Hybridoma cell strain and monoclonal antibody for detecting or identifying MDV-1 and application of hybridoma cell strain and monoclonal antibody

Abstract

The invention belongs to the field of veterinary biotechnology detection, and particularly relates to a hybridoma cell strain and a monoclonal antibody for detecting or identifying MDV-1 and application of the hybridoma cell strain and the monoclonal antibody. The hybridoma cell strain MDV-1Mab-pp38-E2 is obtained through screening by taking pp38 protein of MDV-1 as immunogen, the preservation number is CCTCC NO: C202501, the monoclonal antibody generated by the hybridoma cell strain can recognize I-type chicken Marek's disease virus strains with different serum, and the monoclonal antibody can be used for identifying the type I chicken Marek's disease virus strains with different serum types. The kit has good specificity and sensitivity and can be used for exogenous virus detection of the serum type I chicken Marek's disease virus in poultry virus live vaccines without cross reaction with serum type II chicken Marek's disease virus, serum type III chicken Marek's disease virus, chicken egg drop syndrome virus (EDSV) and other common poultry disease viruses, and the kit has good specificity and sensitivity and can be applied to exogenous virus detection of the serum type I chicken Marek's disease virus in poultry virus live vaccines. The kit can also be used for clinical identification, virus content determination and epidemiological investigation of serotype I chicken Marek's disease virus.

Description

Technical Field

[0001] The present invention belongs to the field of veterinary biotechnology detection, and particularly relates to a hybridoma cell line and monoclonal antibody for detecting or identifying MDV-1 and their applications. Background Art

[0002] Marek disease (MD) is a highly contagious infectious neoplastic disease caused by Marek disease virus (MDV) in chickens, characterized by lymphoid tissue hyperplasia and tumor formation. MDV can be divided into three serotypes, namely MDV-1, MDV-2, and MDV-3. MDV-1 includes all oncogenic virulent strains (such as GA strain), artificially attenuated vaccine strains (such as CVI988, 814 strain), and MDV-1 vaccine strains lacking the meq gene, etc. MDV-2 is a non-pathogenic natural attenuated strain (such as SB-1); MDV-3 is turkey herpesvirus (HVT). In recent years, due to the presence of immunosuppressive diseases such as chicken infectious anemia and avian leukosis in chicken flocks, and the continuous enhancement of MDV virulence and the trend of evolving towards stronger virulence, although MD vaccines are widely inoculated in chicken flocks, MD still occurs, causing huge economic losses to the chicken farming industry.

[0003] Currently, the main method for detecting MDV is to detect MDV antibodies by agar diffusion test. However, for the antibody detection of MDV agar diffusion test, chicken serum must be obtained through the chicken inspection method for detection, which has problems such as time-consuming, high cost, low sensitivity of the method, and missed detection. This method is only used for detecting agar diffusion test antibodies, and cannot detect MDV antigens, let alone distinguish and identify MDV-1, MDV-2, and MDV-3.

[0004] The indirect immunofluorescence method (IFA) has the characteristics of rapidity, simplicity, sensitivity, specificity, and low cost, and has been included in the "Chinese Veterinary Pharmacopoeia" (Part III) for the antigen detection of avian reticuloendotheliosis virus (REV) and group I avian adenovirus (FadV-1). However, there is a lack of an IFA detection method for type I MDV. Screening monoclonal antibodies with high specificity and high sensitivity to type I MDV and realizing the IFA detection of type I MDV are particularly important in this field. Summary of the Invention

[0005] The object of the present invention is to provide a hybridoma cell line and monoclonal antibody for detecting or identifying MDV-1 and their applications, which specifically recognize MDV-1 and do not cross-react with other common avian disease viruses such as MDV-2, MDV-3, and chicken egg drop syndrome virus (EDSV), and have high sensitivity.

[0006] The present invention provides a hybridoma cell line MDV-1Mab-pp38-E2 for detecting or identifying Marek's disease virus serotype I in serum, with the preservation number of CCTCC NO: C202501.

[0007] The present invention also provides a monoclonal antibody for detecting or identifying Marek's disease virus serotype I in serum, which is secreted by the hybridoma cell line MDV-1Mab-pp38-E2 or its subculture cell line described in the above technical solution.

[0008] The present invention also provides the application of the hybridoma cell line MDV-1Mab-pp38-E2 or the monoclonal antibody described in the above technical solution in the preparation of a product for detecting or identifying Marek's disease virus serotype I in serum.

[0009] Preferably, the Marek's disease virus serotype I includes one or more of Marek's disease virus serotype I CVI988 strain, Marek's disease virus serotype I 814 strain, Marek's disease virus serotype I Jing-1 strain, and Marek's disease virus serotype I Md-5 strain.

[0010] The present invention also provides a kit for detecting or identifying Marek's disease virus serotype I in serum, which includes the monoclonal antibody described in the above technical solution.

[0011] Preferably, the kit further includes a fluorescently labeled anti-mouse antibody, a diluent, and a washing solution.

[0012] Preferably, the diluent and the washing solution each include a phosphate buffer solution; the pH value of the phosphate buffer solution is 7.2 - 7.4, and the concentration is 9 - 11 mM.

[0013] The present invention also provides the application of the hybridoma cell line MDV-1Mab-pp38-E2 or the monoclonal antibody or the kit described in the above technical solution in detecting or identifying the pp38 protein of Marek's disease virus serotype I in serum.

[0014] The present invention also provides the application of the hybridoma cell line MDV-1Mab-pp38-E2 or the monoclonal antibody or the kit described in the above technical solution in detecting one or more of the purity, safety, and illegal addition of avian live virus vaccines.

[0015] Preferably, the detection of the safety of the avian live virus vaccine includes detecting and / or monitoring the concentration and / or plaque number of Marek's disease virus serotype I in the avian live virus vaccine.

[0016] Advantageous effects:

[0017] The present invention provides a hybridoma cell line MDV-1Mab-pp38-E2 for detecting or identifying Marek's disease virus serotype I in serum, with the preservation number CCTCC NO: C202501. The monoclonal antibody secreted by the hybridoma cell line MDV-1Mab-pp38-E2 of the present invention can recognize different Marek's disease virus serotype I strains in chickens, and does not cross-react with other common avian disease viruses such as Marek's disease virus serotype II, Marek's disease virus serotype III, and egg drop syndrome virus (EDSV) in chickens. It has good specificity and sensitivity, and can be used for detecting exogenous viruses of Marek's disease virus serotype I in live avian virus vaccines, and can also be used for clinical identification, virus content determination, and epidemiological investigation of Marek's disease virus serotype I in chickens.

[0018] Biological preservation information

[0019] The hybridoma cell line MDV-1Mab-pp38-E2, biologically classified as hybridoma cells, was preserved in the China Center for Type Culture Collection on February 8, 2025. The preservation address: Wuhan University, Wuhan, China; its preservation name is MDV-1Mab-pp38-E2, and the preservation number is: CCTCC NO: C202501; Brief description of the drawings

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0021] Figure 1 It is a SDS-PAGE detection result diagram of the small-scale expression of MDV-1-pp38 recombinant protein; among them, M is Marker, 1 is after IPTG induction, and 2 is before IPTG induction;

[0022] Figure 2 It is a SDS-PAGE detection result diagram of the large-scale expression of MDV-1-pp38 recombinant protein; among them, M is Marker, 1 is the supernatant after sonication, and 2 is the precipitate after sonication;

[0023] Figure 3 It is a SDS-PAGE detection result diagram of the purified MDV-1-pp38 recombinant protein; among them, M is Marker, and 1-3 are all the purified protein supernatants;

[0024] Figure 4 It is a result diagram of detecting MDV-1 CVI988 strain using the indirect immunofluorescence kit in Example 4;

[0025] Figure 5 It is a result diagram of detecting MDV-1 814 strain using the indirect immunofluorescence kit in Example 4;

[0026] Figure 6 Result diagram of detecting MDV-1 Beijing-1 strain using the indirect immunofluorescence kit in Example 4;

[0027] Figure 7 Result diagram of detecting MDV-1 Md-5 strain using the indirect immunofluorescence kit in Example 4;

[0028] Figure 8 Result diagram of detecting MDV-3 FC126 strain using the indirect immunofluorescence kit in Example 4;

[0029] Figure 9 Result diagram of detecting MDV-2 SB-1 strain using the indirect immunofluorescence kit in Example 4;

[0030] Figure 10 Result diagram of detecting NDV Clone30 strain using the indirect immunofluorescence kit in Example 4;

[0031] Figure 11 Result diagram of detecting POX attenuated quail strain using the indirect immunofluorescence kit in Example 4;

[0032] Figure 12 Result diagram of detecting IBV H120 strain using the indirect immunofluorescence kit in Example 4;

[0033] Figure 13 Result diagram of detecting IBDV B87 strain using the indirect immunofluorescence kit in Example 4;

[0034] Figure 14 Detection result diagram of EDSV K911 strain using the indirect immunofluorescence kit in Example 4;

[0035] Figure 15 Detection result diagram of ALVR AV-1 strain using the indirect immunofluorescence kit in Example 4;

[0036] Figure 16 Detection result diagram of ALVR AV-2 strain using the indirect immunofluorescence kit in Example 4;

[0037] Figure 17 Detection result diagram of AIV (H9N2 subtype) AV1571 strain using the indirect immunofluorescence kit in Example 4;

[0038] Figure 18 Detection result diagram of FAdV GY strain using the indirect immunofluorescence kit in Example 4;

[0039] Figure 19 Detection result diagram of CIAV AV1550 strain using the indirect immunofluorescence kit in Example 4;

[0040] Figure 20 Figure showing the detection result of ILTV ILT / 13 strain by the indirect immunofluorescence kit in Example 4;

[0041] Figure 21 Figure showing the detection result of ARV Reo S1133 strain by the indirect immunofluorescence kit in Example 4. Detailed implementation manners

[0042] The present invention provides a hybridoma cell line MDV-1 Mab-pp38-E2 for detecting or identifying Marek's disease virus serotype I in serum, with the preservation number of CCTCC NO: C202501.

[0043] The present invention also provides a monoclonal antibody for detecting or identifying Marek's disease virus serotype I in serum, which is secreted by the hybridoma cell line MDV-1 Mab-pp38-E2 or its subculture cell line described in the above technical solution.

[0044] As an implementation manner, the subculture cell line of the hybridoma cell line MDV-1 Mab-pp38-E2 of the present invention includes the cell line within 30 passages of the hybridoma cell line MDV-1 Mab-pp38-E2; as another implementation manner, the subculture cell line of the hybridoma cell line MDV-1 Mab-pp38-E2 of the present invention includes the cell line of the hybridoma cell line MDV-1 Mab-pp38-E2 after 30 passages. The present invention limits the passage number, which has the advantage of maintaining the purity and stability of the monoclonal antibody.

[0045] The pp38 protein is highly conserved among different Marek's disease virus serotype I (MDV-1) strains. The present invention prepares the pp38 protein based on Marek's disease virus serotype I (MDV-1), immunizes mice with the pp38 protein as the immunogen, collects the spleen cell suspension of the immunized mice, fuses it with SP2 / 0 cells, cultures and screens it to obtain a hybridoma cell line MDV-1 Mab-pp38-E2. The monoclonal antibody secreted by it can specifically recognize different MDV-1 strains and does not cross-react with other common avian disease viruses such as MDV-2, MDV-3, and egg drop syndrome virus (EDSV), with high sensitivity.

[0046] In view of the above advantages, the application of the hybridoma cell line MDV-1 Mab-pp38-E2 or the monoclonal antibody of the present invention in the preparation of products for detecting or identifying Marek's disease virus serotype I in serum also belongs to the protection scope of the present invention.

[0047] As an implementation mode, the product of the present invention includes reagents and / or kits. As an implementation mode, the kit of the present invention is an indirect immunofluorescence detection kit.

[0048] As an implementation mode, the method for detecting or identifying Marek's disease virus serotype I in serum using the product of the present invention includes the following steps: performing a first incubation on chicken embryo fibroblasts inoculated with the sample to be detected using a monoclonal antibody, and obtaining a first incubation product after washing; the monoclonal antibody is the monoclonal antibody secreted by the hybridoma cell line MDV-1Mab-pp38-E2 described in the above technical solution; performing a second incubation on the first incubation product using an FITC-labeled goat anti-mouse antibody, and obtaining a second incubation product after washing; staining the second incubation product, observing at a wavelength of 490 nm, and making a determination based on the fluorescence staining result: when specific green fluorescence appears, it is determined that the sample to be detected contains Marek's disease virus serotype I in serum; when no specific green fluorescence appears, it is determined that the sample to be detected does not contain Marek's disease virus serotype I in serum. As an implementation mode, the present invention inoculates the sample to be detected into CEF (chicken embryo fibroblasts) for adsorption and culture to obtain chicken embryo fibroblasts inoculated with the sample to be detected. As an implementation mode, the adsorption time of the present invention is 50-70 min; as another implementation mode, the adsorption time of the present invention is 60 min. As an implementation mode, the culture temperature of the present invention is 37 °C. As an implementation mode, the culture time of the present invention is 2-4 d; as another implementation mode, the culture time of the present invention is 3 d. The method provided by the present invention can be used to detect MDV-1 virus without cross-reacting with other viruses, is convenient, efficient, and highly operable, and has high specificity and sensitivity. Promoting and using the technical solution in the present invention is beneficial to further ensuring the purity and safety of live avian virus vaccines, thereby improving the vaccine quality, and can also be used for clinical detection, virus content determination, and epidemiological investigation of MDV-1.

[0049] As an implementation mode, the Marek's disease virus serotype I in serum of the present invention includes one or more of Marek's disease virus serotype I CVI988 strain, Marek's disease virus serotype I 814 strain, Marek's disease virus serotype I Beijing-1 strain, and Marek's disease virus serotype I Md-5 strain; as another implementation mode, the Marek's disease virus serotype I in serum of the present invention includes Marek's disease virus serotype I CVI988 strain, Marek's disease virus serotype I 814 strain, Marek's disease virus serotype I Beijing-1 strain, or Marek's disease virus serotype I Md-5 strain.

[0050] The present invention also provides a kit for detecting or identifying Marek's disease virus serotype I in serum, and the kit comprises the monoclonal antibody described in the above technical solution.

[0051] As an embodiment, the kit of the present invention further comprises a fluorescently labeled anti-mouse antibody, a diluent and a washing solution. As an embodiment, the fluorescent labeling of the present invention includes FITC labeling or CY3 labeling. As an embodiment, the anti-mouse antibody of the present invention includes an anti-mouse antibody. As an embodiment, the anti-mouse antibody of the present invention includes a goat anti-mouse antibody or a rabbit anti-mouse antibody.

[0052] As an embodiment, the kit of the present invention further comprises a chromogenic solution. As an embodiment, the diluent and the washing solution of the present invention each comprise a phosphate buffer solution. As an embodiment, the pH value of the phosphate buffer solution of the present invention is 7.2 - 7.4; as another embodiment, the pH value of the phosphate buffer solution of the present invention is 7.3. As an embodiment, the concentration of the phosphate buffer solution of the present invention is 9 - 11 mM; as another embodiment, the concentration of the phosphate buffer solution of the present invention is 10 mM. As an embodiment, the chromogenic solution comprises a citrate buffer solution containing 1% solution A and 10% solution B; solution A comprises DMSO with 1 wt.% TMB, and solution B comprises an aqueous solution of 0.1 wt.% H2O2.

[0053] The present invention also provides the use of the hybridoma cell line MDV-1Mab-pp38-E2, the monoclonal antibody or the kit described in the above technical solution in detecting or identifying the pp38 protein of Marek's disease virus serotype I in serum.

[0054] The present invention also provides the use of the hybridoma cell line MDV-1Mab-pp38-E2, the monoclonal antibody or the kit described in the above technical solution in detecting one or more of the purity, safety and illegal addition of avian live virus vaccines.

[0055] As an embodiment, the detection of the safety of the avian live virus vaccine of the present invention includes detecting and / or monitoring the concentration and / or plaque number of Marek's disease virus serotype I in the avian live virus vaccine.

[0056] As an implementation mode, the live avian virus vaccine of the present invention includes one or more of a live fowlpox vaccine, a live turkey herpesvirus vaccine, a live Newcastle disease vaccine for chickens, a combined live vaccine of avian encephalomyelitis and fowlpox, a live infectious bronchitis vaccine for chickens, a recombinant fowlpox virus genetic engineering vaccine for infectious laryngotracheitis of chickens, and a live infectious bursal disease vaccine for chickens; as another implementation mode, the live avian virus vaccine of the present invention is a live fowlpox vaccine, a live turkey herpesvirus vaccine, a live Newcastle disease vaccine for chickens, a combined live vaccine of avian encephalomyelitis and fowlpox, a live infectious bronchitis vaccine for chickens, a recombinant fowlpox virus genetic engineering vaccine for infectious laryngotracheitis of chickens, and a live infectious bursal disease vaccine for chickens.

[0057] As an implementation mode, the live fowlpox vaccine of the present invention is a quail-attenuated strain of the live fowlpox vaccine. As an implementation mode, the live turkey herpesvirus vaccine of the present invention is the HVTFc-126 clone strain. As an implementation mode, the live Newcastle disease vaccine for chickens of the present invention is the Clone30 strain of the live Newcastle disease vaccine for chickens. As an implementation mode, the combined live vaccine of avian encephalomyelitis and fowlpox of the present invention is the YBF02 strain + quail-attenuated strain of the combined live vaccine of avian encephalomyelitis and fowlpox. As an implementation mode, the live infectious bronchitis vaccine for chickens of the present invention is the H120 strain of the live infectious bronchitis vaccine for chickens. As an implementation mode, the live Newcastle disease vaccine for chickens of the present invention is the CS2 strain of the live Newcastle disease vaccine for chickens. As an implementation mode, the live infectious bursal disease vaccine for chickens of the present invention is the B87 strain of the live infectious bursal disease vaccine for chickens.

[0058] When the safety of the live avian virus vaccine is detected by using the hybridoma cell line MDV-1Mab-pp38-E2, the monoclonal antibody or the kit according to the above technical solution of the present invention, if no specific green fluorescence appears, it indicates that the live avian virus vaccine is not infected with MDV-1 and is safe.

[0059] To further illustrate the present invention, the following will describe in detail a hybridoma cell line and a monoclonal antibody for detecting or identifying MDV-1 and their applications provided by the present invention in conjunction with the accompanying drawings and embodiments, but they cannot be understood as limiting the protection scope of the present invention.

[0060] Example 1

[0061] Analysis of the MDV-1 pp38 protein sequence

[0062] (1) Download the reference sequences of different MDV-1 strains from NCBI. Through analysis, it is found that the VP2 protein has high homology among different strains. The pp38 of MDV-1 CVI988 strain is selected for comprehensive secondary structure analysis and antigenicity analysis. The results show that the 60-221aa region of the MDV-1 pp38 protein is highly conserved and has extremely low antigenicity differences, which can be used as an alternative fragment for the expressed protein.

[0063] (2) Based on the secondary structure analysis and antigenicity of the protein sequence, using the pp38 sequence of MDV-1 CVI988 strain (Genbank accession number: AQN77164.1), the nucleotide fragment (486bp) of its 60-221aa region is selected and synthesized after codon optimization. The restriction enzyme cleavage sites of EcoRⅠ (5'-GAATTC-3') and XhoⅠ (5'-CTCGAG-3') are added at the 5' and 3' ends to obtain the recombinant epitope of MDV-1 pp38 protein for cloning into the vector. The recombinant epitope sequence of MDV-1 pp38 protein is synthesized by Beijing Liuhua Huada Protein R & D Center Co., Ltd. The specific sequence is: 5'- GAATTC GATCGGGTCCAG AGGGACCGGTGGAGATTCAGTTCTCCGCCCCCTCACTCTGGAGTCACGGGGAAGGGGGCTATTCCAATAAAGGGTGATGGGAAGGCGATAGAATGCCAGGAGCTAACCGGAGAGGGAGAGTGGCTGTCACAGTGGGGGGAGCTACCGCCTGAGCCCCGGAGGTCAGGGAATGAACATCTTGACGAAAGTCGGTATGCGAAACAAACCGAAAGGGGTAGCTCTACGGGGAAAGAAGAGGGAGATGGTATGAAGCAGATGGGGGAGCTTGCCCAGCAGTGCGAAGGAGGAACATATGCGGACTTGCTTGTCGAAGCAGAGCAAGCTGTTGTACATTCCGTTCGCGCATTAATGCTGGCCGAAAGACAAAACCCAAATATATTGGGGGAGCATTTGAATAAAAAACGGGTTCTTGTACAACGACCCCGTACTATTCTATCCGTGGAGTCAGAGAATGCAACAATGCGTTCTTATATG CTCGAG -3' (SEQ ID NO:1); where the underlines are the added EcoRⅠ and XhoⅠ restriction enzyme cleavage sites.

[0064] Example 2

[0065] Construction, Expression and Purification of Recombinant Expression Plasmid

[0066] 1. Construction of Recombinant Expression Plasmid

[0067] The sequences of SEQ ID NO:1 in Example 1 and plasmid pET30a were double digested with restriction endonucleases EcoRⅠ and XhoⅠ respectively. After ligating the purified and recovered fragments with the enzyme digestion products of the expression vector using DNA LigationKit, the recombinant expression plasmid was obtained and transformed into competent cells (BL21).

[0068] 2. Small-scale Expression of MDV-1-pp38 Recombinant Protein

[0069] (1) Pick the transformed BL21 clones identified as positive by PCR in step 1 into 1.5 mL of LB liquid medium containing 50 μg / mL kanamycin resistance, and culture at 37 °C and 200 r / min until the OD 600 value of the culture broth is 0.6 - 0.8. IPTG was added to the cultured broth for induction, and the final concentration of IPTG in the cultured broth was 0.5 mM, the induction temperature was 37 °C, the rotation speed was 200 r / min, and the time was 2 h.

[0070] (2) Take 1 mL of the induced bacterial liquid, centrifuge at 12000 r / min for 1 min, discard the supernatant, resuspend the precipitate with 50 μL of 10 mM Tris-HCl (pH 8.0) solution (the amount of buffer added depends on the amount of bacteria), add 2×loading buffer equal in volume to the buffer, and keep at 100 °C for 5 min and then perform agarose gel electrophoresis detection. The results showed that a specific target band of the recombinant MDV-1pp38 protein appeared at about 30 KD( Figure 1 ), indicating the successful expression of MDV-1pp38 protein.

[0071] 3. Large-scale Expression of MDV-1pp38 Recombinant Protein

[0072] (1) The transformed BL21 obtained in step 1 was identified by PCR, and the positive BL21 was cultured. The cultured bacterial liquid was transferred to 250 mL of LB liquid medium containing 50 μg / mL kanamycin resistance according to a volume ratio of 1:50, and cultured with shaking at 37 °C and 200 r / min until the OD 600 value of the culture broth is 0.6 - 0.8. IPTG was added to the cultured broth for induction, and the final concentration of IPTG in the cultured broth was 0.5 mM, the induction temperature was 37 °C, and the induction time was 3 h.

[0073] (2) Under the condition of a rotation speed of 8000 r / min, the induced bacterial liquid was centrifuged for 6 min, and the supernatant was discarded to obtain the bacterial cells. The obtained bacterial cells were lysed by ultrasonic treatment. The specific process was as follows: The obtained bacterial cells were dispersed with 30 mL of 10 mM Tris-HCl (pH value 8.0) solution and then subjected to ultrasonic fragmentation. The ultrasonic fragmentation power was 500 W, and the ultrasonic fragmentation was performed 180 times, 5 s each time, and the next ultrasonic fragmentation was carried out after an interval of 5 s.

[0074] (3) The product obtained by ultrasonic fragmentation was detected by electrophoresis. The specific process was as follows: 100 μL of the bacterial suspension after ultrasonic fragmentation was taken and centrifuged for 10 min under the condition of a rotation speed of 12000 r / min. After centrifugation, 50 μL of the supernatant and the obtained precipitate were retained, and the obtained precipitate was dispersed with 50 μL of 10 mM Tris-HCl (pH value 8.0) solution. The solutions obtained by dispersing the supernatant and the precipitate were respectively subjected to SDS-PAGE detection. As a result, a large amount of the target protein ( Figure 2 ) was detected in the precipitate, indicating that the expression form of the MDV-1 pp38 protein in this recombinant bacterium was inclusion body expression.

[0075] 4. Purification of MDV-1 pp38 recombinant protein

[0076] The precipitate obtained by centrifugation after ultrasonic fragmentation in step 3 was resuspended with 20 - 30 mL of 10 mM Tris-HCl (pH value 8.0) solution and allowed to stand for 10 min; it was centrifuged for 10 min under the condition of 12000 r / min, and the supernatant was transferred to another tube for storage. The precipitate was resuspended with 20 - 30 mL of 10 mM Tris-HCl (pH value 8.0) solution and allowed to stand for 10 min to obtain a bacterial suspension. The obtained bacterial suspension was centrifuged for 10 min under the condition of 12000 r / min, and the supernatant was discarded to obtain the first precipitate; for the first precipitate, the above-mentioned steps of resuspension and centrifugation were repeated once to obtain the second precipitate. First, a small amount of 10 mM Tris-HCl (pH value 8.0) solution was added to the second precipitate to resuspend the precipitate, and then 5 - 10 mL of 10 mM Tris-HCl (pH value 8.0) solution containing 8 M urea was added to dissolve the protein. It was centrifuged at 12000 r / min for 10 min, and the supernatant was collected. 50 μL of the sample was subjected to SDS-PAGE electrophoresis detection. As a result, a large amount of purified MDV-1-pp38 protein ( Figure 3 ) was detected. Using BSA (bovine serum albumin) as a standard, the concentration of the purified protein was estimated to be >0.5 mg / mL and the purity was >85% by SDS-PAGE gel scanning analysis.

[0077] Example 3

[0078] Preparation of monoclonal antibody

[0079] 1. Immunity of Mice

[0080] After emulsifying the purified MDV-1-pp38 protein in Example 2 with Freund's complete adjuvant at a volume ratio of 1:1, 4 SPF-grade BALB / c female mice were subcutaneously injected with 60 μg of MDV-1-pp38 protein per mouse (i.e., primary immunization). At 2 weeks, 4 weeks, and 6 weeks after primary immunization, booster immunizations were subcutaneously administered, with an immunization dose of 30 μg of MDV-1-pp38 protein per mouse. The interval between primary immunization and the first booster immunization was 14 days, the interval between the first booster immunization and the second booster immunization was 14 days, and the interval between the second booster immunization and the third booster immunization was 14 days. Ten days after the third booster immunization, blood was collected from the orbital cavity, and the serum titer was measured by indirect ELISA. Mice with high serum titers (ELISA antibody titer of 1:12800) were selected and intraperitoneally injected with 50 μg of immunogen (MDV-1-pp38 protein) for one immunization boost.

[0081] 2. Cell Fusion

[0082] Three days after the intraperitoneal injection immunization boost, the spleens of the mice were aseptically removed and prepared into spleen cell suspensions. Equal amounts of immunized spleen cell suspensions and SP2 / 0 cells were used for cell fusion by the conventional 50% PEG method. The fused cells obtained after fusion were placed in 5 96-well plates and selectively cultured with HAT culture medium (purchased from Sigma).

[0083] 3. Cloning and Screening of Hybridoma Cells

[0084] 3.1 The cultures in the 96-well plates described in Step 2 were screened using an ELISA plate coated with MDV-1-pp38 protein. The specific steps are as follows:

[0085] (1) Coating the ELISA plate: Dilute the purified MDV-1-pp38 protein in Example 2 with sodium carbonate-sodium bicarbonate buffer at pH 9.6 to a final concentration of 2 μg / mL. Add 100 μL of the diluted MDV-1-pp38 protein to each well of the ELISA plate and incubate overnight at 4°C; then wash 3 times with PBST (PBS containing 0.05% Tween-20).

[0086] (2) Blocking: Add 200 μL of PBS containing 2% milk by mass to each well of the coated ELISA plate, incubate in an incubator at 37°C for 2 h, and then wash 3 times with PBST (PBS containing 0.05% Tween-20).

[0087] (3) Incubate with primary antibody: After blocking, add the culture supernatant of hybridoma cells obtained from the cell fusion in step 2, negative control (SP2 / 0 culture supernatant), blank control (PBS), and positive control (MDV-1 positive serum diluted 1000-fold with PBS) as the primary antibody, 100 μL per well, and incubate in an incubator at 37 °C for 1 h.

[0088] (4) Wash: After incubating with the primary antibody, wash the ELISA plate in step (3) with PBST (PBS containing 0.05% Tween-20), and wash a total of 3 times.

[0089] (5) Incubate with secondary antibody: After washing, add goat anti-mouse IgG / HRP diluted 20000-fold with PBS to the ELISA plate as the secondary antibody, 100 μL per well, and incubate in an incubator at 37 °C for 1 h.

[0090] (6) Wash: Wash the ELISA plate after incubating with the secondary antibody in step (5) with PBST (PBS containing 0.05% Tween-20), and wash a total of 3 times.

[0091] (7) Color development: Add 100 μL of chromogenic solution (citrate buffer containing 1% solution A and 10% solution B, solution A: TMB is prepared into a 1% mass concentration with DMSO; solution B: 0.1% aqueous solution of H2O2) per well, and the color development time is about 5 min.

[0092] (8) Terminate with 50 μL of termination solution (containing 2 M sulfuric acid) per well.

[0093] (9) Read the absorbance: Measure the absorbance at double wavelengths (450 nm, 630 nm), record and save the data, and the results are shown in Table 1.

[0094] 3.2 Screen the cultures in the 96-well plate described in step 2 with an ELISA plate coated with His-tagged protein. The specific steps are similar to those in 3.1, except that when coating the ELISA plate in step (1), His-tagged protein is used to replace the purified MDV-1-pp38 protein; when incubating with the primary antibody in step (3), the positive control is the serum collected from mice immunized with pp38 recombinant protein or MDV-1 positive serum, and the results are shown in Table 1.

[0095] Table 1 ELISA screening results of hybridoma cell lines

[0096]

[0097] Note: A high absorbance value for the target protein and a low absorbance value for the tag protein indicate a high titer of the hybridoma cell line.

[0098] As can be seen from Table 1, a total of 3 hybridoma cell lines (E2, H3, and G4) positive for ELISA were screened in this example for further screening. Among them, the E2 hybridoma cell line had the highest titer.

[0099] 4. Indirect immunofluorescence assay

[0100] 4.1 Preparation of positive virus plates: The virus solutions of different serotype 1 Marek's disease virus (MDV-1) strains in Table 2 were diluted with M199 culture medium containing 2% newborn bovine serum to 100 PFU / 0.1 mL and inoculated into 96-well plates containing chicken embryo fibroblasts (CEF). After about 3 days, they were fixed with cold methanol for 15 min. At the same time, CEF cell controls were set and reserved for use.

[0101] Table 2 Information on different strains of MDV-1 and control strains

[0102]

[0103]

[0104] Note: The above virus strains are from the National Veterinary Microbial Culture (Virus) Collection Center. For details, see the China Veterinary Drug Information Network, Culture Collection, and Bacterial (Viral) Strain Search.

[0105] 4.2 Fluorescent staining

[0106] (1) Fixation: After the preparation of positive virus plates, discard the cell culture medium in the 96-well plates. Add about 250 μL of PBS to each well, gently wash the cell surface once, and try to discard all the PBS as much as possible. Then add 100 μL of cold methanol to each well, fix at room temperature for 10 - 15 min, discard the methanol, and air dry naturally for 2 - 5 min.

[0107] (2) Add primary antibody (monoclonal antibody): After the 96-well plates are fixed, wash the cell surface once with PBS (pH 7.2). The supernatants of the 3 positive hybridoma cell lines (D10, H3, and G4) obtained by ELISA screening in step 3 are used as primary antibodies. After diluting the supernatants 10 times with PBS, add them to the positive virus plates (washed once with PBS before use), 50 μL per well, and incubate at 37 °C in the dark for 1 h.

[0108] (3) Washing: After the addition of the primary antibody in the 96-well plates, discard the monoclonal antibody in the wells of the plate, wash 5 times with PBS, add 0.3 mL of washing solution to each well each time, and wash with gentle oscillation.

[0109] (4) Fluorescent secondary antibody staining: Try to discard all the washing solution as much as possible. Add 50 μL of fluorescein-labeled goat anti-mouse IgG diluted with PBS to each well, and incubate at 37 °C in the dark for 1 h. The volume ratio of fluorescein-labeled goat anti-mouse IgG diluted with PBS is 1:100 - 1:200.

[0110] (5) Washing: The method is the same as that in step (3).

[0111] (6) Observation and result determination: Observe under a fluorescence inverted microscope with blue excitation light (wavelength 490 nm). The cells have a complete cell morphology. When specific green fluorescence appears in the field of view of the inoculation well and is magnified to 200 - 400 times, and it can be seen that both the nucleus and cytoplasm of the infected cells are colored, it is determined that the MDV-1 detection in this well is positive. When no specific green fluorescence appears in the inoculation well and the field of view is dark, it proves that the cells are not infected, and it is determined that the MDV-1 detection in this well is negative. As a result, a cell line with good reactivity to the whole virus of different strains of MDV-1 was screened. This cell line expresses a monoclonal antibody against MDV-1 pp38 protein and is named MDV-1 Mab-pp38-E2.

[0112] 5. Identification of hybridoma cells

[0113] 5.1 Culture characteristics

[0114] Cultivate the hybridoma cell line MDV-1 Mab-pp38-D16 in M199 culture medium containing 10% - 15% fetal bovine serum in a 37 °C, 5% CO2 incubator. Examine the cell morphology of the hybridoma cell line under a microscope. The cell morphology should be consistent, indicating that the cell state is good.

[0115] 5.2 Purity test

[0116] According to the appendix method of the current "Chinese Veterinary Pharmacopoeia" (compiled by the Chinese Veterinary Pharmacopoeia Committee, Chinese Veterinary Pharmacopoeia, 2020 Edition, China Agricultural Press, 2020, abbreviated as "Chinese Veterinary Pharmacopoeia" in this invention), conduct sterility test, mycoplasma test and exogenous virus test on the hybridoma cell line MDV-1 Mab-pp38-D16. The results all meet the requirements.

[0117] 5.3 Karyological examination

[0118] Examine the chromosome number of the hybridoma cell line MDV-1 Mab-pp38-D16 cultured for 24 h by the colchicine method, and observe that the chromosome characteristics conform to the staining characteristics of hybridoma cells.

[0119] 5.4 Ascites titer determination

[0120] (1) Preparation of ascites: Take 8 - 10-week-old BALB / C mice and inject pristane intraperitoneally, 0.5 mL per mouse. 7 - 10 days later, inject 10 6 ~10 7One hybridoma cell MDV-1 Mab-pp38-D16, 0.5 mL per mouse. After 7 - 10 days, observe the status of the mice. When the abdomen of the mice is significantly enlarged and they have difficulty moving, collect the ascites of the mice, centrifuge at 3000 r / min for 10 min, take the supernatant, and store it at -40 °C. If ascites is produced again at an interval of 2 - 3 days, it can be collected again. This ascites is purified by Protein-A affinity to obtain the mouse anti-MDV-1 monoclonal antibody.

[0121] (2) Dilute the ascites producing the mouse anti-MDV-1 monoclonal antibody serially from a volume ratio of 1:100 to 1:16000, and determine the fluorescence antibody titer of the ascites to be 1:2000 according to the method of indirect immunofluorescence detection in step 4.

[0122] Example 4

[0123] The indirect immunofluorescence kit for detecting MDV-1 includes the monoclonal antibody against MDV-1, commercially available FITC-labeled goat anti-mouse antibody (purchased from: Sigma, catalog number F2057), sample diluent and washing solution. The diluent and washing solution are both 10 mM phosphate buffer (PBS) at pH 7.2; among them, the monoclonal antibody against MDV-1 is produced by the hybridoma cell line MDV-1 Mab-pp38-D16 obtained in Example 3.

[0124] The steps and judgment criteria for detecting MDV-1 with this indirect immunofluorescence kit are as follows:

[0125] 1. Sample inoculation

[0126] Inoculate 100 μL of the sample to be tested into a 96-well plate filled with confluent chicken embryo fibroblasts (CEF), and culture at 37 °C for about 3 days.

[0127] 2. Fluorescent staining and result judgment

[0128] (1) Fixation: After 1 h, discard the cell culture medium in the 96-well cell plate, add about 0.3 mL of PBS (pH 7.2) to each well and gently wash the cell surface once, try to discard all the PBS as much as possible, then add 0.2 mL of cold methanol to each well, fix at room temperature for 15 min, discard the methanol, and air dry naturally for 5 min.

[0129] (2) Add the primary antibody: After natural air drying, wash the cell surface once with PBS (pH 7.2), then add 50 μL of the MDV-1 monoclonal antibody to each well and incubate at 37 °C for 1 h. The added MDV-1 monoclonal antibody is diluted with PBS (pH 7.2 - 7.4), and the dilution volume ratio is 1:100.

[0130] (3) Washing: Discard the MDV-1 monoclonal antibody, wash 5 times with PBS (pH 7.2), add 0.3 mL of washing solution to each well each time, and wash with gentle oscillation.

[0131] (4) Fluorescent secondary antibody staining: Try to discard all the washing solution as much as possible, add 50 μL of FITC-labeled goat anti-mouse IgG to each well, and incubate at 37 °C for 1 h. The added FITC-labeled goat anti-mouse IgG is diluted with PBS (pH 7.2 - 7.4), and the dilution volume ratio is 1:100.

[0132] (5) Washing: The method is the same as in step (3).

[0133] (6) Observation and determination: Observe under a fluorescence inverted microscope with blue excitation light (wavelength 490 nm). The cells have a complete cell morphology. When specific green fluorescence appears in the field of view of the inoculation well and, when magnified to 200 - 400 times, it can be seen that the nuclei and cytoplasm of the infected cells are both stained, it is determined that the MDV-1 detection in this well is positive. When no specific green fluorescence appears in the inoculation well and the field of view is dark, it proves that the cells are not infected, and it is determined that the MDV-1 detection in this well is negative.

[0134] Example 5

[0135] Specific detection

[0136] Using the indirect immunofluorescence kit of Example 4, according to the established steps and determination criteria, different MDV-1, MDV-2, MDV-3, Newcastle disease virus (NDV), fowlpox virus (POX), infectious bronchitis virus (IBV), infectious bursal disease virus (IBDV), egg drop syndrome virus (EDSV), avian leukosis virus (ALV), infectious laryngotracheitis virus (ILTV), avian orthoreovirus (ARV) in Table 2 were respectively detected, and the coloring situation of the infected virus cells was observed to determine the specificity of this indirect immunofluorescence method.

[0137] The specific detection results show that the indirect immunofluorescence kit of Example 4 can specifically recognize and detect different MDV-1 strains ( Figures 4 - 7 ), and the reaction results all show positive, while there is no reaction with the MDV strain of serotype 3 ( Figure 8 ) and the strain of serotype 2 ( Figure 9 ), and there is also no reaction with other common avian disease viruses such as NDV ( Figure 10 ), POX ( Figure 11 ), IBV ( Figure 12 ), IBDV ( Figure 13 ), EDSV ( Figure 14 ), ALV ( Figures 15 - 16 ), AIV ( Figure 17 ), FAdV (Figure 18 )、CIAV( Figure 19 )、ILTV( Figure 20 ) and ARV( Figure 21 ) reactions were all negative, proving that the established method has good specificity, and this indirect immunofluorescence kit can be applied to the specific detection of MDV-1.

[0138] Example 6

[0139] Sensitivity detection

[0140] (1) Dilute MDV-1 (CVI988 strain) to 80 PFU / 100 μL, and perform two-fold serial dilution based on this to 40 PFU / 100 μL, 20 PFU / 100 μL, 10 PFU / 100 μL, 5 PFU / 100 μL, 2.5 PFU / 100 μL, 1.25 PFU / 100 μL, 0.625 PFU / 100 μL. Inoculate the above 8 dilutions of samples into confluent monolayer CEF, 100 μL / well, with 4 replicates for each sample. At the same time, set CEF as the negative control. Use the indirect immunofluorescence kit in Example 4 to detect according to the established steps and judgment criteria. The results show that for the detection results of MDV-1 at each dose gradient, when the MDV-1 infection dose is greater than or equal to 2.5 PFU, the virus detection result is positive.

[0141] (2) Dilute MDV-1 (814 strain) to 80 PFU / 100 μL, and perform two-fold serial dilution based on this to 40 PFU / 100 μL, 20 PFU / 100 μL, 10 PFU / 100 μL, 5 PFU / 100 μL, 2.5 PFU / 100 μL, 1.25 PFU / 100 μL, 0.625 PFU / 100 μL. Inoculate the above 8 dilutions of samples into confluent monolayer CEF, 100 μL / well, with 4 replicates for each sample. At the same time, set CEF as the negative control. Use the indirect immunofluorescence kit in Example 4 to detect according to the established steps and judgment criteria. The results show that for the detection results of MDV-1 at each dose gradient, when the MDV-1 infection dose is greater than or equal to 2.5 PFU, the virus detection result is positive.

[0142] Combining step (1) and step (2), it can be seen that the lowest detection limit for detecting MDV-1 contamination using the indirect immunofluorescence kit in Example 4 is 2.5 PFU.

[0143] Example 7

[0144] (1) Exogenous virus test of live avian virus vaccines

[0145] Eight key varieties of live poultry vaccines produced by domestic manufacturers (Table 3) were selected and subjected to indirect immunofluorescence (IFA) testing for MDV-1 using the indirect immunofluorescence kit described in Example 4. Serological testing for MDV-1 contamination of the selected live poultry vaccines was also performed in accordance with Part III of the Chinese Veterinary Pharmacopoeia 2020 Edition. Meanwhile, a PBS group was set as the negative control and an MDV-1 (CVI988 strain) infected group was set as the positive control. The specific test results are shown in Table 3.

[0146] Table 3 Detection Results of Exogenous Viruses in Enterprise Vaccines

[0147]

[0148] As can be seen from Table 3, the results of serological testing and testing using the indirect immunofluorescence kit in Example 4 were consistent. None of the selected live poultry vaccines were contaminated with MDV-1. The negative control was negative for MDV-1 detection, and the positive control was positive for MDV-1 detection.

[0149] (2) Detection of Illegally Added MDV Live Vaccines

[0150] Ten batches of MDV HVT live vaccines produced by 5 domestic manufacturers were selected and tested for MDV-1 using the indirect immunofluorescence kit described in Example 4. The specific test results are shown in Table 4.

[0151] Table 4 Detection Results of Illegally Added Substances in Enterprise Vaccines

[0152]

[0153]

[0154] As can be seen from Table 4, none of the selected MDV live vaccines were contaminated with MDV-1. The cell control was negative for MDV-1 detection, and the positive control was positive for MDV-1 detection.

[0155] (3) Plaque Count of MDV Live Vaccines

[0156] Eight batches of MDV live vaccines produced by domestic manufacturers were selected and subjected to plaque counting for MDV-1 using the indirect immunofluorescence kit described in Example 4. The specific test results are shown in Table 5.

[0157] Table 5 Detection Results of Plaque Counts of Enterprise Vaccines

[0158]

[0159] As can be seen from Table 5, the plaque count results of the selected MDV live vaccines all met the requirements. The results were higher than the visual inspection results, indicating that the IFA method has higher precision.

[0160] (4) Identification of MDV live vaccine

[0161] Select the MDV-1 live vaccines produced by 8 domestic manufacturers. Take the MDV-1 group as the positive control and detect them according to the indirect immunofluorescence kit in Example 4. The specific detection results are shown in Table 6.

[0162] Table 6 Identification results of MDV live vaccine

[0163]

[0164] It can be seen from Table 6 that the identification test results of the selected MDV live vaccines all meet the requirements, indicating that the quality of the live vaccine meets the requirements of MDV live vaccine.

[0165] It can be seen from the above content that the anti-MDV-1 monoclonal antibody produced by the hybridoma cell line MDV-1 Mab-pp38-D16 of the present invention can simultaneously recognize different strains of MDV-1, and does not cross-react with viruses such as egg drop syndrome virus (EDSV) of chickens. It has good sensitivity and specificity, and can be used not only for the detection of exogenous viruses of MDV-1 in live vaccines of avian viruses (cell inspection method), but also for the clinical detection and epidemiological investigation of MDV-1.

[0166] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments without creative efforts based on this embodiment, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A hybridoma cell line MDV-1Mab-pp38-E2 for detecting or identifying serum type I Marek's disease virus, with a deposit number of CCTCC NO: C202501.

2. A monoclonal antibody for detecting or identifying serum type I Marek's disease virus, characterized in that: The monoclonal antibody is secreted by the hybridoma cell line or its successive cell line according to claim 1.

3. Use of the hybridoma cell line MDV-1Mab-pp38-E2 according to claim 1 or the monoclonal antibody according to claim 2 in the preparation of a product for detecting or identifying serotype I Marek's disease virus.

4. The use according to claim 3, characterized in that: The serotype I Marek's disease virus comprises one or more of serotype I Marek's disease virus CVI988 strain, serotype I Marek's disease virus 814 strain, serotype I Marek's disease virus Jing-1 strain and serotype I Marek's disease virus Md-5 strain.

5. A kit for detecting or identifying serum type I Marek's disease virus, characterized in that: The kit comprises the monoclonal antibody according to claim 2.

6. The kit according to claim 5, characterized in that The kit also includes fluorescently labeled anti-mouse antibodies, diluent and washing solution.

7. The kit according to claim 6, characterized in that The diluent and the washing solution respectively include a phosphate buffer; the pH value of the phosphate buffer is 7.2-7.4, and the concentration is 9-11 mM.

8. Use of the hybridoma cell line MDV-1Mab-pp38-E2 according to claim 1, the monoclonal antibody according to claim 2, or the kit according to any one of claims 5 to 7 in detecting or identifying the pp38 protein of Marek's disease virus of serum type I.

9. Use of the hybridoma cell line MDV-1Mab-pp38-E2 according to claim 1, the monoclonal antibody according to claim 2, or the kit according to any one of claims 5 to 7 in detecting one or more of the purity, safety, and illegal addition of live virus vaccines for avian use.

10. The use according to claim 9, characterized in that: The safety of the poultry live virus vaccine comprises detecting and / or monitoring the concentration and / or plaque number of serum type I chicken Marek's disease virus in the poultry live virus vaccine.

Images