Method for enhancing insect resistance of tobacco plant by using NtCYP94B3 gene and application of NtCYP94B3 gene

By reducing or knocking out the NtCYP94B3-1 and NtCYP94B3-2 genes in tobacco, interfering with the jasmonic acid signaling pathway, the problem of insufficient application of existing insect-resistant genes is solved, and the resistance to tobacco to pests is significantly improved, and it does not affect the growth and yield of tobacco.

CN120210282APending Publication Date: 2025-06-27CHINA TOBACCO HUNAN IND CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510440283.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-09
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

Existing insect-resistant genes are difficult to promote and apply. Insects have a resistance to insecticidal proteins, and the insect resistance spectrum is narrow. There is a gene 'silence' phenomenon in the expression of exogenous genes in plants, which cannot meet the needs of agricultural production for pest control.

Method used

By reducing the expression levels of the NtCYP94B3-1 gene and/or NtCYP94B3-2 gene in tobacco or knocking out these genes, CRISPR-Cas9, zinc finger nuclease, TALENs or RNAi gene silencing technology interferes with the jasmonic acid signaling pathway, thereby enhancing the insect resistance of tobacco plants.

Benefits of technology

It significantly enhances the resistance of tobacco plants to the twill moth and tobacco hawk moth, and gene knockdown does not affect the growth of tobacco and the yield and quality of tobacco leaves after grilling, providing broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210282A_ABST
    Figure CN120210282A_ABST
Patent Text Reader

Abstract

The invention provides a method for enhancing insect resistance of a tobacco plant. The method comprises the step of reducing the expression level of an NtCYP94B3-1 gene and / or an NtCYP94B3-2 gene in tobacco. Through the NtCYP94B3-1 and NtCYP94B3-2 of a targeted jasmonic acid signal pathway, single-gene or multi-gene inhibition expression or knockout is carried out in a plant, and it is found that the insect resistance, especially the resistance to prodenia litura and tobacco hornworm, of the knockout plant can be greatly enhanced; meanwhile, after the gene is knocked out, the growth of tobacco and the yield and quality of flue-cured tobacco leaves are not influenced, and the gene has a wide application prospect in the aspects of molecular breeding and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, and particularly to a method for enhancing the insect resistance of tobacco plants by the NtCYP94B3 gene and its application. Background Art

[0002] Pest damage is the most important environmental factor causing crop yield reduction. Currently, chemical control is still the main method for pest control. Although chemical control technology has good effects, the problems of pesticide residues, increased pest resistance, and ecological environment problems caused by long-term use are becoming increasingly prominent. By regulating the expression of insect-resistant genes, cultivating insect-resistant varieties, and improving the insect resistance of crops themselves is a more economical, effective, and environmentally friendly way, which is conducive to the sustainable development of agriculture.

[0003] Although there have been some reports on insect-resistant genes in related technologies, most of them are difficult to be popularized and applied. Insects can also develop resistance to insecticidal proteins; the insect-resistant spectrum of insect-resistant genes is narrow; there is a phenomenon of gene "silencing" in the expression of foreign genes in plants, etc., which cannot meet the pest control needs in agricultural production. Therefore, it is very necessary to develop new insect-resistant genes or make full use of existing insect-resistant gene resources to improve the resistance of plants to pests through gene recombination or fusion technology. Summary of the Invention

[0004] In view of this, in order to at least partially solve at least one of the above-mentioned technical problems, the present invention provides a method for enhancing the insect resistance of tobacco plants by the NtCYP94B3 gene and its application.

[0005] According to an embodiment of one aspect of the present invention, a method for enhancing the insect resistance of tobacco plants is provided, which includes the step of reducing the expression level of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in tobacco.

[0006] According to the embodiment of the present invention, the nucleotide sequence of the NtCYP94B3-1 gene is as shown in SEQ ID No.1; the nucleotide sequence of the NtCYP94B3-2 gene is as shown in SEQ ID No.2.

[0007] According to the embodiment of the present invention, the above method includes knocking out the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in tobacco.

[0008] According to the embodiment of the present invention, the above method includes reducing the expression level of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in tobacco or knocking out the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene by CRISPR-Cas9, zinc finger nuclease, TALENs or RNAi gene silencing technology.

[0009] According to an embodiment of the present invention, reducing the expression level of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in tobacco or knocking out the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene is carried out by targeting the target site shown in SEQ ID No. 3 in the NtCYP94B3-1 gene and / or the target site shown in SEQ ID No. 4 in the NtCYP94B3-2 gene, or by means of an sgRNA having the sequence shown in SEQ ID NO. 3 and / or SEQ ID NO. 4.

[0010] According to an embodiment of another aspect of the present invention, there is provided an application of the NtCYP94B3 gene in tobacco, wherein the gene includes the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene, and the application includes any one of the following applications: (1) resisting pest stress; (2) increasing the content of insect-resistant substances in tobacco plants; (3) being used for tobacco breeding.

[0011] According to an embodiment of the present invention, resisting pest stress includes resisting Spodoptera litura and Manduca sexta.

[0012] According to an embodiment of another aspect of the present invention, there is provided an expression vector, which includes a polynucleotide targeting the target site shown in SEQ ID No. 3 in the NtCYP94B3-1 gene and / or the target site shown in SEQ ID No. 4 in the NtCYP94B3-2 gene, or a polynucleotide encoding an sgRNA having the sequence shown in SEQ ID NO. 3 and / or SEQ ID NO. 4.

[0013] According to an embodiment of the present invention, the expression vector is applicable to monocotyledonous plants or dicotyledonous plants, preferably tobacco, and preferably the expression vector is a CRISPR gene editing vector.

[0014] According to an embodiment of another aspect of the present invention, there is provided a kit, which contains the above-mentioned expression vector; optionally, the kit further contains a polynucleotide encoding a Cas protein such as Cas9, and optionally a polynucleotide encoding an sgRNA and the polynucleotide encoding a Cas protein are in the same expression vector or in different expression vectors.

[0015] According to an embodiment of the present invention, by targeting the NtCYP94B3-1 and NtCYP94B3-2 genes in the jasmonic acid signaling pathway, single-gene or multi-gene down-regulation or knockout is carried out in plants, and it is found that the insect-resistant performance of the knockout plants, especially the resistance to Spodoptera litura and Manduca sexta, can be greatly enhanced; at the same time, after the gene is knocked out, it has no impact on the growth of tobacco and the yield and quality of the cured tobacco leaves, and has broad application prospects in aspects such as molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Through the following description of the embodiments of the present invention with reference to the accompanying drawings, the above and other objects, features and advantages of the present invention will become more apparent. In the drawings:

[0017] Figure 1 Schematic diagram of the gene knockout vector constructed for the embodiment of the present invention;

[0018] Figure 2 Analysis diagram of mutation sites of the multi-gene knockout strain for the embodiment of the present invention;

[0019] Figure 3 Statistical analysis diagram of the insect weight after inoculating the multi-gene knockout mutant strain of the embodiment of the present invention with insects. A is Spodoptera litura, and B is Manduca sexta;

[0020] Figure 4 Detection result diagram of insect-resistant substances of the multi-gene knockout mutant strain for the embodiment of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0021] Hereinafter, embodiments of the present invention will be described with reference to the accompanying drawings. However, it should be understood that these descriptions are merely exemplary and are not intended to limit the scope of the present invention. In the following detailed description, for the sake of explanation, many specific details are set forth to provide a comprehensive understanding of the embodiments of the present invention. However, obviously, one or more embodiments can also be implemented without these specific details. In addition, in the following description, descriptions of well-known structures and technologies are omitted to avoid unnecessarily confusing the concepts of the present invention.

[0022] The terms used herein are merely for describing specific embodiments and are not intended to limit the present invention. The term "comprising" used herein indicates the presence of features, steps, operations, but does not exclude the presence or addition of one or more other features.

[0023] In the case of using expressions such as "at least one of A, B, and C, etc.", generally, it should be interpreted according to the meaning that those skilled in the art usually understand this expression (for example, "a system having at least one of A, B, and C" should include, but is not limited to, a system having only A, only B, only C, having A and B, having A and C, having B and C, and / or having A, B, and C, etc.). In the case of using expressions such as "at least one of A, B, or C, etc.", generally, it should be interpreted according to the meaning that those skilled in the art usually understand this expression (for example, "a system having at least one of A, B, or C" should include, but is not limited to, a system having only A, only B, only C, having A and B, having A and C, having B and C, and / or having A, B, and C, etc.).

[0024] The term "homology" refers to the level of similarity or percent identity in terms of percent nucleotide position identity (i.e., sequence similarity or identity) between polynucleotide sequences. The term homology as used herein also refers to the concept of similar functional properties between different polynucleotide molecules. For example, promoters with similar functions may have homologous cis - elements. Polynucleotide molecules are homologous when they specifically hybridize under certain conditions to form a duplex molecule. Under these conditions (referred to as stringent hybridization conditions), one polynucleotide molecule can be used as a probe or primer to identify another polynucleotide molecule sharing homology.

[0025] The term "promoter" refers to a polynucleotide molecule that, in its natural state, is located upstream or at the 5' of the translation start codon of an open reading frame (or protein - coding region) and is involved in the recognition and binding of RNA polymerase II and other proteins (trans - acting transcription factors) to initiate transcription.

[0026] The term "operably linked" refers to the connection of a first polynucleotide molecule (such as a promoter) to a second transcribable polynucleotide molecule (such as a gene of interest), where the polynucleotide molecules are arranged such that the first polynucleotide molecule affects the function of the second polynucleotide molecule. Preferably, the two polynucleotide molecules are part of a single continuous polynucleotide molecule and more preferably are adjacent. For example, if a promoter regulates or mediates the transcription of a gene of interest in a cell, then the promoter is operably linked to the gene of interest.

[0027] The term "recombinant plant expression vector": one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, together with vectors having helper plasmids, are most commonly used for Agrobacterium - mediated transformation. Binary vectors typically include: cis - acting sequences required for T - DNA transfer, selectable markers engineered to be able to express in plant cells, heterologous DNA sequences to be transcribed, etc.

[0028] The term "transformation" is a method for introducing a heterologous DNA sequence into a host cell or organism.

[0029] The term "expression" is the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0030] The term "recombinant host cell line" or "host cell" means a cell containing the polynucleotide of the present invention, regardless of the method used for insertion to generate the recombinant host cell, such as direct uptake, transduction, mating, or other methods known in the art. The exogenous polynucleotide can remain as a non - integrated vector such as a plasmid or can be integrated into the host genome. The host cell can be a prokaryotic cell or a eukaryotic cell, and the host cell can also be a monocotyledonous or dicotyledonous plant cell.

[0031] In the process of realizing the concept of the present invention, it was found that the development of CRISPR / Cas9 gene editing technology provides an important tool for realizing gene-directed editing and integrating multiple gene sites for molecular breeding. Moreover, after completing the editing of the target site, the transgenic vector elements such as Cas9 can be removed by self-pollination or hybridization with the wild type, thereby obtaining mutant materials without transgenic traces without the insertion of exogenous fragments, and the transgenic safety risk is relatively low. Therefore, it is of great practical value and economic significance to develop new resistance genes or utilize existing gene resources to knock out resistance genes by CRISPR / Cas9 gene editing technology and transgenic methods.

[0032] Studies have shown that the jasmonic acid (JAs) signaling pathway plays a very important role in plant resistance to insect pests. After being induced by insect feeding, the secondary metabolites produced by this pathway, such as trypsin inhibitor (TPI), nicotine and terpenes, can directly inhibit the growth and survival of pests.

[0033] Specifically, according to an embodiment of one aspect of the present invention, a method for enhancing insect resistance of tobacco plants is provided, which comprises the step of reducing the expression level of NtCYP94B3-1 gene and / or NtCYP94B3-2 gene in tobacco.

[0034] According to an embodiment of the present invention, by targeting the NtCYP94B3-1 and NtCYP94B3-2 genes of the jasmonic acid signaling pathway, single or multiple genes are reduced in expression or knocked out in plants, and it is found that the insect resistance of the knocked-out plants, especially the resistance to Spodoptera litura and Manduca sexta, can be greatly enhanced; at the same time, the knockout of this gene has no effect on the growth of tobacco and the yield and quality of the tobacco leaves after curing, and has broad application prospects in molecular breeding and other aspects.

[0035] According to an embodiment of the present invention, the base sequence of the NtCYP94B3-1 gene is shown as SEQ ID No.1.

[0036] The sequence of SEQ ID No.1 is as follows:

[0037] ATGTTTCTTTCCCTCTTACTTTCCTTCATTTTAGGGTTTCTTTCCTTCTCTTTTTTGTCTTTCTCCAAAAAACTTCATCTCAAATGCAGAAGAATCACACCCATCTATGGCCCTTCTTCTTATCCAATCCTTGGCTGTCTTATTTCCTTCTACAAAAATAGTCACCGTCTATTGGATTGGTACACTGAACTTTTATCAGAGTCACCCACACAAACCATTCTCGTTCAACGCTTTGGCGCACCTCGAACTATAATCACAGCCAATGCGAATAACGTTGAGCACATTCTCAAAACGAACTTCATTAATTATCCTAAGGGTCAGCCATTTACAGAGATATTAGGCGATTTTCTAGGGATGGGAATCTTCAATGTAGACGGCGAGCGATGGAACACGCAGCGCAAATTGGCTAGCCA CGAGTTCAGCACAAAGTCA

[0038] According to an embodiment of the present invention, the base sequence of the NtCYP94B3-2 gene is shown in SEQ ID No.2.

[0039] The sequence of SEQ ID No.2 is shown as follows:

[0040] ATGTTTCTTTCCCTCTTACTTTCGTTCATTTTAGGGTTTCTTTCCTTCTCTTTTTTATCTTTCTCCAAAAAACTTCATCTCAAATTCCGAAGAATCACTCCCATATATGGCCCTTCCTCTTACCCAATCCTTGGCTGTCTTATTTCCTTTTACAAAAATCGTCACCGTCTATTGGATTGGTACACTGAACTTTTGTCTGAGTCACCCACACAAACCATTCTAGTTCAACGCTTTGGTGCCCCTCGAACTATAATCACAGCCAATGCAACTAACGTTGAGCACATTCTCAAAACGAACTTTACTAATTATCCAAAAGGCCAGCCATTTACAGAGATTCTAGGCGATTTTCTCGGGATGGGGATCTTCAACGTAGACGGCGAGCGATGGAACACGCAGCGCAAATTGGCTAGCCA CGAGTTCAGCACAAAGTCA

[0041] According to an embodiment of the present invention, a method for enhancing the insect resistance of a tobacco plant includes knocking out the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in the tobacco.

[0042] According to an embodiment of the present invention, the NtCYP94B3-1 gene and the NtCYP94B3-2 gene and related metabolites have a regulatory pathway relationship: insect feeding will cause the plant to accumulate a large amount of jasmonic acid in a short time. After jasmonic acid forms a conjugate (JA-Ile) with isoleucine, it will promote the receptor of the jasmonic acid pathway to form a receptor complex with multiple other proteins and regulate the expression of downstream insect resistance-related genes, inducing the plant to produce insect resistance substances such as nicotine, glucosinolate, trypsin inhibitor (TPIs), and diterpene glycoside (HGL-DTGs). The NtCYP94B3-1 and NtCYP94B3-2 genes hydroxylate JA-Ile to inactivate it, resulting in a decrease in the expression of downstream insect resistance genes, a reduction in insect resistance metabolites, and a decrease in resistance.

[0043] In some specific embodiments of the present invention, an editing vector of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene can be constructed by conventional gene editing techniques or the construction method of a gene knockout vector, or a recombinant plant expression vector containing the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene can be constructed according to the conventional methods in the art. These methods are all proficiently mastered by those skilled in the art; for example, the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene are operably linked to an expression regulatory element to obtain a recombinant plant expression vector capable of expressing the gene in a plant; the recombinant plant expression vector includes a promoter, the CDS sequence of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene, and a terminator; the promoter can be a constitutive promoter, an inducible promoter, a tissue- or organ-specific promoter, and the terminator sequence can be taken from the Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase termination regions. The vector can also contain a selectable marker gene for selecting transformed cells, which is used to select transformed cells or tissues. The marker genes include: genes encoding antibiotic resistance and genes conferring herbicide resistance, etc.

[0044] According to an embodiment of the present invention, the expression level of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in the tobacco is reduced or the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene is knocked out by CRISPR-Cas9, zinc finger nuclease, TALENs or RNAi gene silencing technology.

[0045] According to the embodiments of the present invention, through CRISPR-Cas9, zinc finger nucleases, TALENs or RNAi gene silencing technology, the inhibition of the jasmonic acid (JAs) signaling pathway can be reduced by decreasing the expression level of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene. Thus, after being induced by pest feeding, secondary metabolites such as trypsin inhibitor (TPI), nicotine and terpenoids produced by this pathway can directly inhibit the growth and survival of pests; the content of insect-resistant substances in tobacco can also be regulated by knocking out the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene. The present invention does not specifically limit the regulation method or knockout method of the expression level of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene. The target sites for the regulation method or knockout method of the expression levels of multiple genes can be selected according to various methods, and one or more target sites can be selected for the regulation or knockout of the gene expression level.

[0046] In some specific embodiments of the present invention, regarding how to reduce the expression level of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in tobacco or knock out the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene, those skilled in the art can achieve it through various conventional technical means; for example, by constructing an overexpression vector of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene, transforming plants by the Agrobacterium-mediated genetic transformation method to obtain an overexpression line of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene; or by knocking out or interfering with the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in tobacco or the NtCYP94B3-1 and / or NtCYP94B3-2 homologous genes in other plants through CRISPR or VIGS methods, so that the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in tobacco or the NtCYP94B3-1 and / or NtCYP94B3-2 homologous genes in other plants have deletions or mutations or reduce the expression level of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene, thereby realizing the regulation of insect-resistant substances in tobacco.

[0047] According to an embodiment of the present invention, reducing the expression level of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in tobacco or knocking out the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene is carried out by targeting the target site shown in SEQ ID No. 3 in the NtCYP94B3-1 gene and / or the target site shown in SEQ ID No. 4 in the NtCYP94B3-2 gene, or by an sgRNA having the sequence shown in SEQ ID NO. 3 and / or SEQ ID NO. 4.

[0048] The sequence of SEQ ID NO. 3:

[0049] CGAGTTCAGCACAAAGTCA.

[0050] The SEQ ID NO. 3 sequence is located at positions 414-432 bp of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene. The corresponding sgRNA sequence is the SEQ ID NO. 5 sequence: GTGACTTTGTGCTGAACTCG.

[0051] The sequence of SEQ ID NO. 4:

[0052] TTCTACCCATTCCGTACTGC.

[0053] The SEQ ID NO. 4 sequence is located at positions 294-312 bp (in reverse) of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene. The corresponding sgRNA sequence is the SEQ ID NO. 6 sequence: GCAGTACGGAATGGGTAGAA.

[0054] According to an embodiment of the present invention, by using the CRISPR-Cas9 gene editing technology to knock out the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in tobacco, corresponding primers can be designed for the sgRNA sequences corresponding to the target sites shown in SEQ ID No. 3 and / or SEQ ID No. 4, which can quickly and efficiently achieve efficient gene editing in a variety of cell types and species, improve the success rate and efficiency of gene editing. Through the sgRNA sequences shown in SEQ ID No. 5 and / or SEQ ID No. 6, the target sites SEQ ID No. 3 and / or SEQ ID No. 4 sequences in the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene can be specifically recognized and cleaved, thereby achieving precise gene knockout.

[0055] According to an embodiment of the present invention, there is also provided an application of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in any one of the following: (1) resistance to pest stress; (2) increasing the content of insect-resistant substances in tobacco plants; (3) for tobacco breeding.

[0056] According to an embodiment of the present invention, the silencing of the NtCYP94B3 gene can reduce the inhibition of the jasmonic acid (JAs) signaling pathway in plants. Thus, after the plant is induced by pest feeding, secondary metabolites such as trypsin inhibitor (TPI), nicotine, and terpenoids produced by this pathway can directly inhibit the growth and survival of pests; by using CRISPR-Cas9 or RNAi technology to directionally edit the NtCYP94B3 gene, stable genetic insect-resistant lines can be quickly created.

[0057] According to an embodiment of the present invention, resistance to pest stress includes resistance to Spodoptera litura and Manduca sexta.

[0058] According to an embodiment of the present invention, tobacco plants with reduced expression or knockout of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene can effectively inhibit the growth of Spodoptera litura and Manduca sexta, reduce the weight of Spodoptera litura and Manduca sexta, and achieve resistance to pest stress.

[0059] According to an embodiment of another aspect of the present invention, there is also provided an expression vector, which includes a polynucleotide targeting the target site shown in SEQ ID No. 3 in the NtCYP94B3-1 gene and / or the target site shown in SEQ ID No. 4 in the NtCYP94B3-2 gene, or a polynucleotide encoding an sgRNA of the sequence shown in SEQ ID NO. 3 and / or SEQ ID NO. 4.

[0060] According to an embodiment of the present invention, when constructing a plant expression vector, any enhancer promoter or inducible promoter can be added before its transcription start nucleotide. An expression vector carrying the polynucleotide targeting the target site shown in SEQ ID No. 3 in the NtCYP94B3-1 gene and / or the target site shown in SEQ ID No. 4 in the NtCYP94B3-2 gene, or a polynucleotide encoding an sgRNA of the sequence shown in SEQ ID NO. 3 and / or SEQ ID NO. 4 can be used to transform plant cells or tissues by conventional biological methods such as using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated transformation, etc., and the transformed plant tissues can be cultivated into plants.

[0061] In some specific embodiments of the present invention, the expression vector simultaneously contains polynucleotides or sgRNA coding sequences targeting the NtCYP94B3-1 gene and the NtCYP94B3-2 gene, which can achieve synchronous knockout of two homologous genes and avoid the weakening of insect resistance caused by gene redundancy. For example, single-gene knockout only partially inhibits the metabolic pathway, while double-target knockout can completely block the detoxification mechanism of pests.

[0062] According to an embodiment of the present invention, the expression vector is applicable to monocotyledonous plants or dicotyledonous plants, preferably tobacco, and preferably the expression vector is a CRISPR gene editing vector.

[0063] According to an embodiment of the present invention, the expression vector is designed with a universal promoter such as the Arabidopsis ACT2 promoter or a plant transformation element such as the Agrobacterium T-DNA border, and is applicable to rice (monocotyledon) or tobacco (dicotyledon), expanding the scope of technical application; the CRISPR gene editing vector is simple to construct, low in cost, and can target multiple genes simultaneously such as NtCYP94B3-1 and NtCYP94B3-2, significantly improving the editing efficiency.

[0064] According to an embodiment of another aspect of the present invention, a kit is further provided, which contains the above-mentioned expression vector; optionally, the kit further contains a polynucleotide encoding a Cas protein such as Cas9, and optionally a polynucleotide encoding an sgRNA and a polynucleotide encoding a Cas protein are in the same expression vector or in different expression vectors.

[0065] According to an embodiment of the present invention, the kit further includes an editing vector for the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene constructed by conventional gene editing techniques or the construction method of gene knockout vectors, or a recombinant plant expression vector containing the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene constructed according to the conventional methods in the art, as well as other conventional optional components, such as marker genes, etc., or essential components required for selecting a gene editing method.

[0066] The following will further explain and illustrate the solution of the present invention in combination with specific embodiments. In the following embodiments, if not otherwise specified, all are conventional commercially available reagents.

[0067] Example 1 Construction of a multi-gene knockout vector

[0068] Clone the NtCYP94B3 gene from Nicotiana tabacum cv. NC89, which contains two homologous genes, NtCYP94B3-1 and NtCYP94B3-2. Design specific target sequences for gene editing according to their genomic sequences, and synthesize the gRNA (guideRNA) sequences.

[0069] Figure 1 Schematic diagram of the gene knockout vector constructed for the embodiments of the present invention.

[0070] Two target sites SEQ ID NO. 3 and SEQ ID NO. 4 were designed for NtCYP94B3-1 and NtCYP94B3-2 respectively. Then the gRNA sequence fragment was recombined onto this CRISPR / Cas9 gene editing vector containing a resistance tag as Figure 1 shown.

[0071] Using this CRISPR / Cas9 gene editing vector system, the bases in the target sequence were edited so that the coding sequences of the NtCYP94B3-1 and NtCYP94B3-2 genes were mutated, so that they could not be normally expressed or the expressed products were not the original amino acid products, thereby achieving the purpose of knocking out the NtCYP94B3-1 and NtCYP94B3-2 genes.

[0072] Example 2 Genetic transformation experiment

[0073] By electroporation transformation, the plant gene editing vector constructed in Example 1 was transformed into Agrobacterium tumefaciens EHA105.

[0074] Take the seeds of common cultivated tobacco, treat the seeds with 1% sodium hypochlorite solution for 15 minutes, then wash them 3 - 5 times with sterile water, and sow them on MS medium. When the seeds germinate and grow to the four-leaf stage, the leaf disc method is used for the genetic transformation of tobacco. Select tobacco seedlings with good growth status and fresh green leaf color, cut the leaves into about 1 cm × 1 cm size, place them in the Agrobacterium infection solution for 15 minutes; take out the infected leaves, blot the excess bacterial liquid on the surface with sterile filter paper, and spread them flat on the tobacco differentiation medium, and co-culture them for two days under dark conditions.

[0075] After the co-culture is completed, transfer the tobacco leaves to the screening and differentiation medium for continued culture. When tender shoots grow on the tobacco leaves, transfer the tender shoots to the screening and rooting medium for screening until adventitious roots grow. When the adventitious roots of the tobacco seedlings grow to about 1 cm, acclimatize them for two days, select transgenic seedlings with good growth status, and transplant them into the soil for cultivation and growth.

[0076] Example 3 Obtaining of transgenic plants

[0077] Identification of positive transgenic seedlings

[0078] Extract the genomic DNA of the leaves of T0 generation transgenic seedlings, and perform PCR detection to check whether the Cas9 gene sequence is contained in the genome and whether the knockout vector has been inserted into the genome of the transgenic plants.

[0079] The Cas9 detection primers are as follows:

[0080] Cas9-F (SEQ ID No.7): GCCTCTTCGCTATTACGCC;

[0081] Cas9-R (SEQ ID No.8): CCTGCTTCTCTTCTTTCAGATTC.

[0082] The PCR products were subjected to electrophoresis detection and sequencing confirmation to obtain positive transgenic seedlings.

[0083] Analysis of editing mutations at the target sites

[0084] Using the genomic DNA of the leaves of positive transgenic seedlings as a template, the target gene sequences were amplified respectively, and the primers were as follows:

[0085] NtCYP94B3-1-F (SEQ ID No.9): TTTGAAGCCACTTAAACTCA;

[0086] NtCYP94B3-1-R (SEQ ID No.10): TTGCTTCCACCACAACT;

[0087] NtCYP94B3-2-F (SEQ ID No.11): TGAAACACTCATCACTTTCT;

[0088] NtCYP94B3-2-R (SEQ ID No.12): CCATTCTTCTGGAGGTAG.

[0089] The T1 generation plants were identified for the editing status at the target sites, and gene editing events were detected at both target sites of the two genes. The editing efficiency of each target site was judged according to whether there was an editing event in the T1 generation (Table 1). Generally speaking, the editing efficiencies of target site 1 and target site 2 were relatively high. Among them, the editing efficiencies of target site 2 in the two genes were 63.2% and 84.2% respectively, and the editing efficiencies of target site 1 in the two genes were 68.4% and 26.3% respectively.

[0090] Table 1. Statistics of the editing status of each target site in T1 generation plants

[0091]

[0092] Statistical analysis was performed on the number of edited sites of two gene targets. The results showed that the proportion of plants with single-site editing in NtCYP94B3-1 was 42.1%; there were more plants with two-site editing, with a proportion of 47.4%; in NtCYP94B3-2, the proportion of plants with single-site editing was 57.9%; the proportion of plants with two-site editing was 26.3% (Table 2). Therefore, both of the two target sites selected in the present invention have high editing efficiency.

[0093] Table 2. Statistics of the number of edited target sites in T1 generation plants

[0094]

[0095] Figure 2 This is the analysis diagram of mutation sites of the multi-gene knockout lines in the examples of the present invention.

[0096] According to Figure 2 It can be seen that there is an insertion mutation of 14 bases in the coding sequence of the NtCYP94B3-1 gene, and an insertion mutation of base T in the coding sequence of the NtCYP94B3-2 gene. Two insect-resistant related genes have been effectively knocked out.

[0097] Example 4 Effects of gene knockout lines on the body weights of Spodoptera litura and Helicoverpa armigera

[0098] Taking the increased body weights of Spodoptera litura and Manduca sexta as the measurement indicators, the effects of transgenic knockout tobacco and control plants on the body weights of Spodoptera litura and Manduca sexta were detected. Four transgenic plants and four control plants with basically the same growth size were selected, and Helicoverpa armigera larvae with similar body weights were selected to treat each line. The larvae were placed on tobacco leaves, and 3 larvae were placed on each plant. The body weights of the insects were weighed continuously for 4 days, and a comparative analysis was made on the body weights of Spodoptera litura and Manduca sexta on transgenic tobacco and control plants. The results are as Figure 3 shown.

[0099] Figure 3 This is the statistical analysis diagram of the insect body weights after inoculating insects with the multi-gene knockout mutant lines in the examples of the present invention. A is Spodoptera litura, and B is Manduca sexta.

[0100] According to Figure 3 It can be seen that the body weights of the insects on the multi-gene mutants are significantly reduced, indicating that they have obvious resistance to Spodoptera litura and Manduca sexta.

[0101] Example 5 Detection of insect-resistant substances in gene knockout lines

[0102] Substances such as trypsin inhibitors and nicotine can enhance the insect resistance of plants. The contents of protease inhibitors (PI, trypsin inhibitor) and nicotine in the gene knockout lines after feeding insects were measured, and the results are as Figure 4 shown.

[0103] Figure 4 This is the detection result diagram of insect-resistant substances in the multi-gene knockout mutant lines of the embodiments of the present invention.

[0104] According to Figure 4 it can be seen that compared with the control, the contents of trypsin inhibitor and nicotine in the knockout mutants are both significantly increased, and the level of insect-resistant metabolites in the mutant lines is improved, indicating that the insect resistance of the mutant plants may be caused by the increase in the contents of these metabolites.

[0105] Example 6 Quality evaluation of gene knockout lines

[0106] One of the advantages of gene editing technology is that transgenic vector elements such as Cas9 can be removed from the materials after gene editing, so as to obtain mutant materials without transgenic traces without exogenous fragment insertion. To detect whether the application of the NtCYP94B3 gene knockout lines is affected in the quality of tobacco leaves, field trials were carried out on the improved lines and the control lines, and their appearance quality, conventional chemical components and sensory quality were evaluated and analyzed. After detection, it was confirmed that there were no significant differences in the appearance quality, conventional chemical components and sensory quality between the gene knockout lines and the control lines, and they can be applied to the molecular breeding of cultivated tobacco.

[0107] Appearance quality evaluation

[0108] The control line and the gene knockout line were planted in Hunan and Shandong for plot trials. C3F tobacco leaf samples were randomly selected, and the appearance quality of the tobacco leaf samples of the gene knockout materials and the control line was evaluated by the expert scoring method according to the excellent and poor proportions of different indexes of the tobacco leaves. The specific indexes include color, maturity, structure, identity, oil content, chroma, and the results are shown in Table 3 below.

[0109] Table 3. Appearance quality of the original tobacco of the control line and the gene knockout line

[0110]

[0111] The results in Table 3 show that there are no differences in the appearance quality of the original tobacco between the improved line and the control line. The colors of the cured tobacco leaves are all orange-yellow, the maturity of the tobacco leaves is mature, the leaf structures of the middle tobacco leaves are all relatively loose, the identity is medium, the oil content is present, and the chroma is medium.

[0112] Determination of conventional chemical components

[0113] The conventional chemical components of the baked samples (C3F) of the control strain and the gene knockout strain were detected. The detection indicators included total sugar, reducing sugar, nicotine, nitrogen, potassium, chlorine, etc. Total nitrogen was determined by the hydrogen peroxide-sulfuric acid nitrification method; nicotine was determined by the content decolorization method; the reducing sugar content was determined by the 3,5-dinitrosalicylic acid colorimetric method; total sugar was determined by the ether extraction and anthrone colorimetric method; chlorine content was determined by the Mohr method; potassium content was determined by the flame photometry method. The results are shown in Table 4 below.

[0114] Table 4 Detection of Conventional Chemical Components of Control Strain and Gene Knockout Strain

[0115]

[0116] The results in Table 4 show that the contents of total sugar, reducing sugar, nitrogen, chlorine, and potassium in the control strain and the gene knockout strain have small differences and are not significant.

[0117] Sensory Evaluation

[0118] Tissue smoking experts evaluated the sensory quality of C3F samples from the field trials in Shandong and Hunan. The results are shown in Table 5 below.

[0119] Table 5 Sensory Evaluation of Control Strain and Gene Knockout Strain

[0120]

[0121] The results in Table 5 show that the tobacco leaf samples of the control strain and the gene knockout strain have the same flavor style, the same highlighting degree, and the same comprehensive sensory quality.

[0122] In summary, gene knockout plants will not affect the appearance, taste, and chemical composition of cigarettes.

[0123] The specific embodiments described above have further detailed the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A method for enhancing insect resistance of tobacco plants, comprising the step of reducing the expression level of NtCYP94B3-1 gene and / or NtCYP94B3-2 gene in tobacco.

2. The method according to claim 1, wherein: The base sequence of the NtCYP94B3-1 gene is shown in SEQ ID No. 1; The base sequence of the NtCYP94B3-2 gene is shown in SEQ ID No.

2.

3. The method according to claim 1 or 2, wherein: The method comprises knocking out the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in tobacco.

4. The method according to claim 1 or 2, wherein: The method comprises reducing the expression level of NtCYP94B3-1 gene and / or NtCYP94B3-2 gene in tobacco or knocking out NtCYP94B3-1 gene and / or NtCYP94B3-2 gene by CRISPR-Cas9, zinc finger nuclease, TALENs or RNAi gene silencing technology.

5. The method according to claim 4, wherein: Reducing the expression level of the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene in tobacco or knocking out the NtCYP94B3-1 gene and / or the NtCYP94B3-2 gene is carried out by targeting the target site shown in SEQ ID No. 3 in the NtCYP94B3-1 gene and / or the target site shown in SEQ ID No. 4 in the NtCYP94B3-2 gene, or by using an sgRNA having a sequence shown in SEQ ID NO. 3 and / or SEQ ID NO.

4.

6. Application of NtCYP94B3 gene in tobacco, including: The gene includes NtCYP94B3-1 gene and / or NtCYP94B3-2 gene, and the application includes any of the following applications: (1) Resistance to pest stress; (2) Increase the content of insect-resistant substances in tobacco plants; (3) Used in tobacco breeding.

7. The use according to claim 6, wherein: The resistance to insect pest stress includes resistance to Spodoptera litura and Manduca sexta.

8. An expression vector comprising a polynucleotide targeting the target site shown in SEQ ID No. 3 in the NtCYP94B3-1 gene and / or the target site shown in SEQ ID No. 4 in the NtCYP94B3-2 gene, or a polynucleotide encoding an sgRNA of the sequence shown in SEQ ID NO. 3 and / or SEQ ID NO.

4.

9. The expression vector according to claim 8, which is suitable for monocotyledonous plants or dicotyledonous plants, preferably tobacco, and preferably the expression vector is a CRISPR gene editing vector.

10. A kit comprising the expression vector of claim 8 or 9; optionally, the kit further comprises a polynucleotide encoding a Cas protein such as Cas9, and optionally a polynucleotide encoding an sgRNA and a polynucleotide encoding a Cas protein in the same expression vector or in different expression vectors.