifies through a series of experiments that the combined use of evofosfamide and roxadustat can be used to synergistically prevent and / or treat diseases related to HIF-2α activity, especially renal anemia.

[0036] Term Explanation

[0037] Certain embodiments of the present invention will now be described in detail, and examples thereof are illustrated by the accompanying structural formulas. The present invention is intended to cover all alternatives, modifications, and equivalent technical solutions, which are all included within the scope of the present invention as defined by the claims. Those skilled in the art should recognize that many methods and materials similar or equivalent to those described herein can be used to practice the present invention. The present invention is in no way limited to the methods and materials described herein. In the case where one or more of the incorporated documents, patents, and similar materials are different from or inconsistent with the present application (including but not limited to the defined terms, term applications, described technologies, etc.), the present application shall prevail.

[0038] It should be further recognized that certain features of the present invention, for the sake of clarity, are described in multiple separate embodiments, but can also be provided in combination in a single embodiment. Conversely, various features of the present invention, for the sake of brevity, are described in a single embodiment, but can also be provided separately or in any suitable sub-combination.

[0039] Unless otherwise specified, all scientific and technical terms used in the present invention have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. All patents and published publications related to the present invention are incorporated herein by reference in their entirety.

[0040] In the description of this specification, the description referring to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples", etc. means that the specific features, structures, materials, or characteristics described in connection with that embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0041] In the following content, whether or not words such as "about" or "approximately" are used, all the numbers disclosed herein are approximate values. There may be differences of 1%, 2%, 5%, 7%, 8%, 10%, 15%, or 20%, etc. for each numerical value. Whenever a number with a value of N is disclosed, any number with a value of N+ / -1%, N+ / -2%, N+ / -3%, N+ / -5%, N+ / -7%, N+ / -8%, N+ / -10%, N+ / -15%, or N+ / -20% will be explicitly disclosed, where "+ / -" means plus or minus.

[0042] Combination, which refers to a fixed combination in the form of a single dosage unit or a kit of parts for co - administration, wherein the compounds disclosed in the present invention and the combination partner can be administered independently at the same time or separately at certain time intervals, especially such that the combination partner exhibits cooperation, such as synergism. As used herein, terms such as "co - administration" or "combined administration" are intended to encompass the administration of the selected combination partner to a single individual (e.g., a patient) in need thereof, and are intended to include treatment regimens in which the substances need not be administered by the same route of administration or simultaneously.

[0043] As used herein, the term "drug combination" refers to a product obtained by mixing or combining more than one active ingredient, and includes both fixed combinations and non - fixed combinations of active ingredients. The term "fixed combination" means that the active ingredients, such as the compounds disclosed in the present invention, and the combination partner are administered to a patient simultaneously in the form of a single entity or dose. The term "non - fixed combination" means that the active ingredients, such as the compounds disclosed in the present invention, and the combination partner are both administered to a patient as separate entities simultaneously, jointly, or successively without a specific time limit, wherein such a mode of administration provides a therapeutically effective level of both compounds in the patient. The latter also applies to cocktail therapies, for example, the administration of three or more active ingredients. Brief Description of the Drawings

[0044] Figure 1 This is the result graph of the luciferase reporter gene experiment in Example 1 of the present invention. Among them, Figure A is the result graph of the agonistic activity of clofibric acid on HIF - 2 protein, and Figure B is the agonistic activity of meglumine clofibric acid (B) on HIF - 2 protein. In the figure, Luciferase assay: fluorescence detection. Efficacy: efficacy, concentration: concentration.

[0045] Figure 2 This is the result graph of the real - time fluorescence quantitative PCR detection in Example 2 of the present invention. The results show that in Example 2 of the present invention, real - time fluorescence quantitative PCR detects that the combination of clofibric acid and roxadustat up - regulates the transcription of the HIF - 2 downstream target gene EPO. In the figure, relative mRNA level: relative mRNA level; Vehicle: matrix.

[0046] Figure 3Detection result graph for Example 3. Among them, Figure A is a statistical graph of the effects of each group on the red blood cell count of rats with renal anemia in a cisplatin-induced renal anemia model; Figure B is a statistical graph of the effects of each group on the hemoglobin level in a cisplatin-induced renal anemia model; Figure C is a statistical graph of the effects of each group on the hematocrit in a cisplatin-induced renal anemia model. In Figure D, the kidney tissue images of rats induced by cisplatin in each group show that compared with the cisplatin group and when roxadustat is used alone, the combination of clofazimine and roxadustat significantly increases renal blood flow. Days: days. Detailed implementation manners

[0047] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and do not constitute any limitation to the present invention. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessarily confusing the concepts of the present disclosure. Such structures and technologies have also been described in many publications.

[0048] The reagents used in the present invention can all be purchased from the market or can be prepared by the methods described in the present invention.

[0049] Example 1: Luciferase reporter gene experiment

[0050] Experimental principle: 786-O is a renal cancer cell line that mainly expresses HIF-2α and lacks functional HIF-1α. This characteristic makes 786-O cells an ideal model for studying the transcriptional activity of HIF-2α and related signaling pathways. The luciferase reporter gene experiment obtains a 786-O monoclonal cell line that stably expresses the hypoxia response element (HRE) and luciferase (Luc) activity through puromycin screening. The HIF-2α agonist promotes the formation of a dimer of HIF-2α / HIF-β, activates the HRE promoter, and the activity of luciferase can be measured by detecting the intensity of fluorescence, thereby judging the ability of the HIF-2α agonist to promote transcription.

[0051] Experimental method: 6000 stably transfected 786-O cells stably containing HRE and Luc sequences were seeded in 96-well plates, and 100 μL of RPMI-1640 medium containing 10% fetal bovine serum was added to each well. After 24 h, the corresponding concentration of the compound was added to each well. A blank group was set as a control, and only the solvent DMSO was added to the wells of the blank group. In the initial screening of the compound, both obeticholic acid and obeticholic acid meglumine were tested at two concentrations of 2 μM and 20 μM. When measuring the concentration gradient, there were 3 replicates for each concentration. After co-incubation for 24 hours, the culture medium was discarded, and 20 μL of firefly luciferase reporter gene cell lysate (RG126M, Beyotime) was added to each well. The 96-well plate was placed on a microplate rapid oscillator and shaken for 10 min. After shaking, 10 μL of the lysate was aspirated and transferred to a white opaque plate, and then 10 μL of Steady-Lumi TM Firefly luciferase detection reagent (RG058S, Beyotime) was added to each well. Finally, it was placed in a microplate reader (Agilent Synergy Neo2) for luminescence detection. E 20 represents the effect of the 20 μM compound and was calculated as E 20 = fluorescence value of the 20 μM well ÷ fluorescence value of the blank × 100%. E2 represents the effect of the 2 μM compound and was calculated as E2 = fluorescence value of the 2 μM well ÷ fluorescence value of the blank group × 100%. EC 50 is the compound concentration when the agonist efficiency increases by 50% relative to the blank group. The agonist efficiency of the compound was determined by calculating the concentration (EC 50 ) required to achieve a 50% increase in fluorescence activity relative to the fluorescence value of the blank group and the maximum activation percentage (E max ). The maximum activation percentage (Emax) of the agonist is the ratio of the fluorescence value of the maximum effect (measured maximum response) induced when the agonist concentration reaches the receptor binding saturation state in a specific receptor system to the fluorescence value of the receptor system without the addition of the agonist, expressed as a percentage. In this experiment, obeticholic acid meglumine was directly replaced with Vyndaqel.

[0052] The detection results showed that the agonist efficiency of 20 μM obeticholic acid was 207% and that of 2 μM was 142%, indicating that the agonist efficiency of obeticholic acid increased with the increase in concentration, showing an obvious dose-dependence. The measured EC 50 of obeticholic acid was 1.11 μM, and E max was 225% ( Figure 1 A), indicating that obeticholic acid has strong agonist activity and good pharmacodynamic effects.

[0053] The agonistic efficiency of 20 μM of glucosamine clofibrate was 223%, and that at 2 μM was 122%, indicating that the agonistic efficiency of glucosamine clofibrate increased with the increase of concentration, showing an obvious dose-dependence. The measured EC 50 of glucosamine clofibrate was 0.97 μM, and the E max was 228% ( Figure 1 B), indicating that glucosamine clofibrate also had strong agonistic activity and good pharmacodynamic effects.

[0054] It can be seen that clofibrate and its pharmaceutically acceptable salts, as HIF-2α agonists, promote the formation of HIF-2α / HIF-β dimers, enhance the binding of HIF-2α and HIF-β, and further promote the transcription of HIF-2α downstream genes.

[0055] Example 2: Real-time fluorescence quantitative (qRT-PCR) experiment

[0056] Experimental method: Hepatoma cells HepG2 were inoculated onto 12-well plates. After 24 h, 10 μM of roxadustat, 1 μM of clofibrate, 5 μM of clofibrate, 10 μM of clofibrate, and 20 μM of clofibrate were added respectively, as well as 10 μM of roxadustat + 1 μM of clofibrate, 10 μM of roxadustat + 5 μM of clofibrate, 10 μM of roxadustat + 10 μM of clofibrate, and 10 μM of roxadustat + 20 μM of clofibrate. The cells were co-incubated with the compounds for 24 h. The vehicle group did not perform any operation. RNA extraction was performed using TRIZOL reagent. cDNA transcription was performed using the All-in-one TM First-Strand cDNA Synthesis Kit kit (for specific operation steps, please refer to the instruction manual). SYBR reagent was used for signal calibration, and GAPDH was used as an internal reference. The qRT-PCR primers were:

[0057] GAPDH_fwd, GCACCGTCAAGGCTGAGAAC;

[0058] GAPDH_rev, TGGTGAAGACGCCAGTGGA;

[0059] EPO_fwd, AACAATCACTGCTGACACTT;

[0060] EPO_rev, AGAGTTGCTCTCTGGACAGT.

[0061] The detection results are as Figure 2Shown: Based on the matrix, when used alone, 10 μM roxadustat upregulated the erythropoietin (EPO) gene by 1.5-fold, and 20 μM lofibrazole upregulated the EPO gene by 1-fold; different concentrations of lofibrazole had an upregulating effect on the expression of the EPO gene, indicating that lofibrazole could effectively activate the expression of HIF-2α downstream target genes. When different concentrations of lofibrazole were combined with 10 μM roxadustat, 10 μM roxadustat + 20 μM lofibrazole upregulated the EPO gene by 4.7-fold, showing a synergistic effect. It is indicated that lofibrazole and prolyl hydroxylase drugs can be used in combination to activate the expression of HIF-2α downstream target genes, and this activation effect may have potential therapeutic value for treating diseases such as ischemic diseases or anemia. Statistical analysis was performed using SPSS software. Compared with the non-drug group, *P < 0.05, **P < 0.01, ***P < 0.001. Compared with the 10 μM roxadustat group, # P < 0.05, ## P < 0.01, ### P < 0.001.

[0062] Example 3: A rat model of cisplatin-induced renal anemia

[0063] Male SD rats, after a one-week adaptation period, were given 6 mg / kg cisplatin by tail vein injection, and a second injection was given one week later. Two weeks later, the successful establishment of the kidney disease model was confirmed by measuring serum creatinine and urea levels. The successfully modeled rats were randomly divided into three groups: the cisplatin group (n = 6), the 5 mg / kg roxadustat group (n = 6), and the 5 mg / kg roxadustat + 10 mg / kg lofibrazole group (n = 6), and continuously administered for 4 weeks. The normal control group (n = 7) and the rats in the cisplatin group were given the solvent according to the same dosing regimen. After dosing, blood analysis (using Mindray automatic hematology analyzer BC-5150) was performed once a week. After sample collection, the rats were euthanized. Statistical significance was determined by one-way ANOVA, followed by Dunnett's test comparison with the cisplatin group (*P < 0.05, **P < 0.01, ***P < 0.001).

[0064] Hematological analysis in the fourth week showed as shown in Table 1 below,

[0065]

[0066] Result analysis: Table 1 and Figure 3 The results of A-3C indicate that lofibrazole further enhances the activity of roxadustat when used in combination with roxadustat.

[0067] Gross observation of kidney tissues ( Figure 3D) Display: The kidneys of the normal control group showed a healthy red color, while the kidneys of the cisplatin group showed obvious yellow discoloration. In contrast, 3 rats in the 5 mg / kg roxadustat group had red kidneys, and 5 rats in the 5 mg / kg roxadustat + 10 mg / kg clobenpropit group had red kidneys. This indicates that clobenpropit further improves the symptoms of renal anemia when used in combination with roxadustat.

[0068] In terms of the mechanism of action, roxadustat can inhibit the activity of prolyl hydroxylase, thereby stabilizing the HIF-2α protein. For HIF-2α to exert its regulatory effect on the transcriptional activity of downstream genes, it needs to form a stable dimer with HIF-β. In Example 1, it was clarified that clobenpropit, as an HIF-2α agonist, promotes the formation of the HIF-2α / HIF-β dimer, enhances the binding of HIF-2α and HIF-β, and thus promotes the transcription of the HIF-2α gene; through the combined use of clobenpropit and prolyl hydroxylase drugs in this Example 2, the transcription of the HIF-2α downstream EPO gene is enhanced; through the combined use of clobenpropit and the prolyl hydroxylase drug roxadustat in this Example 3, the pharmacodynamic activity of roxadustat is further enhanced. This research is of great significance for patients who only use roxadustat.

[0069] The method of the present invention has been described through preferred embodiments. It is obvious that relevant personnel can make changes or appropriate modifications and combinations to the methods and applications described herein within the content, spirit, and scope of the present invention to implement and apply the technology of the present invention. Those skilled in the art can draw on the content of this article and appropriately modify the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are all considered to be included in the present invention.

Claims

1. A drug combination preparation comprising clofazodone or a pharmaceutically acceptable salt thereof and a proline hydroxylase inhibitor.

2. The pharmaceutical combination preparation according to claim 1, characterized in that: The pharmaceutically acceptable salt of clofazodone is an acid addition salt or a base addition salt.

3. The pharmaceutical combination preparation according to claim 1, characterized in that: The pharmaceutically acceptable salt of clofazodone is selected from at least one of the structures:

4. The pharmaceutical combination preparation according to claim 1, characterized in that: The proline hydroxylase inhibitors include one or more of rosuvastat, dapnostat, valdustat, enastat, and molistat.

5. The pharmaceutical combination preparation according to claim 1, characterized in that: The pharmaceutical combination preparation further comprises a pharmaceutically acceptable excipient.

6. The pharmaceutical combination preparation according to claim 1, characterized in that: In the drug combination preparation, the dosage ratio of clofazodone to the proline hydroxylase inhibitor is 1 to 20:

10.

7. Use of the pharmaceutical combination preparation according to any one of claims 1 to 6 in the preparation of a drug for preventing, alleviating or treating diseases associated with HIF-2α activity.

8. The use according to claim 7, characterized in that The diseases associated with HIF-2α activity include hematopoietic disorders, anemia, surgery-related ischemic states and their continuous symptoms after surgery, surgical wound healing, chronic kidney disease, cardiovascular disease, infection, inflammatory diseases, cancer, and damage to health status during cancer treatment, or continuous symptoms of acute and prolonged cerebral ischemic states; Or, the diseases associated with HIF-2α activity include renal anemia, primary anemia, anemia associated with tumor diseases, chemotherapy-induced anemia, anemia caused by blood loss, iron deficiency anemia, vitamin deficiency anemia, dysplasia and aplastic anemia, hemolytic anemia, anemia caused by iron utilization disorder (iron loss anemia) or other endocrine disorders (such as hypothyroidism), cardiac intervention using heart-lung machine (such as bypass surgery, heart valve transplantation), carotid artery intervention, aortic intervention and intervention using instrument opening or penetrating the skull cap caused by ischemic state and its continuous symptoms, primary glomerulonephritis, hypertension renal arterioles sclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial diseases (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, hereditary renal diseases (polycystic kidney disease, hereditary nephritis), heart failure, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary, pulmonary and malignant hypertension and peripheral arterial occlusive disease, HIV infection, rheumatoid arthritis, after treatment with cytostatics, antibiotics and radiotherapy, diseases of the rheumatic form and other forms of diseases considered as autoimmune diseases, impairment of health status during drug treatment of such diseases (e.g. stroke, birth asphyxia); Or, the disease associated with HIF-2α activity includes anemia, ischemia, vascular disease, angina pectoris, myocardial infarction, metabolic disorder or cancer; or, the disease associated with HIF-2α activity includes renal anemia and / or renal disease.

9. The use according to claim 7, characterized in that: The drug combination preparation according to any one of claims 1 to 6 prevents, alleviates or treats diseases related to HIF-2α activity by upregulating downstream genes regulated by HIF-2α.

10. The use according to claim 9, characterized in that The downstream genes regulated by HIF-2α include vascular endothelial growth factor, erythropoietin, cell cycle proteins and / or glucose transporters.

Images