Kit for detecting human BRAF gene V600E and TERT gene promoter mutation

Abstract

The invention provides a kit for detecting human BRAF gene V600E and TERT gene promoter mutation, and belongs to the technical field of biology. The kit comprises a primer, a probe, a 5 * PCR (Polymerase Chain Reaction)-Enhancer, a 10 * PCR Buffer, dNTP (Deoxyribonucleoside Triphosphate) Mix, MalTaq DNAPlyase, magnesium ions, DEPC (Diethylpyrocarbonate) water, a positive control and a negative control. According to the present invention, the ARMS-PCR detection technology is adopted to detect the specific gene mutation, and the target mutation site is identified by designing the specific primer and the probe, such that the detection specificity and the detection sensitivity are improved; by combining with a Taqman probe technology, the fluorescent signal change in the PCR amplification process can be monitored in real time, so that whether mutation of a BRAF V600E site, a TERT C228T site and a TERT C250T site exists or not is accurately judged; according to the method, pre-amplification of 15 cycles is adopted, then quantitative amplification of 30 cycles is adopted, and when the initial amount of the target DNA is very low, the copy number of the target DNA can be increased, so that the detection accuracy and sensitivity are further improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to a kit for detecting mutations of human BRAF gene V600E and TERT gene promoter. Background Art

[0002] The BRAF gene is an important member of the RAF family. The protein encoded by it consists of 783 amino acids. Due to a missense mutation of a single base of thymine (T) and adenine (A) in exon 15, the valine at codon 600 of the translated protein is replaced by glutamic acid, resulting in a change in the protein sequence. This protein plays a role in regulating the MAPK / ERK signaling pathway and affects cell division, differentiation and secretion. This gene mutation is a common genetic alteration, mainly seen in various types of cancers, including malignant melanoma, papillary thyroid carcinoma, colorectal cancer, etc. This mutation leads to the continuous activation of the BRAF protein, thereby promoting cell proliferation and tumor formation. The TERT gene is one of the important genes encoding the telomerase complex, and its full name is telomerase reverse transcriptase (TERT). TERT gene mutations are present in 73% of tumors, among which C228T and C250T in the promoter region are particularly common. TERT gene promoter mutations are closely related to the clinical symptoms of patients. Patients with mutated bladder cancer or glioma often show characteristics such as easy recurrence of tumors, easy distal metastasis, and poor prognosis after radiotherapy and chemotherapy. And a variety of tumor data show that TERT gene promoter mutations are common characteristics in the processes of cancer occurrence, development and metastasis.

[0003] Currently, the main methods for detecting gene mutations include sequencing, immunohistochemistry (IHC), and PCR-fluorescent probe method. Sanger sequencing cannot accurately detect mutations with a variant allele frequency (VAF) lower than 15%. Although the sensitivity of Sanger sequencing can be enhanced to 0.04% VAF through technical improvements such as XNA molecular clamping technology, this method has high costs and technical dependencies. Although next-generation sequencing (NGS) provides comprehensive genomic information, the experimental operation and data analysis processes are complex. At the same time, it also faces factors such as low detection efficiency and easy sample contamination. Especially for the two hot mutation sites C228T and C250T, due to the high GC content and repetitive sequences in the TERT promoter region, problems such as amplification failure or low read depth may be encountered, and experimental design needs to be optimized to improve detection accuracy. The sensitivity of immunohistochemistry (IHC) shows certain differences in different studies. It has high accuracy in detecting BRAF V600E mutations in melanoma and papillary thyroid carcinoma (PTC). In colorectal cancer samples, the sensitivity of using the IHC method to detect BRAF V600E mutations is 100%, but the specificity is only 62.9%. The results indicate that the sensitivity of the IHC method may be lower than that of molecular detection methods. The sensitivity of ddPCR in detecting mutations is significantly higher than that of Sanger sequencing, but its cost is high. The PCR-fluorescent probe method has obvious advantages in terms of sensitivity, specificity, rapidity, simplicity, cost, and throughput, and is more suitable for the needs of clinical rapid screening and large-scale detection compared with sequencing and immunohistochemistry (IHC). Currently, the mainstream PCR-fluorescent probe methods for detecting BRAF gene V600E and TERT gene promoter (C228T, C250T) mutations on the market have certain limitations in terms of normal gene interference and detection sensitivity. Through technical improvements, the detection sensitivity can be significantly improved, and the range of 1%-5% has been exceeded. For extremely low-level mutations, such as a small amount of TERT gene promoter mutations in tumor cells, they may be close to the detection limit and cannot be accurately detected. Especially in the detection of some precancerous lesions or early tumors, false negatives may occur, thus prompting continuous improvement of technology to continuously increase the detection sensitivity of the kit. Summary of the Invention

[0004] To overcome the problem of the detection sensitivity of existing methods for detecting mutations in the BRAF gene V600E and the TERT gene promoter (C228T, C250T), the present invention uses the ARMS-PCR method (amplification refractory mutation system PCR) and combines it with the Taqman probe method to detect the fluorescence signal value, thereby determining whether there are mutations at the BRAF V600E, TERT C228T, and TERT C250T sites, improving the sensitivity and accuracy of PCR detection. The primers and probes provided by the present invention for detecting mutations at the human BRAF V600E, TERT C228T, and TERT C250T sites, as well as the kit containing these primers and probes, are intended to achieve rapid and accurate detection of mutations at the BRAF V600E, TERT C228T, and TERT C250T sites. Specifically, the technical solutions of the present invention include the following:

[0005] A kit for detecting mutations in the human BRAF gene V600E and the TERT gene promoter, the kit comprising: primers, probes, 5×PCR-Enhancer, 10×PCR Buffer, dNTP Mix, MalTaq DNA Polymerase, magnesium ions, DEPC water, positive control, and negative control.

[0006] Furthermore, the primers include:

[0007] The upstream primer-F and downstream primer-R for the BRAF V600E site, with nucleotide sequences GTGATTTTGGTCTAGCTACAC[LNA-A] and TCTAGTAACTCAGCAGCATCTCAG respectively;

[0008] The upstream primer-F and downstream primer-R for the TERT C228T site, with nucleotide sequences CCGGGCTCCCAGTGGATTC and GCTGGGAGGGCCCGGCA respectively;

[0009] The upstream primer-F and downstream primer-R for the TERT C250T site, with nucleotide sequences CCGGGCTCCCAGTGGATTC and TGGGCCGGGGACCCGTA respectively;

[0010] The upstream primer-F and downstream primer-R for the reference gene, with nucleotide sequences CGCGAACTCACCCGTTGACT and CACTAGGCGCTCACTGTTCTC respectively.

[0011] Furthermore, the probes include:

[0012] Mutation fluorescence probe - P for BRAF V600E locus, with nucleotide sequence VIC - ATGGAGTGGGTCCCATCAGTTTGAACAG - BHQ2;

[0013] Mutation fluorescence probe - P for TERT C228T locus, with nucleotide sequence FAM - CGGGCACAGACGCCCAGGACCG - BHQ1;

[0014] Mutation fluorescence probe - P for TERT C250T locus, with nucleotide sequence FAM - CGGGCACAGACGCCCAGGACCG - BHQ1;

[0015] Reference fluorescence probe - P for reference gene, with nucleotide sequence CY5 - ACCTTCACCTTCCCCATGGTGTCTG - BHQ2.

[0016] Furthermore, the 5' end of the mutation fluorescence probe - P for BRAF V600E locus is labeled with VIC as the luminescent group, and the 3' end of the mutation fluorescence probe - P for BRAF V600E locus is labeled with BHQ2 as the fluorescence quenching group.

[0017] Furthermore, the 5' end of the mutation fluorescence probe - P for TERT C228T locus and TERT C250T locus is labeled with FAM as the luminescent group, and the 3' end of the mutation fluorescence probe - P for TERT C228T locus and TERT C250T locus is labeled with BHQ1 as the fluorescence quenching group.

[0018] Furthermore, the 5' end of the reference fluorescence probe - P for reference gene is labeled with CY5 as the luminescent group, and the 3' end of the reference fluorescence probe - P for reference gene is labeled with BHQ2 as the fluorescence quenching group.

[0019] Furthermore, the 5'-end of the fluorescent probe sequence is linked to a fluorescent group (VIC / FAM / CY5), and the 3'-end is linked to a quenching group (BHQ1, BHQ2). Before the PCR amplification reaction, the fluorescent group at the 5'-end of the fluorescent probe is close to the quenching group at the 3'-end. Due to fluorescence resonance energy transfer, the fluorescent group cannot emit fluorescence. As the PCR amplification reaction progresses, the fluorescent probe is hydrolyzed under the action of DNA polymerase, and the fluorescent group at the 5'-end falls off and separates from the quenching group, and then can emit fluorescence. Corresponding mutant detection ARMS primers and TaqMan probes (VIC fluorescently labeled) for detecting the target gene are designed for the BRAF V600E mutation site, and corresponding mutant detection ARMS primers and TaqMan probes (FAM fluorescently labeled) for detecting the target gene are designed for the TERT C228T / TERT C250T mutation site. The mutant genes in the DNA sample are detected, and effective detection of low-content mutations can be achieved on the qPCR platform; and internal reference primers and probes (CY5 fluorescently labeled) for amplifying the housekeeping gene are designed to monitor the quality of the DNA added to the system.

[0020] Furthermore, the positive control includes:

[0021] The positive control for BRAF V600E is the plasmid with the BRAF V600E mutation site and human genomic DNA;

[0022] The positive control for TERT is the plasmids with TERT C228T and TERT C250T mutations and human genomic DNA.

[0023] Furthermore, the negative control includes:

[0024] The negative control for BRAF V600E is DEPC-treated water;

[0025] The negative control for TERT is DEPC-treated water.

[0026] Furthermore, the method for using the kit includes the following steps:

[0027] Step 1: Extract the DNA of the sample to be tested;

[0028] Step 2: Perform a fluorescent PCR amplification reaction on the DNA of the sample to be tested using the kit to obtain a fluorescent detection result;

[0029] Step 3: Analyze whether the sample to be tested is positive or negative using the fluorescent detection result.

[0030] Furthermore, the reaction solution used in the fluorescent PCR amplification reaction includes the BRAF V600E main reaction solution, the TERT C228T main reaction solution, and the TERT C250T main reaction solution.

[0031] Further, the BRAF V600E master reaction solution includes 2.5 μl of 10×PCR Buffer, 1 μl of dNTP Mix, 1 μl of MalTaq DNA Polymerase, 2 μl of magnesium ions, 1 μl of upstream primer - F for BRAF V600E site, 1 μl of downstream primer - R for BRAF V600E site, 1 μl of mutant fluorescent probe - P for BRAF V600E site, 0.5 μl of upstream primer - F for reference gene, 0.5 μl of downstream primer - R for reference gene, 1 μl of reference fluorescent probe - P for reference gene, 12.5 μl of DEPC water, and 1 μl of DNA of the sample to be tested.

[0032] Further, the TERT C228T master reaction solution includes 5 μl of 5×PCR - Enhancer, 2.5 μl of 10×PCR Buffer, 1 μl of dNTP Mix, 1 μl of MalTaq DNA Polymerase, 2 μl of magnesium ions, 2 μl of upstream primer - F for TERT C228T site, 2 μl of downstream primer - R for TERT C228T site, 2 μl of mutant fluorescent probe - P for TERT C228T site, 0.5 μl of upstream primer - F for reference gene, 0.5 μl of downstream primer - R for reference gene, 1 μl of reference fluorescent probe - P for reference gene, 3.5 μl of DEPC water, and 2 μl of DNA of the sample to be tested.

[0033] Further, the TERT C250T master reaction solution includes 5 μl of 5×PCR - Enhancer, 2.5 μl of 10×PCR Buffer, 1 μl of dNTP Mix, 1 μl of MalTaq DNA Polymerase, 2 μl of magnesium ions, 2 μl of upstream primer - F for TERT C250T site, 2 μl of downstream primer - R for TERT C250T site, 2 μl of mutant fluorescent probe - P for TERT C250T site, 0.5 μl of upstream primer - F for reference gene, 0.5 μl of downstream primer - R for reference gene, 1 μl of reference fluorescent probe - P for reference gene, 3.5 μl of DEPC water, and 2 μl of DNA of the sample to be tested.

[0034] Further, the procedure of the fluorescence PCR amplification reaction is as follows: 95°C for 15 min, (95°C for 30 s, 60°C for 30 s, 15 cycles), (95°C for 15 s, 56°C for 30 s, 30 cycles), and the reaction ends; signals are collected during the 56°C for 30 s process.

[0035] Further, the method for analyzing whether the sample to be tested is positive or negative includes the following content:

[0036] BRAF V600E locus: If the Ct values in the CY5 fluorescence channel of the sample to be tested are all ≤ 30, and if the Ct value in the VIC fluorescence channel of the sample to be tested is ≤ 30, the test result is positive. If there is no Ct value in the VIC fluorescence channel of the sample to be tested, the test result is negative.

[0037] TERT C228T locus: If the ΔCt (Ct FAM -Ct CY5 ) ≤ 13, the sample is positive; if the ΔCt (Ct FAM -Ct CY5 ) > 13 or there is no Ct value in the FAM channel, it is judged as negative.

[0038] TERT C250T locus: If the ΔCt (Ct FAM -Ct CY5 ) ≤ 14, the sample is positive; if the ΔCt (Ct FAM -Ct CY5 ) > 14 or there is no Ct value in the FAM channel, it is judged as negative.

[0039] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0040] (1) The present invention adopts the ARMS-PCR technology for detecting specific gene mutations, and identifies the target mutation sites by designing specific primers and probes. The specificity and sensitivity of the detection are improved; combined with the Taqman probe technology, the fluorescence signal changes during the PCR amplification process can be monitored in real time, so as to accurately judge whether there are mutations at the BRAF V600E locus, TERT C228T locus and TERT C250T locus.

[0041] (2) The present invention program adopts pre-amplification (15 cycles), followed by quantitative amplification (30 cycles). When the starting amount of the target DNA is very low, it can increase the copy number of the target DNA, thereby further improving the accuracy and sensitivity of the detection; the two-step method reduces the reaction time and improves the detection efficiency. The annealing and extension temperature of 56 °C can ensure the amplification efficiency of the primers while ensuring the amplification specificity of the primers.

[0042] (3) The present invention realizes the rapid detection of mutations at the BRAF gene V600E and the TERT gene promoter (C228T, C250T), and has the advantages of simple operation, fast and efficient, and easy result interpretation.

[0043] (4) The BRAF V600E reaction system can detect BRAF gene V600E with a content as low as 1% in a 5 ng DNA sample; the TERT C228T reaction system can detect a mutation with a content as low as 0.5% in a 10 ng DNA sample; the TERT C250T reaction system can detect a mutation with a content as low as 1% in a 5 ng DNA sample. Description of the Drawings

[0044] Figure 1 They are the amplification curves and coefficient of variation of the strongly positive precision reference product (mutation ratio 5%).

[0045] Figure 2 They are the amplification curves and coefficient of variation of the weakly positive precision reference product (mutation ratio 2%).

[0046] Figure 3 They are the amplification curves and coefficient of variation of the negative reference product.

[0047] Figure 4 They are the amplification curves and coefficient of variation of the positive reference product.

[0048] Figure 5 They are the amplification curves and coefficient of variation of wild-type human gDNA.

[0049] Figure 6 They are the amplification curves and coefficient of variation of the sensitivity test.

[0050] Figure 7 They are the detection results of the kit and the sequencing results. Detailed Embodiments

[0051] Next, through the embodiments of the present invention, the technical solutions of the present invention will be clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative efforts belong to the scope of protection of the present invention.

[0052] Unless otherwise specified, the raw materials and reagents used in the following present invention are all commercially available products, or can be prepared by known methods.

[0053] Example 1:

[0054] A kit for detecting the V600E mutation of the human BRAF gene and the promoter mutation of the TERT gene, the kit comprising: primers, probes, 5×PCR-Enhancer, 10×PCR Buffer, dNTP Mix, MalTaq DNA Polymerase, magnesium ions, DEPC water, positive control and negative control.

[0055] The above kit is applied to detect BRAF V600E mutation.

[0056] Among them, the primers include:

[0057] The upstream primer - F and downstream primer - R at the BRAF V600E locus, with nucleotide sequences GTGATTTTGGTCTAGCTACAC[LNA - A] and TCTAGTAACTCAGCAGCATCTCAG respectively;

[0058] The upstream primer - F and downstream primer - R of the reference gene, with nucleotide sequences CGCGAACTCACCCGTTGACT and CACTAGGCGCTCACTGTTCTC respectively.

[0059] Among them, the probes include:

[0060] The mutant fluorescence probe - P at the BRAF V600E locus, with nucleotide sequence VIC - ATGGAGTGGGTCCCATCAGTTTGAACAG - BHQ2;

[0061] The reference fluorescence probe - P of the reference gene, with nucleotide sequence CY5 - ACCTTCACCTTCCCCATGGTGTCTG - BHQ2.

[0062] Among them, the 5' end of the mutant fluorescence probe - P at the BRAF V600E locus is labeled with VIC as the luminescent group, and the 3' end of the mutant fluorescence probe - P at the BRAF V600E locus is labeled with BHQ2 as the fluorescence quenching group.

[0063] Among them, the 5' end of the reference fluorescence probe - P of the reference gene is labeled with CY5 as the luminescent group, and the 3' end of the reference fluorescence probe - P of the reference gene is labeled with BHQ2 as the fluorescence quenching group.

[0064] The usage method of the above kit includes the following steps:

[0065] Step 1:

[0066] Use a commercially available DNA extraction kit to extract the DNA of the sample to be tested:

[0067] 1.1 Paraffin sections: Take 5 - 8 paraffin sections (5 - 10 μm thick, 1×1 cm 2 in size);

[0068] Paraffin blocks: Use a scalpel to scrape about 30 mg of tissue sample;

[0069] 1.2 Place the paraffin section or paraffin block sample in a 1.5 ml sterile centrifuge tube, add 1 ml of xylene, vortex vigorously for 10 s, then centrifuge at 12,000 r / min at room temperature for 2 min, and discard the supernatant;

[0070] 1.3 Add 1 ml of absolute ethanol to the above tube, vortex for 10 s to mix evenly, then centrifuge at 12,000 r / min at room temperature for 2 min, discard the supernatant, and collect the precipitate;

[0071] 1.4 Let it stand at room temperature for 5 - 10 min to fully volatilize the ethanol;

[0072] 1.5 Add 200 μl of buffer GA and 20 μl of proteinase K to the precipitate, mix well, incubate at 56 °C for 1 h until the sample is completely lysed, and then incubate at 90 °C for 1 h;

[0073] 1.6 After incubation, add 220 μl of buffer GB, vortex to mix evenly, then add 250 μl of absolute ethanol, vortex and shake well to mix evenly, and centrifuge briefly to collect the solution on the tube wall to the bottom of the tube;

[0074] 1.7 Add the mixture obtained in the previous step to an adsorption column CR2, centrifuge at 8,000 r / min at room temperature for 2 min, pour out the waste liquid, and place the adsorption column back into the collection tube;

[0075] 1.8 Add 500 μl of buffer GD to the adsorption column CR2, centrifuge at 8,000 r / min at room temperature for 60 s, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube;

[0076] 1.9 Add 600 μl of washing buffer PW to the adsorption column CR2, centrifuge at 8,000 r / min at room temperature for 60 s, pour out the waste liquid, and place the adsorption column back into the collection tube;

[0077] 1.10 Add 600 μl of washing buffer PW to the adsorption column CR2, centrifuge at 8,000 r / min at room temperature for 60 s, pour out the waste liquid, and place the adsorption column back into the collection tube;

[0078] 1.11 Place the adsorption column CR2 back into the collection tube, centrifuge at 12,000 r / min for 2 min, pour out the waste liquid, open the lid of the adsorption column and let it stand at room temperature for 2 - 5 min to thoroughly dry the residual washing buffer in the adsorption material;

[0079] 1.12 Transfer the adsorption column CR2 into a clean centrifuge tube, suspend and drop 30 - 100 μl of preheated elution buffer TE or ddH2O at 65 °C in the middle of the adsorption membrane for elution, let it stand at room temperature for 2 - 5 min, centrifuge at 12,000 r / min for 2 min to collect the DNA of the sample to be tested, and store the centrifuge tube containing the DNA of the sample to be tested at -20 °C;

[0080] Step 2:

[0081] 2.1 Take out the BRAF V600E master reaction solution from the kit provided by the present invention. After thawing at room temperature, vortex and mix well and centrifuge instantaneously. Calculate the number of reaction reagent portions required for each site n [n = number of samples + number of controls (2)], and dispense 24 μl per well into PCR thin-walled tubes;

[0082] 2.2 Add 1 μl of BRAF V600E negative control, DNA of the sample to be tested, and BRAF V600E positive control to the BRAF V600E master reaction solution (Table 1) in a certain order. Carefully cover the lid of the PCR thin-walled tube, flick the tube wall 5 times to mix the liquid well, and centrifuge instantaneously after removing the bubbles;

[0083] Table 1. BRAF V600E master reaction solution

[0084]

[0085]

[0086] The primers and probes (BRAF-FM1 / BRAF-ER / BRAF-AP) of the BRAF V600E master reaction solution are used to detect the mutation sites, and the primers and probes (IC6_F / IC6_R / IC6_P) of the BRAF V600E master reaction solution are used to detect the internal standard in the test sample.

[0087] 2.3 Place the PCR reaction tubes in the sample slot of the fluorescence quantitative PCR amplifier in a certain order, set the sample names in the corresponding order, select the CY5 (internal reference) and VIC (target) detection channels for fluorescence detection, and set the PCR amplification cycle parameters as shown in Table 2;

[0088] Table 2. PCR amplification cycle parameters

[0089]

[0090] 2.4 After setting, save the file, run the reaction program, and obtain the fluorescence detection result;

[0091] Step 3: Analyze the results

[0092] 3.1 Threshold setting and determination of Ct value

[0093] ABI7500: Set the amplification curve graph type to linear. Select CY5 (internal reference) and VIC (target) in sequence for threshold setting. Set the threshold line of CY5 (internal reference) to 20000 and the threshold line of VIC (target) to 10000. After the threshold setting is completed, analyze to obtain the Ct values of each detected internal reference and target in sequence. If there is no amplification curve in the CY5 and VIC channels, or the amplification curve is a straight line or a slight inclined line without an obvious exponential growth phase, no Ct value judgment is made;

[0094] ABIQ5: Set the amplification curve graph type to linear. Select CY5 (internal reference) and VIC (target) in sequence for threshold setting. Set the threshold line of CY5 (internal reference) to 5000 and the threshold line of VIC (target) to 5000. After the threshold setting is completed, analyze to obtain the Ct values of each detected internal reference and target in sequence. If there is no amplification curve in the CY5 and VIC channels, or the amplification curve is a straight line or a slight inclined line without an obvious exponential growth phase, no Ct value judgment is made.

[0095] 3.2 Positive judgment value

[0096] 3.2.1 BRAF V600E negative control, positive control

[0097] Negative control: There is no amplification curve in the CY5 and VIC fluorescence channels;

[0098] Positive control: There is an obvious amplification curve in the CY5 and VIC fluorescence channels and Ct value ≤ 25.

[0099] 3.2.2. Sample determination

[0100] BRAF V600E result interpretation: For the test sample, if the Ct value in the CY5 fluorescence channel ≤ 30, and if the Ct value in the VIC fluorescence channel of the test sample ≤ 30, the sample is positive; if there is no Ct value in the VIC fluorescence channel of the test sample, it is judged as negative.

[0101] Example 2:

[0102] A kit for detecting V600E mutation of human BRAF gene and promoter mutation of TERT gene, the kit includes: primers, probes, 5×PCR-Enhancer, 10×PCR Buffer, dNTP Mix, MalTaq DNA Polymerase, magnesium ions and DEPC water.

[0103] The above kit is applied to detect TERT C228T and TERT C250T mutations.

[0104] Among them, the primers include:

[0105] The upstream primer - F and downstream primer - R for the TERT C228T locus have nucleotide sequences of CCGGGCTCCCAGTGGATTC and GCTGGGAGGGCCCGGCA, respectively;

[0106] The upstream primer - F and downstream primer - R for the TERT C250T locus have nucleotide sequences of CCGGGCTCCCAGTGGATTC and TGGGCCGGGGACCCGTA, respectively;

[0107] The upstream primer - F and downstream primer - R for the reference gene have nucleotide sequences of CGCGAACTCACCCGTTGACT and CACTAGGCGCTCACTGTTCTC, respectively.

[0108] Among them, the probes include:

[0109] The mutant fluorescence probe - P for the TERT C228T locus has a nucleotide sequence of FAM - CGGGCACAGACGCCCAGGACCG - BHQ1;

[0110] The mutant fluorescence probe - P for the TERT C250T locus has a nucleotide sequence of FAM - CGGGCACAGACGCCCAGGACCG - BHQ1;

[0111] The reference fluorescence probe - P for the reference gene has a nucleotide sequence of CY5 - ACCTTCACCTTCCCCATGGTGTCTG - BHQ2.

[0112] Among them, the 5' end of the mutant fluorescence probe - P for the TERT C228T locus and the TERT C250T locus is labeled with FAM as the luminescent group, and the 3' end of the mutant fluorescence probe - P for the TERT C228T locus and the TERT C250T locus is labeled with BHQ1 as the fluorescence quenching group.

[0113] Among them, the 5' end of the reference fluorescence probe - P for the reference gene is labeled with CY5 as the luminescent group, and the 3' end of the reference fluorescence probe - P for the reference gene is labeled with BHQ2 as the fluorescence quenching group.

[0114] The usage method of the above kit includes the following steps:

[0115] Step 1:

[0116] Extract the DNA of the sample to be tested using a commercially available DNA extraction experimental kit:

[0117] 1.1 Paraffin section: Take 5 - 8 paraffin sections (5 - 10 μm thick, 1×1 cm 2 size);

[0118] Paraffin block: Use a scalpel to scrape about 30 mg of tissue sample;

[0119] 1.2 Place the paraffin section or paraffin block sample in a 1.5 ml sterile centrifuge tube, add 1 ml of xylene, vortex vigorously for 10 s, then centrifuge at 12000 r / min at room temperature for 2 min, and discard the supernatant;

[0120] 1.3 Add 1 ml of absolute ethanol to the above tube, vortex for 10 s to mix evenly, then centrifuge at 12000 r / min at room temperature for 2 min, discard the supernatant, and collect the precipitate;

[0121] 1.4 Let it stand at room temperature for 5 - 10 min to fully volatilize the ethanol;

[0122] 1.5 Add 200 μl of buffer GA and 20 μl of proteinase K to the precipitate, mix well, incubate at 56 °C for 1 h until the sample is completely lysed, and then incubate at 90 °C for 1 h;

[0123] 1.6 After incubation, add 220 μl of buffer GB and vortex to mix evenly, then add 250 μl of absolute ethanol, vortex thoroughly to mix evenly, and centrifuge briefly to collect the solution on the tube wall to the bottom of the tube;

[0124] 1.7 Add the mixture obtained in the previous step to an adsorption column CR2 and centrifuge at 8000 r / min at room temperature for 2 min, pour out the waste liquid, and place the adsorption column back into the collection tube;

[0125] 1.8 Add 500 μl of buffer GD to the adsorption column CR2, centrifuge at 8000 r / min at room temperature for 60 s, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube;

[0126] 1.9 Add 600 μl of wash buffer PW to the adsorption column CR2, centrifuge at 8000 r / min at room temperature for 60 s, pour out the waste liquid, and place the adsorption column back into the collection tube;

[0127] 1.10 Add 600 μl of wash buffer PW to the adsorption column CR2, centrifuge at 8000 r / min at room temperature for 60 s, pour out the waste liquid, and place the adsorption column back into the collection tube;

[0128] 1.11 Place the adsorption column CR2 back into the collection tube, centrifuge at 12000 r / min for 2 min, pour out the waste liquid, open the lid of the adsorption column and let it stand at room temperature for 2 - 5 min to thoroughly dry the residual wash buffer in the adsorption material;

[0129] 1.12 Transfer the adsorption column CR2 into a clean centrifuge tube, suspend and add 30 - 100 μl of elution buffer TE or ddH2O preheated to 65°C to the middle part of the adsorption membrane for elution, let it stand at room temperature for 2 - 5 min, centrifuge at 12000 r / min for 2 min to collect the DNA of the sample to be tested, and store the centrifuge tube containing the DNA of the sample to be tested at -20°C;

[0130] Step 2:

[0131] 2.1 Take out the TERT C228T master reaction solution (Table 3) and TERT C250T master reaction solution (Table 4) from the detection kit respectively. After thawing at room temperature, vortex and mix well and centrifuge instantaneously. Calculate the number of reaction reagent aliquots n required for each site [n = number of samples + number of controls (2)], and dispense each master reaction solution into PCR thin-walled tubes at 23 μl per aliquot;

[0132] Table 3. TERT C228T master reaction solution

[0133]

[0134]

[0135] The primers and probes (TERT-F / R228M / TERT-AP) of the TERT C228T master reaction solution are used to detect the mutation site, and the primers and probes (IC6_F / IC6_R / IC6_P) of the TERT C228T master reaction solution are used to detect the internal standard of the test sample.

[0136] Table 4. TERT C250T master reaction solution

[0137]

[0138]

[0139] The primers and probes (TERT-F / R250M / TERT-AP) of the TERT C250T master reaction solution are used to detect the mutation site, and the primers and probes (IC6_F / IC6_R / IC6_P) of the TERT C250T master reaction solution are used to detect the internal standard of the test sample.

[0140] 2.2 Add 2 μl of TERT negative control, DNA of the sample to be tested, and TERT positive control to the TERT C228T master reaction solution and TERT C250T master reaction solution respectively in a certain order. Carefully cover the lids of the PCR thin-walled tubes, flick the tube walls 5 times to mix the liquid well, and centrifuge instantaneously after removing the bubbles;

[0141] 2.3 Place the PCR reaction tubes in the sample slots of the fluorescence quantitative PCR amplifier in a certain order, set the sample names in the corresponding order, and select the CY5 (internal reference) and FAM (target) detection channels for fluorescence detection. The PCR amplification cycle parameters are set as shown in Table 5:

[0142] Table 5. PCR Amplification Cycle Parameters

[0143]

[0144]

[0145] 2.4 After setting, save the file, run the reaction program, and obtain the fluorescence detection results;

[0146] Step 3: Analyze the results

[0147] 3.1 Threshold setting and determination of △Ct value

[0148] ABI7500: Set the amplification curve map type to linear, select CY5 (internal reference) and FAM (target) in turn for threshold setting, set the CY5 (internal reference) threshold line to 20000, and the FAM (target) threshold line to 30000. After the threshold setting is completed, analyze to obtain the Ct values of each detected internal reference and target in turn. If there is no amplification curve in the CY5 and FAM channels, or the amplification curve is a straight line or a slight diagonal line, no Ct value judgment is made.

[0149] ABIQ5: Set the amplification curve map type to linear, select CY5 (internal reference) and FAM (target) in turn for threshold setting, set the CY5 (internal reference) threshold line to 5000, and the FAM (target) threshold line to 5000. After the threshold setting is completed, analyze to obtain the Ct values of each detected internal reference and target in turn. If there is no amplification curve in the CY5 and FAM channels, or the amplification curve is a straight line or a slight diagonal line, no Ct value judgment is made.

[0150] Calculate △Ct = mutant Ct - internal reference Ct value (△Ct = Ct FAM -Ct CY5 )

[0151] 3.2 Positive judgment value

[0152] 3.2.1 TERT negative control, TERT positive control

[0153] Negative control: There is no amplification curve in the CY5 and FAM fluorescence channels;

[0154] Positive control: There are obvious amplification curves in the CY5 and FAM fluorescence channels and Ct value ≤ 25.

[0155] 3.2.2 Sample determination

[0156] 1) Interpretation of TERT C228T results:

[0157] If the ΔCt (Ct FAM - Ct CY5 ) of the test sample ≤ 13, the sample is positive; if the ΔCt (Ct FAM - Ct CY5 ) > 13 or there is no Ct value in the FAM channel, it is judged as negative.

[0158] 2) Interpretation of TERT C250T results:

[0159] If the ΔCt (Ct FAM - Ct CY5 ) of the test sample ≤ 14, the sample is positive; if the ΔCt (Ct FAM - Ct CY5 ) > 14 or there is no Ct value in the FAM channel, it is judged as negative.

[0160] Experimental Example 1: Precision Test

[0161] The human BRAF gene V600E and TERT gene promoter (C228T, C250T) mutation detection kit was used to perform fluorescence PCR reaction tests on the strong positive precision reference product and the weak positive precision reference product respectively, and each group of this test was repeated 10 times. The test results are as Figure 1 and Figure 2 shown.

[0162] BRAF V600E locus: The strong positive precision reference product is a mixture of wild - type human gDNA and V600E - mutated gDNA, with a V600E mutation rate of 5%; the weak positive precision reference product is a mixture of wild - type human gDNA and V600E - mutated gDNA, with a V600E mutation rate of 2%.

[0163] TERT C228T locus: The strong positive precision reference product is a mixture of wild - type human gDNA and TERT C228T - mutated gDNA, with a TERT C228T mutation rate of 5%; the weak positive precision reference product is a mixture of wild - type human gDNA and TERT C228T - mutated gDNA, with a TERT C228T mutation rate of 2%;

[0164] TERT C250T locus: The strong positive precision reference product is a mixture of wild - type human gDNA and TERT C250T - mutated gDNA, with a TERT C250T mutation rate of 5%; the weak positive precision reference product is a mixture of wild - type human gDNA and TERT C250T - mutated gDNA, with a TERT C250T mutation rate of 2%.

[0165] The test results show that Figure 1 and Figure 2 it can be seen that for the strong positive precision reference product and weak positive precision reference product of the BRAF V600E locus, obvious amplification curves are observed in both the CY5 and VIC channels. Moreover, the Ct values of the CY5 and VIC channels are ≤ 30, the positive detection rate is 100%, and the CV of the strong positive reference product is ≤ 15.0%. For the strong positive precision reference product and weak positive precision reference product of the TERT C228T locus, obvious amplification curves are observed in both the CY5 and FAM channels, the Ct values are both ≤ 30, and △Ct (Ct FAM -Ct CY5 ) ≤ 13. For the strong positive precision reference product of the TERT C228T locus, the coefficient of variation (CV, %) of the △Ct (Ct FAM -Ct CY5 ) value should be ≤ 15.0%. For the strong positive precision reference product and weak positive precision reference product of the TERT C250T locus, obvious amplification curves are observed in both the CY5 and FAM channels, the Ct values are both ≤ 30, and △Ct (Ct FAM -Ct CY5 ) ≤ 14. For the strong positive precision reference product of the TERT C250T locus, the coefficient of variation (CV, %) of the △Ct (Ct FAM -Ct CY5 ) value should be ≤ 15.0%. This shows that the detection kit has good precision.

[0166] Test Example 2: Specificity Test

[0167] The human BRAF gene V600E and TERT gene promoter (C228T, C250T) mutation detection kit was used to perform fluorescence PCR reaction tests on the enterprise's positive and negative reference products respectively. The test results are as shown in Figure 3 and Figure 4 .

[0168] BRAF V600E locus: The working concentration of the negative reference product is 10 ng / μl wild-type human gDNA. The strong positive reference product is a mixture of wild-type human gDNA and V600E mutant gDNA, with a V600E mutation rate of 20%. The medium strong positive reference product is a mixture of wild-type human gDNA and V600E mutant gDNA, with a V600E mutation rate of 12%. The weak positive reference product is a mixture of wild-type human gDNA and V600E mutant gDNA, with a V600E mutation rate of 2%.

[0169] TERT C228T locus: The working concentration of the negative reference is 10 ng / μl wild-type gDNA. The strong positive reference is a mixture of wild-type human gDNA and TERT C228T mutant gDNA with a TERT C228T mutation rate of 20%. The moderately strong positive reference is a mixture of wild-type human gDNA and TERT C228T mutant gDNA with a TERT C228T mutation rate of 12%. The weak positive reference is a mixture of wild-type human gDNA and TERT C228T mutant gDNA with a TERT C228T mutation rate of 2%.

[0170] TERT C250T locus: The working concentration of the negative reference is 10 ng / μl wild-type gDNA. The strong positive reference is a mixture of wild-type human gDNA and TERT C250T mutant gDNA with a TERT C250T mutation rate of 20%. The moderately strong positive reference is a mixture of wild-type human gDNA and TERT C250T mutant gDNA with a TERT C250T mutation rate of 12%. The weak positive reference is a mixture of wild-type human gDNA and TERT C250T mutant gDNA with a TERT C250T mutation rate of 2%.

[0171] From Figure 3 、 Figure 4 It can be seen that when performing fluorescence PCR reaction testing on wild-type human gDNA at the BRAF V600E locus, there is an obvious amplification curve in the CY5 channel and no amplification curve in the VIC channel, and the negative coincidence rate is 100%. When performing testing on the positive reference of the BRAF V600E locus, there are obvious amplification curves in both the CY5 and VIC channels, and the positive coincidence rate is 100%. When performing fluorescence PCR reaction testing on wild-type human gDNA at the TERT C228T locus, the Ct value in the CY5 channel ≤ 30, the Ct value in the FAM channel ≤ 30 or there is no Ct value, and △Ct (Ct FAM -Ct CY5 ) > 13, and the negative coincidence rate is 100%. When performing fluorescence PCR reaction testing on the positive reference of the TERT C228T locus, there are obvious amplification curves in both the CY5 and FAM channels, the Ct values are all ≤ 30, and △Ct (Ct FAM -Ct CY5 ) ≤ 13, and the positive coincidence rate is 100%. When performing fluorescence PCR reaction testing on wild-type human gDNA at the TERT C250T locus, the Ct value in the CY5 channel ≤ 30, the Ct value in the FAM channel ≤ 30 or there is no Ct value, and △Ct (Ct FAM -Ct CY5) > 14, the negative coincidence rate is 100%; when the positive reference product of the TERT C250T locus is tested by fluorescence PCR reaction, obvious amplification curves appear in both the CY5 and FAM channels, the Ct values are all ≤ 30, and △Ct (Ct FAM -Ct CY5 ) ≤ 14, and the positive coincidence rate is 100%. Through the comparison of the above tests, it can be concluded that the detection kit has good specificity.

[0172] Test Example 3: Sensitivity and wild tolerance test

[0173] The human BRAF gene V600E and TERT gene promoter (C228T, C250T) mutation detection kits were respectively used to perform fluorescence PCR reaction tests on 20 ng / μl wild-type human gDNA at the BRAF V600E locus and 5 ng / μl wild-type human gDNA containing 1% V600E mutant gDNA; 20 ng / μl wild-type human gDNA at the TERT C228T locus and 10 ng / μl wild-type human gDNA containing 0.5% TERT C228T mutant gDNA and 20 ng / μl wild-type human gDNA at the TERT C250T locus and 5 ng / μl wild-type human gDNA containing 1% TERT C250T mutant gDNA, and the test results are as Figure 5 and Figure 6 shown.

[0174] From Figure 5 、 Figure 6 it can be seen that when the detection kit performs a fluorescence PCR reaction test on wild-type human gDNA at the BRAF V600E locus, an obvious amplification curve appears in the CY5 channel, no amplification curve appears in the VIC channel, and the coincidence rate is 100%; when performing a sensitivity test on gDNA containing 1% V600E mutant, an obvious amplification curve appears, and the repeatability of the amplification curve is very good, and the coincidence rate is 100%. When performing a fluorescence PCR reaction test on wild-type human gDNA at the TERT C228T locus, the Ct value in the CY5 channel is ≤ 30, the Ct value in the FAM channel is ≤ 30 or there is no Ct value, and △Ct (Ct FAM -Ct CY5 ) > 13, and the coincidence rate is 100%; when performing a sensitivity test on gDNA containing 0.5% TERT C228T mutant, an obvious amplification curve appears, and the repeatability of the amplification curve is very good, and the coincidence rate is 100%. When performing a fluorescence PCR reaction test on wild-type human gDNA at the TERT C250T locus, the Ct value in the CY5 channel is ≤ 30, the Ct value in the FAM channel is ≤ 30 or there is no Ct value, and △Ct (Ct FAM -Ct CY5) > 14, and the coincidence rate is 100%; when performing sensitivity testing on gDNA containing 1% TERT C250T mutation, obvious amplification curves appeared, and the repeatability of the amplification curves was very good, and the coincidence rate was 100%.

[0175] Through the comparison of the above tests, it can be concluded that this kit cannot detect the mutation of normal wild-type human gDNA, and can still detect it under the condition of a low mutation rate. This kit has high sensitivity.

[0176] Test Example 4: 20 clinical sample tests

[0177] The kit for detecting mutations in human BRAF gene V600E and TERT gene promoter (C228T, C250T) detects the DNA in clinical samples. The samples to be tested are 20 clinical samples (paraffin-embedded tissue sections). While using the method of the present invention for detection, a part of the DNA of the paraffin section samples is sent to a professional testing company for Sanger sequencing, and the results are compared with the method described in the present invention.

[0178] The extraction method of paraffin section samples is as follows: Use the instruction manual of the paraffin-embedded tissue DNA extraction kit of Tiangen Company (DP331). Take 5 - 8 paraffin sections, and extract the DNA in the samples according to the instruction manual. After the samples are deparaffinized and digested with protease, through DNA binding, washing, and elution, high-quality DNA is extracted. The extracted DNA is detected with the kit in the present invention, and the detection results are as Figure 7 shown.

[0179] The kit detected and Sanger sequenced 14 paraffin section samples of patients diagnosed with papillary thyroid carcinoma and 6 paraffin section samples of normal tissues. The detection rate of BRAF gene V600E mutation in paraffin section samples of patients diagnosed with papillary thyroid carcinoma by the kit was 85.71%, and the detection rate of TERT promoter (TERT C228T) mutation was 7.14%. There were no BRAF V600E and TERT promoter (TERT C228T, TERT C250T) mutations in paraffin section samples of normal tissues. The detection rate of BRAF gene V600E mutation in paraffin section samples of patients diagnosed with papillary thyroid carcinoma by Sanger sequencing method was 50%, and the TERT promoter (TERT C228T) mutation was not detected. There were no BRAF V600E and TERT promoter (TERT C228T, TERT C250T) mutations in paraffin section samples of normal tissues. The mutation detection rate of the kit provided by the present invention is higher than that of Sanger sequencing, which can meet the requirements of DNA detection of paraffin-embedded tissues. Compared with the sequencing detection method, the detection time and cost are greatly reduced.

[0180] The above-described embodiments have detailed the technical solutions and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed.

Claims

1. A kit for detecting human BRAF gene V600E and TERT gene promoter mutations, characterized in that: The kit comprises: primers, probes, 5×PCR-Enhancer, 10×PCR Buffer, dNTP Mix, MalTaqDNAPolymerase, magnesium ions, DEPC water, positive control and negative control.

2. A kit for detecting human BRAF gene V600E and TERT gene promoter mutations according to claim 1, characterized in that: The primers include: The nucleotide sequences of the upstream primer-F and downstream primer-R of the BRAF V600E site were GTGATTTTGGTCTAGCTACAC[LNA-A] and TCTAGTAACTCAGCAGCATCTCAG, respectively; The nucleotide sequences of the upstream primer-F and downstream primer-R of the TERT C228T site were CCGGGCTCCCAGTGGATTC and GCTGGGAGGGCCCGGCA, respectively; The nucleotide sequences of the upstream primer-F and downstream primer-R of the TERT C250T site were CCGGGCTCCCAGTGGATTC and TGGGCCGGGGACCCGTA, respectively; The nucleotide sequences of the upstream primer-F and the downstream primer-R of the internal reference gene are CGCGAACTCACCCGTTGACT and CACTAGGCGCTCACTGTTCTC, respectively.

3. A kit for detecting human BRAF gene V600E and TERT gene promoter mutations as claimed in claim 1, characterized in that: The probe comprises: The mutation fluorescent probe-P of BRAF V600E site has the nucleotide sequence of VIC-ATGGAGTGGGTCCCATCAGTTTGAACAG-BHQ2; The mutation fluorescent probe-P of TERT C228T site, the nucleotide sequence is FAM-CGGGCACAGACGCCCAGGACCG-BHQ1; The mutation fluorescent probe-P of TERT C250T site, the nucleotide sequence is FAM-CGGGCACAGACGCCCAGGACCG-BHQ1; The nucleotide sequence of the internal reference fluorescent probe-P of the internal reference gene is CY5-ACCTTCACCTTCCCCATGGTGTCTG-BHQ2.

4. A kit for detecting human BRAF gene V600E and TERT gene promoter mutations according to any one of claims 1 to 3, characterized in that: The method for using the kit comprises the following steps: Step 1: Extract DNA from the sample to be tested; Step 2: Use the kit to perform a fluorescent PCR amplification reaction on the DNA of the sample to be tested to obtain a fluorescent detection result; Step 3: Use the fluorescence detection results to analyze whether the sample is positive or negative.

5. A kit for detecting human BRAF gene V600E and TERT gene promoter mutations according to claim 4, characterized in that: The reaction solutions used in the fluorescent PCR amplification reaction include BRAF V600E main reaction solution, TERTC228T main reaction solution and TERT C250T main reaction solution.

6. A kit for detecting human BRAF gene V600E and TERT gene promoter mutations according to claim 5, characterized in that: The BRAF V600E main reaction solution includes 2.5 μl of 10×PCR Buffer, 1 μl of dNTP Mix, 1 μl of MalTaq DNA Polymerase, 2 μl of magnesium ions, 1 μl of BRAF V600E site upstream primer-F, 1 μl of BRAFV600E site downstream primer-R, 1 μl of BRAF V600E site mutation fluorescent probe-P, 0.5 μl of internal reference gene upstream primer-F, 0.5 μl of internal reference gene downstream primer-R, 1 μl of internal reference gene internal reference fluorescent probe-P, 12.5 μl of DEPC water and 1 μl of sample DNA to be tested.

7. A kit for detecting human BRAF gene V600E and TERT gene promoter mutations according to claim 5, characterized in that: The TERT C228T main reaction solution includes 5 μl of 5×PCR-Enhancer, 2.5 μl of 10×PCRBuffer, 1 μl of dNTP Mix, 1 μl of MalTaq DNA Polymerase, 2 μl of magnesium ions, 2 μl of TERT C228T site upstream primer-F, 2 μl of TERT C228T site downstream primer-R, 2 μl of TERT C228T site mutation fluorescent probe-P, 0.5 μl of internal reference gene upstream primer-F, 0.5 μl of internal reference gene downstream primer-R, 1 μl of internal reference gene internal reference fluorescent probe-P, 3.5 μl of DEPC water and 2 μl of sample DNA to be tested.

8. A kit for detecting human BRAF gene V600E and TERT gene promoter mutations according to claim 5, characterized in that: The TERT C250T main reaction solution includes 5 μl of 5×PCR-Enhancer, 2.5 μl of 10×PCRBuffer, 1 μl of dNTP Mix, 1 μl of MalTaq DNA Polymerase, 2 μl of magnesium ions, 2 μl of TERT C250T site upstream primer-F, 2 μl of TERT C250T site downstream primer-R, 2 μl of TERT C250T site mutation fluorescent probe-P, 0.5 μl of internal reference gene upstream primer-F, 0.5 μl of internal reference gene downstream primer-R, 1 μl of internal reference gene internal reference fluorescent probe-P, 3.5 μl of DEPC water and 2 μl of sample DNA to be tested.

Images