Breeding method for constructing XX / XY sex determination all-female sterile fish and application
Through the combination of gene editing technology and gender determination technology, a group of all female sterile fish was obtained, which solved the problems of all female sterile and ecological security in aquaculture, and achieved efficient breeding and ecological protection.
Patent Information
- Application Number
- CN202311852783.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-29
- Publication Date
- 2025-07-01
AI Technical Summary
The prior art is difficult to efficiently obtain all female sterile fish populations in aquaculture, which has the risk of genetic pollution and poor fertility control effect, which affects ecological security and breeding yield.
Gene editing technology was used to knock out the catalytic enzyme-encoded genes of the fish sexual steroid hormone synthesis pathway, and homozygous XX sex inherited pseudo-male fish were screened out, and hybridized with the modified allotetraploid crucian carp female fish to obtain the allotriploid all female sterile population.
It has achieved efficient acquisition of all female sterile groups, avoided genetic pollution, increased breeding yield, and ensured ecological security through triploid chromosomal disorders, while improving hatching rate.
Smart Images

Figure CN120230794A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene editing technology, and also relates to the fields of fish sex control and fertility control breeding, and particularly relates to a breeding method for constructing XX / XY sex-determining all-female sterile fish and its application. Background Art
[0002] Gene editing technology has been widely studied in the related fields of aquaculture, and is of great significance for increasing the yield of aquaculture varieties, enhancing disease resistance, and improving the quality of aquatic products. However, once the aquaculture materials with genetic manipulation are released or escape into natural water bodies, they may naturally reproduce with wild-type populations, resulting in the introgression of genetic manipulation sites into wild-type populations in nature, thereby destroying the natural population genetic structure and genetic diversity, causing "gene pollution" of wild species by artificial genetic manipulation sites, and generating ecological safety risks that are difficult to predict and eliminate. This hinders the application and popularization of new breeding technologies based on genetic manipulation and aquaculture varieties with genetic manipulation in the aquaculture industry. Therefore, it is particularly important to develop fish fertility control technology.
[0003] There are widespread sexual differences in individual size, external morphology, and color characteristics among aquatic fish, which are called sexual dimorphism or gender dimorphism in fish. Many fish show significant sexual dimorphism in important production traits such as individual size. For example, female Yellow River carp grow significantly faster than males, and the economic value of this production trait is closely related to gender. Therefore, developing monosex breeding technology for fish is of great significance in the fish farming industry. For example: the invention patent with the patent number ZL202110274642.0 uses the CRISPR / Cas9 system to specifically cut cyp17a1 in fish, block the sex steroid hormone synthesis pathway in fish, obtain F1 generation cyp17a1 heterozygous fish (cyp17a1+ / -) with effective mutations, and perform self-crossing. By screening with sex markers, pseudo-male fish of F2 generation cyp17a1 homozygotes (cyp17a1- / -XX) with XX sex genotype are selected, and they are hybridized with wild-type female fish (cyp17a1+ / +XX) to obtain a 100% female fish population (cyp17a1+ / -XX), thereby obtaining a population culture of all-female cultured fish and achieving the effect of sex control breeding and the improvement of aquaculture yield. However, the genotype of this monosex fish is cyp17a1+ / -XX, which carries gene editing sites and may escape into natural water bodies and mate with wild populations, causing gene pollution and posing an ecological risk. Therefore, it is particularly important to achieve fertility control for fish carrying gene editing sites.
[0004] Triploids have an uneven number of chromosome sets. Chromosomes cannot synapse and pair normally during meiosis, and normal gametes cannot be produced. As a result, gonadal development is often impaired and can be used for the development of fertility control technologies. Sterile triploid economic fish have potential benefits in terms of growth ability because there is no energy loss during gonadal development at the sexually mature stage, but there is also a problem of low hatching rate. If gene editing technology, sex control technology, and fertility control technology can be organically combined and developed and applied in the field of aquatic genetics and breeding, it will effectively promote the sustainable development of the aquaculture industry.
[0005] In view of this, it is necessary to develop a technology for efficiently obtaining a completely female sterile population for aquaculture fish with XX / XY sex determination, which has important value and production significance for sex control breeding of aquatic fish, cultivation of single-sex populations, and fertility control breeding. Summary of the Invention
[0006] Aiming at the defects of the above-mentioned existing technologies, the purpose of the present invention is to provide a breeding method and application for constructing completely female sterile fish with XX / XY sex determination.
[0007] To achieve the above purpose, the present invention provides a breeding method for constructing completely female sterile fish with XX / XY sex determination. The catalytic enzyme encoding gene of the sex steroid hormone synthesis pathway in fish is knocked out by gene editing technology to block the sex steroid hormone synthesis pathway in fish, and homozygous pseudo-male fish with XX sex genotype with effective mutations are screened and obtained. Then, the pseudo-male fish are hybridized with improved allotetraploid crucian carp females to obtain an allotriploid population. All individuals in this population develop into females and are sterile due to gonadal developmental disorders, thus obtaining a completely female sterile population.
[0008] As a further improvement of the present invention, the catalytic enzyme encoding gene of the sex steroid hormone synthesis pathway includes one of the cyp17a1 catalytic enzyme encoding gene and the cyp19a1a catalytic enzyme encoding gene.
[0009] As a further improvement of the present invention, the method includes the following steps:
[0010] S1. Use gene editing technology to knock out the cyp17a1 gene in fish to obtain cyp17a1 deletion homozygous fish;
[0011] S2. From the cyp17a1 deletion homozygous fish, screen out cyp17a1 deletion homozygous fish without male sex markers and with XX sex genotype, which show physiological maleness and are denoted as pseudo-male fish;
[0012] S3. Hybridize the pseudo-male fish (cyp17a1- / -XX, 2n = 100) with the improved allotetraploid crucian carp female fish (cyp17a1+ / + / + / +XXXX, 4n = 200). After artificial induced spawning and fertilization, an allotriploid crucian carp population (cyp17a1+ / + / -XXX, 3n = 150) is obtained. All individuals in this population are female fish with the genotype cyp17a1+ / + / - and are sterile. Thus, a completely female and sterile population is obtained.
[0013] As a further improvement of the present invention, in step S1, obtaining the cyp17a1 deletion homozygous fish includes the following steps:
[0014] S11. Use gene editing technology to knockout the cyp17a1 gene in fish to obtain the F0 generation.
[0015] S12. Hybridize the F0 generation male fish with wild-type female fish, and perform amplification and sequencing of the target detection fragment on the genome of the obtained F1 generation to detect the mutation situation of the F1 generation, and obtain the F1 generation cyp17a1 heterozygous fish with effective mutations.
[0016] S13. Self-cross the F1 generation cyp17a1 heterozygous fish, and screen to obtain the F2 generation cyp17a1 deletion homozygous fish.
[0017] As a further improvement of the present invention, in step S11, the gene editing technology is to specifically cut the cyp17a1 gene of fish using the CRISPR / Cas9 system to achieve the editing of the cyp17a1 gene of fish. The specific process is as follows:
[0018] P1. Based on the CRISPR / Cas9 system, design the target site for editing the cyp17a1 gene of fish.
[0019] P2. Design corresponding primers according to the target site for editing the cyp17a1 gene of fish, and synthesize RNA containing the amplified fragment of the target site for editing the cyp17a1 gene of fish, denoted as gRNA.
[0020] P3. Prepare an injection mixture of gRNA and Cas9 mRNA in a predetermined ratio to obtain an injection mixture for editing the cyp17a1 gene, and perform microinjection of the injection mixture for editing the cyp17a1 gene into the fertilized eggs of fish (this step of operation may also directly obtain the cyp17a1 deletion homozygous fish described in S3 due to the improvement of the targeted editing efficiency, and omit the steps of obtaining cyp17a1+ / - heterozygotes and self-crossing described in S12 and S13).
[0021] P4. Raise the injected fertilized eggs of fish to sexual maturity to obtain the F0 generation.
[0022] As a further improvement of the present invention, in step P2, the fish cyp17a1 gene editing target site is located on exon 1 of the cyp17a1 gene, including a first target site and a second target site.
[0023] As a further improvement of the present invention, in step S13, F2 generation cyp17a1 homozygous deletion fish lacking a predetermined number of base pairs at the target site are screened out by restriction enzyme digestion identification.
[0024] As a further improvement of the present invention, in step S2, the pseudo-male fish are male fish with normal testis structure and spermatogenesis, but without male secondary sexual characteristics (the bead stars on the operculum and the genital tubercles on the pectoral fins); the screening process of the pseudo-male fish is as follows: XX sex-genotype cyp17a1 homozygous deletion fish are screened out by sex marking.
[0025] As a further improvement of the present invention, the fish is a Cyprinidae fish.
[0026] To achieve the above object, the present invention also provides an application of the above breeding method for constructing XX / XY sex-determining all-female sterile fish in the fields of sex control breeding and fertility control of aquaculture economic fish.
[0027] The beneficial effects of the present invention are as follows:
[0028] 1. The breeding method for constructing XX / XY sex-determining all-female sterile fish provided by the present invention proposes an inventive concept of hybridizing pseudo-male fish obtained by gene editing breeding with improved allotetraploid crucian carp females to obtain all-female sterile fish. By using the CRISPR / Cas9 system to specifically cut the cyp17a1 gene of fish (the catalytic enzyme encoding gene of an important sex steroid hormone synthesis pathway), the sex steroid hormone synthesis pathway of fish is blocked, and the levels of estrogen and androgen can be significantly reduced. Whether the sex genotype is XX or XY, cyp17a1 homozygous deletion fish can develop into male fish with normal testis structure and spermatogenesis, but without male secondary sexual characteristics. On this basis, the present invention uses sex marking to screen out XX sex-genotype cyp17a1 homozygous deletion fish, and hybridizing them with improved allotetraploid crucian carp can obtain allotriploid crucian carp, and this population is an all-female sterile population. This method does not require the use of hormone treatment to obtain pseudo-male fish, avoiding environmental pollution caused by drugs; nor does it require cumbersome methods such as cold shock and hydrostatic pressure to obtain triploids, and has the advantages of safety and high efficiency.
[0029] 2. The breeding method for constructing XX / XY sex-determining all-female sterile fish provided by the present invention can efficiently obtain an all-female sterile population. This population is a female-only population and has an obvious growth advantage compared to the male-female mixed population. At the same time, this population is also a triploid population. Since triploids have an uneven number of chromosome sets, during meiosis, the chromosomes will undergo synaptic disorders and cannot produce normal gametes, resulting in sterility. This can effectively prevent the "gene pollution" caused by the drift of artificial genetic operation sites in the wild population, thereby ensuring the ecological safety of natural populations. Moreover, the method provided by the present invention has a higher hatching rate compared to conventional triploid induction methods.
[0030] 3. The breeding method for constructing XX / XY sex-determining all-female sterile fish provided by the present invention has wide adaptability and expandability in aquaculture economic fish, greatly expanding the application scope of the method provided by the present invention in the fields of sex control breeding and fertility control breeding of aquaculture economic fish. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 It is a schematic flow chart of the breeding method for constructing XX / XY sex-determining all-female sterile fish provided by the present invention.
[0032] Figure 2 It is a comparison chart of partial cyp17a1 cDNA sequences of wild-type control Yellow River carp and cyp17a1 homozygous deletion fish provided by the present invention.
[0033] Figure 3 It is a flow cytometry analysis chart of the heterologous triploid all-female crucian carp provided in Comparative Example 1 and Example 1.
[0034] Figure 4 It is an agarose gel electrophoresis chart for sex marker identification of diploid male and female fish in Comparative Example 1 and the heterologous triploid all-female crucian carp provided in Example 1.
[0035] Figure 5 It is a HE staining chart of gonad sections of diploid male and female fish in Comparative Example 1 and the heterologous triploid all-female crucian carp provided in Example 1.
[0036] Figure 6 It is an observation chart of ovarian squash preparations of diploid male and female fish in Comparative Example 1 and the heterologous triploid all-female crucian carp provided in Example 1.
[0037] Figure 7 It is a genetic schematic diagram of the cross between the pseudo-male fish (cyp17a1- / -XX) and the improved heterologous tetraploid crucian carp provided by the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0038] To make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.
[0039] Here, it should also be noted that in order to avoid obscuring the present invention with unnecessary details, only the structures and / or processing steps closely related to the solution of the present invention are shown in the drawings, while other details less related to the present invention are omitted.
[0040] In addition, it should also be noted that the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, such that a process, method, article or device comprising a series of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article or device.
[0041] The present invention provides a breeding method for constructing XX / XY sex-determining all-female sterile fish, and the schematic flow chart thereof is as Figure 1 shown, specifically as follows:
[0042] Using gene editing technology to knockout the catalytic enzyme encoding gene of the sex steroid hormone synthesis pathway in fish, so as to block the sex steroid hormone synthesis pathway in fish, and screening to obtain homozygous pseudo-male fish with an effective mutation of XX sex genotype.
[0043] Then, using the methods of artificial induced spawning and fertilization, hybridize the pseudo-male fish with the improved allotetraploid crucian carp females to obtain an allotriploid population, all of which develop into females and are sterile due to gonadal dysplasia, thereby obtaining an all-female sterile population.
[0044] Through the above method, an all-female sterile population can be efficiently obtained, and at the same time, sex control and fertility control breeding of fish can be achieved.
[0045] Among them, the catalytic enzyme encoding gene of the sex steroid hormone synthesis pathway includes one of the cyp17a1 catalytic enzyme encoding gene and the cyp19a1a catalytic enzyme encoding gene.
[0046] Preferably, the method specifically includes the following steps:
[0047] S1. Using gene editing technology to knockout the cyp17a1 gene in fish to obtain cyp17a1 deletion homozygous fish;
[0048] S2. Screening out cyp17a1 deletion homozygous fish without male sex markers and XX sex genotype from the cyp17a1 deletion homozygous fish, which are physiologically male and are denoted as pseudo-male fish;
[0049] S3. Hybridize the pseudo-male fish (cyp17a1- / -XX, 2n = 100) with the improved allotetraploid crucian carp female fish (cyp17a1+ / + / + / +XXXX, 4n = 200). After artificial induced spawning and fertilization, an allotriploid crucian carp population (cyp17a1+ / + / -XXX, 3n = 150) is obtained. All individuals in this population are female fish with the genotype cyp17a1+ / + / - and have gonadal dysplasia and sterility, thus obtaining an all-female sterile population.
[0050] In step S1, obtaining the cyp17a1 deletion homozygous fish includes the following steps:
[0051] S11. Use gene editing technology to knockout the cyp17a1 gene in fish to obtain the F0 generation;
[0052] S12. Hybridize the F0 generation male fish with wild-type female fish, and perform amplification and sequencing of the target detection fragment on the genome of the obtained F1 generation to detect the mutation situation of the F1 generation, and obtain the F1 generation cyp17a1 heterozygous fish with effective mutations;
[0053] S13. Self-cross the F1 generation cyp17a1 heterozygous fish to screen and obtain the F2 generation cyp17a1 deletion homozygous fish.
[0054] In step S11, the gene editing technology is to specifically cut the cyp17a1 gene of fish using the CRISPR / Cas9 system to achieve the editing of the cyp17a1 gene of fish. The specific process is as follows:
[0055] P1. Based on the CRISPR / Cas9 system, design the target site for editing the cyp17a1 gene of fish;
[0056] P2. Design corresponding primers according to the target site for editing the cyp17a1 gene of fish, and synthesize RNA containing the amplified fragment of the target site for editing the cyp17a1 gene of fish, denoted as gRNA;
[0057] P3. Prepare an injection mixture of gRNA and Cas9 mRNA in a predetermined ratio to obtain an injection mixture for editing the cyp17a1 gene, and perform microinjection of the injection mixture for editing the cyp17a1 gene into the fertilized eggs of fish (this step of operation may also directly obtain the cyp17a1 deletion homozygous fish described in S3 due to the improvement of the targeted editing efficiency, thus omitting the steps of obtaining cyp17a1+ / - heterozygotes and self-crossing described in S12 and S13);
[0058] P4. Raise the injected fertilized eggs of fish to sexual maturity to obtain the F0 generation.
[0059] In step P2, the gene editing target site of the fish cyp17a1 gene is located on exon 1 of the cyp17a1 gene, including a first target site and a second target site.
[0060] In step S12, the process of obtaining the F1 generation of cyp17a1 heterozygous fish with effective mutations is as follows: Amplify and sequence the target detection fragment of the F1 generation of fish individuals, detect the mutation situation of the F1 generation, and screen out the F1 generation with effective mutations.
[0061] In step S13, screen out the F2 generation of cyp17a1 homozygous deletion fish that have deleted a predetermined number of base pairs at the target site through enzyme digestion identification.
[0062] In step S2, the pseudo-male fish is a male fish with a normal testis structure and spermatogenesis, but without male secondary sexual characteristics (the bead stars on the operculum and the genital tubercles on the pectoral fins); the screening process of the pseudo-male fish is as follows: Screen out the cyp17a1 homozygous deletion fish with XX sex genotype through sex marking.
[0063] In the present invention, the fish is an economically cultured fish, and preferably an economically cultured fish with male heterogametic genetic determination (XX / XY sex genetic determination), and more preferably a cyprinid fish.
[0064] The present invention also provides the application of the above breeding method for constructing XX / XY sex-determining all-female sterile fish in the fields of sex control breeding and fertility control of economically cultured fish.
[0065] The following combines specific embodiments to detail the breeding method and application for constructing XX / XY sex-determining all-female sterile fish provided by the present invention.
[0066] Example 1
[0067] This example provides a breeding method for constructing XX / XY sex-determining all-female sterile fish, including the following steps:
[0068] S1. Use gene editing technology to knockout the cyp17a1 gene in yellow river carp to obtain cyp17a1 homozygous deletion fish. The specific process is as follows:
[0069] S11. Use the CRISPR / Cas9 technology to knockout the cyp17a1 gene in yellow river carp to obtain the F0 generation. The specific method is as follows:
[0070] 1) Search for the cyp17a1 gene editing target sites through the online tool at http: / / zifit.partners.org / ZiFiT / Disclaimer.aspx. The gene target sites are located on exon 1 of the cyp17a1 gene, divided into the first target site and the second target site. The sequences of the above two are TGGCTTTTCTGTTCATGCC and CCAAGCCTCCCATCACTCCC respectively;
[0071] 2) Design corresponding primers according to the cyp17a1 gene editing target sites of the fish. The sequence of the forward primer for the first target site is TAATACGACTCACTATAGGGCATGAACAGAAAAGCCAGTTTTAGAGCTAGAAATAGC, and the sequence of the forward primer for the second target site is TAATACGACTCACTATAGGGGAGTGATGGGAGGCTTGGGTTTTAGAGCTAGAAATAGC. The sequence of the common reverse primer for the first target site and the second target site is AGCACCGACTCGGTGCCACT. Using these primers with the pUC19-gRNA-scaffold plasmid as the template, synthesize the amplification fragments containing the cyp17a1 gene editing target sites of the fish, and synthesize RNA, denoted as gRNA1 and gRNA2; specifically: Use the TranscriptAid T7 HighYield Transcription Kit from Thermo to synthesize the gRNAs containing the above two cyp17a1 target sites, denoted as gRNA1 and gRNA2 respectively. After synthesis, run agarose gel for detection. After measuring the concentration, dilute it to 500 ng / μL and store it at -80 °C for later use;
[0072] 3) Cas9 mRNA is transcribed from the pXT7-Cas9 vector. Specifically: Use the mMESSAGEmMACHINE mRNA transcription synthesis kit from Invitrogen to synthesize capped Cas9 mRNA. After measuring the concentration, dilute it to 500 ng / μL and store it at -80 °C for later use;
[0073] 4) Mix gRNA1 and gRNA2 with a concentration of 100 ng / μL and Cas9 mRNA with a concentration of 200 ng / μL as the injection material for cyp17a1 gene editing, and inject it into the 1- or 2-cell embryos of yellow river carp using microinjection. The injection volume is 1.0 nL; The injected fish eggs are raised to sexual maturity to obtain the F0 generation, and gene editing of cyp17a1 is achieved by specifically cleaving the cyp17a1 gene.
[0074] S12. After inducing ovulation and sperm production in F0 male common carp and wild-type female common carp using compound chorionic gonadotropin B for injection, artificial insemination was carried out for hybridization to obtain F1 generation. PCR was performed on the genome of the F1 generation to detect the mutation situation of the offspring, and the F1 generation cyp17a1 heterozygous fish (cyp17a1+ / -) with effective mutations were screened out. Among the primers for amplifying and sequencing the target detection fragment, the forward primer sequence for screening cyp17a1 heterozygous fish was CCGATGAC ACTTAGATAGTTG, and the reverse primer sequence was CATGTTGGCTGCAGTGATACTC.
[0075] S13. The F1 generation cyp17a1 heterozygous fish with effective mutations were self-crossed to obtain F2 generation. Through enzyme digestion identification, the effective mutation lines with deletion at the target site were screened out, that is, the cyp17a1 deletion homozygous fish were obtained.
[0076] The comparison diagram of the partial sequence of cyp17a1 cDNA between the cyp17a1 deletion homozygous fish and the wild-type control Yellow River carp is as Figure 2 shown.
[0077] S2. All gonads of the F2 generation cyp17a1 deletion homozygous fish developed into testes, with normal testis structure and spermatogenesis. The cyp17a1 deletion homozygous fish with XX sex genotype were screened out through sex markers, which were pseudo-male fish.
[0078] S3. The pseudo-male fish (cyp17a1- / -XX, 2n = 100) were hybridized with the improved allotetraploid female crucian carp (cyp17a1+ / + / + / +XXXX, 4n = 200). The hybridization genetic schematic diagram is as Figure 7 shown. After artificial induction of ovulation and insemination, an allotriploid crucian carp population (cyp17a1+ / + / -XXX, 3n = 150) was obtained. All individuals in this population were female fish with the genotype cyp17a1+ / + / - and had gonadal dysplasia and infertility, thus obtaining a completely female and infertile population.
[0079] The test results showed that by using the above method, offspring were produced by two pairs of pseudo-male fish and the improved allotetraploid female crucian carp. The number of hybrid offspring fry obtained for each pair was greater than 800 tails, and the survival situation was good.
[0080] Comparative Example 1
[0081] For the convenience of comparison with Example 1, in this comparative example, diploid common carp was used. The offspring obtained after artificial induction of ovulation and insemination of wild-type female and male fish were used as Comparative Example 1 for chromosome ploidy, sex differentiation, and gonadal development comparative tests. The results are as Figures 3 - 6 shown.
[0082] From Figures 3 - 6It can be seen that the DNA content in the blood cells of the allogynogenetic triploid crucian carp population obtained in Example 1 was 1.5 times that of the control diploid carp detected by flow cytometry, confirming that it was a triploid. By detecting with sex markers, it was found that there were no male-specific PCR bands in the allogynogenetic triploid all-female crucian carp. Through HE staining of gonadal sections, it was found that the gonads of the allogynogenetic triploid all-female crucian carp in Example 1 all developed into abnormal female gonads. For the offspring of the diploid carp in Comparative Example 1, the sexes were normally differentiated into females and males, and the testes and ovaries could develop normally, while the gonads of the allogynogenetic triploid all-female crucian carp all developed into ovaries and were abnormally developed.
[0083] In summary, the present invention provides a breeding method and application for constructing XX / XY sex-determining all-female sterile fish. This method uses gene editing technology to knock out the catalytic enzyme-encoding gene in the sex steroid hormone synthesis pathway of fish to block the sex steroid hormone synthesis pathway of fish, and screens to obtain homozygous XX sex-genotype pseudo-male fish with effective mutations. Then, the pseudo-male fish are hybridized with the improved allogynogenetic tetraploid crucian carp females to obtain an allogynogenetic triploid population. All individuals in this population develop into females and are sterile, thus achieving the effect of obtaining an all-female and sterile population at the same time. This method has strong applicability. Applying the method provided by the present invention widely to aquaculture fish can obtain a female monosex population of fish, improve aquaculture production, effectively control female fertility, protect ecological safety, and has broad application prospects in the fields of aquaculture fish genetic breeding and ecological safety.
[0084] The above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention.
Claims
1. A breeding method for constructing XX / XY sex-determining all-female sterile fish, characterized in that: The catalytic enzyme-encoding gene in the sex steroid hormone synthesis pathway of fish is knocked out by gene editing technology to block the sex steroid hormone synthesis pathway of fish, and homozygous XX sex-genotype pseudo-male fish with effective mutations are screened and obtained. Then, the pseudo-male fish are hybridized with improved allotetraploid crucian carp females to obtain an allotriploid population, which is a completely female and sterile population.
2. The breeding method for constructing XX / XY sex-determining all-female sterile fish according to claim 1, characterized in that: The catalytic enzyme-encoding gene in the sex steroid hormone synthesis pathway includes one of the cyp17a1 catalytic enzyme-encoding gene and the cyp19a1a catalytic enzyme-encoding gene.
3. The breeding method for constructing XX / XY sex-determining all-female sterile fish according to claim 2, characterized in that: The method includes the following steps: S1. Use gene editing technology to knock out the cyp17a1 gene in fish to obtain cyp17a1 deletion homozygous fish; S2. From the cyp17a1 deletion homozygous fish, screen out cyp17a1 deletion homozygous fish without male sex markers and with XX sex-genotype, which are physiologically male and are denoted as pseudo-male fish; S3. Hybridize the pseudo-male fish with improved allotetraploid crucian carp females, and after artificial induced spawning and fertilization, obtain an allotriploid crucian carp population; all the allotriploid crucian carp population are females with the genotype cyp17a1+ / + / - and are sterile, which is a completely female and sterile population.
4. The breeding method for constructing XX / XY sex-determining all-female sterile fish according to claim 3, characterized in that: In step S1, obtaining the cyp17a1 deletion homozygous fish includes the following steps: S11. Use gene editing technology to knock out the cyp17a1 gene in fish to obtain the F0 generation; S12. Hybridize the F0 generation male fish with wild-type female fish, and perform amplification and sequencing of the target detection fragment on the genome of the obtained F1 generation to detect the mutation situation of the F1 generation, and obtain F1 generation cyp17a1 heterozygous fish with effective mutations; S13. Self-cross the F1 generation cyp17a1 heterozygous fish, and screen to obtain F2 generation cyp17a1 deletion homozygous fish.
5. The breeding method for constructing XX / XY sex-determining all-female sterile fish according to claim 4, characterized in that: In step S11, the gene editing technology is to specifically cut the cyp17a1 gene of fish by using the CRISPR / Cas9 system to achieve the editing of the cyp17a1 gene of fish. The specific process is as follows: P1. Based on the CRISPR / Cas9 system, design the gene editing target site of the cyp17a1 gene of fish; P2. Design corresponding primers according to the gene editing target site of the cyp17a1 gene of fish, and synthesize RNA containing the amplified fragment of the gene editing target site of the cyp17a1 gene of fish, which is denoted as gRNA; P3. Prepare an injection mixture of gRNA and Cas9 mRNA according to a predetermined ratio to obtain an injection mixture for cyp17a1 gene editing, and perform microinjection of the injection mixture for cyp17a1 gene editing into the fertilized eggs of fish; P4. Raise the injected fertilized eggs of fish to sexual maturity to obtain the F0 generation.
6. The breeding method for constructing XX / XY sex-determining all-female sterile fish according to claim 5, characterized in that: In step P2, the gene editing target site of the cyp17a1 gene of fish is located on exon 1 of the cyp17a1 gene and includes a first target site and a second target site.
7. The breeding method for constructing XX / XY sex-determining all-female sterile fish according to claim 4, characterized in that: In step S13, F2 generation cyp17a1 deletion homozygous fish with a predetermined number of base pairs deleted at the target site are screened out by enzyme digestion identification.
8. The breeding method for constructing XX / XY sex-determining all-female sterile fish according to claim 3, characterized in that: In step S2, the pseudo-male fish is a male fish with a normal testis structure and spermatogenesis, but without male secondary sexual characteristics; the screening process of the pseudo-male fish is as follows: XX sex-genotype cyp17a1 deletion homozygous fish are screened out by means of sex marking.
9. The breeding method for constructing XX / XY sex-determining all-female sterile fish according to claim 1, characterized in that: The fish is a cyprinid fish.
10. Application of the breeding method for constructing XX / XY sex-determining all-female sterile fish according to any one of claims 1 to 9 in the fields of sex control breeding and fertility control of aquaculture economic fish.
Citation Information
Patent Citations
Method for realizing XX / XY sex genetic determinant fish sex control breeding and application
CN113789352A
Cited By
Molecular marker related to testis character of allotetraploid crucian carp and carp and application of molecular marker
CN121023034A
Method for constructing pseudo male carp parent and breeding all-female carp based on cyp19a1aA gene editing
CN121204162A