Visual detection method of canine adeno-virus type 2 CRISPR-Cas13a

Abstract

The invention relates to a nucleic acid detection platform based on an SHERLOCK technology, which is used for diagnosing CAV-2. The SHERLOCK consisting of recombinase polymerase nucleic acid pre-amplification (RPA) and CRISPR-Cas13a is mainly used for specifically recognizing a conserved sequence of CAV-2RNA (Ribonucleic Acid) through crRNA (Complementary Ribonucleic Acid) so as to activate the non-specific'side cutting activity 'of lwCas13a, so that the report RNA is degraded. A real-time fluorescent quantitative PCR (qPCR) system or a lateral flow test strip is used for collecting fluorescent signals generated by cracking of the reporter molecules, and a visual result is displayed. In addition, through HUDSON treatment, RPA-CRISPR can be amplified at room temperature without viral nucleic acid extraction. The detection limit of the method is 1.1 * 10 < 2 > copies / [mu] L, and the method has no cross reaction with other canine infectious viruses. From sample collection to result output, the whole reaction of RPA-CRISPR can be completed within two hours, and the RPA-CRISPR kit is suitable for rapid test of clinical samples and can work well in the field or in primary laboratories. The method can get rid of the limitation of a detection instrument and complex operation, and is suitable for on-site rapid batch detection. The method is preliminarily verified and further optimized and applied.

Description

Technical Field

[0001] The present invention belongs to the field of virus detection, and particularly relates to a visual detection method for canine adenovirus type 2 CRISPR-Cas13a. Background Art

[0002] Canine Adenovirus Type 2 (CAV-2) is a common canine virus. Nucleic acid detection is a common method for CAV-2 detection, but it has deficiencies in terms of specificity, simplicity, temperature, and requirements for reagents and instruments. SHELOCK (Specific High-sensitivity Enzymatic Reporter unLOCKing) is a CRISPR detection technology. The applicant's Chinese patent CN119685528A discloses a method for detecting canine parvovirus based on the SHELOCK method, and Chinese patent CN119287082A discloses a method for detecting canine distemper virus based on SHERLOCK. The inventors found that specific RPA primers and specific crRNAs need to be paired, and based on the CRISPR-Cas13a lateral flow detection method, canine parvovirus or canine distemper virus can be directly detected visually. Although the prior art gives some design and experimental methods for RPA primers and crRNAs, based on the prior art, specific RPA primers and specific crRNA pairings for visual detection of canine adenovirus type 2 CRISPR-Cas13a cannot be obtained. Summary of the Invention

[0003] To solve the above technical problems, the present invention provides an RPA primer for detecting canine adenovirus type 2, including any one of the following groups:

[0004] The first group:

[0005] Sequence 1 RPAF1:

[0006] GAAATTAATACGACTCACTATAGGGCTTTTGCTWTGCCTGTACGTTCAGARCCC; Sequence 2 RPAR1:

[0007] CCCCAGGTTTGGCAGACACAAAAATAACTT;

[0008] The third group:

[0009] Sequence 5 RPAF3:

[0010] GAAATTAATACGACTCACTATAGGGGGTTTTGTCTTTTACCTCCCCATTACATAA; Sequence 6 RPAR3:

[0011] TTAAGGGTGCCATTTTCATCTTCTAACCCA;

[0012] The fourth group:

[0013] Sequence 7 RPAF4:

[0014] GAAATTAATACGACTCACTATAGGGAAACACTGTATCCCTAGCGCTAGGAGATGG; Sequence 8 RPAR4:

[0015] GAATTGTAGCGGGGGAGGGGGAGTAGGGAA.

[0016] Further RPA primers for detecting canine adenovirus type 2, which are the third group:

[0017] Sequence 5 RPAF3:

[0018] GAAATTAATACGACTCACTATAGGGGGTTTTGTCTTTTACCTCCCCATTACATAA; Sequence 6 RPAR3:

[0019] TTAAGGGTGCCATTTTCATCTTCTAACCCA.

[0020] The present invention also provides a crRNA for detecting canine adenovirus type 2, including any one of the following groups:

[0021] The first group:

[0022] Sequence 9 crRNAs IVT-1tempaltes:

[0023] TTCGGCTGGAGCTGAGGAGGAAGATGATGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC;

[0024] The third group:

[0025] Sequence 11 crRNAs IVT-3tempaltes:

[0026] TGAAAACACTGTATCCCTAGCGCTAGGAGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC;

[0027] Group 4:

[0028] Sequence 12 crRNAs IVT-4 tempaltes:

[0029] TTAGAAGATGAANATGGCACCCTTAAAGGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC。

[0030] Furthermore, the crRNA for detecting Canine adenovirus type 2, which is the third group:

[0031] Sequence 11 crRNAs IVT-3 tempaltes:

[0032] TGAAAACACTGTATCCCTAGCGCTAGGAGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC。

[0033] The present invention also provides a reagent for detecting Canine adenovirus type 2, which comprises the aforementioned RPA primers and the aforementioned crRNA. Preferably: the first group of RPA primers are paired with the first group of crRNA, the third group of RPA primers are paired with the third group of crRNA, and the fourth group of RPA primers are paired with the fourth group of crRNA; More preferably: the third group of RPA primers are paired with the third group of crRNA. In this field, the technical difficulty lies in the design of RPA primers and crRNA. Different virus RPA primers are different from each other. The present invention unexpectedly discovers that the primer pair of the third group of RPA primers paired with the third group of crRNA has the best visual detection effect for CRISPR-lwCas13a.

[0034] The reagent for further detecting Canine adenovirus type 2 further comprises Cas13a protein. The concentration of the crRNA is 0.5 - 5 ng / ul, and the concentration of the Cas13a protein is 0.5 - 5 ng / ul; Preferably: the concentration of the crRNA is 2.5 ng / ul, and the concentration of the Cas13a protein is 2 ng / ul.

[0035] Reagent for further detecting canine adenovirus type 2, the reagent comprising: RPA product: 1 - 3 μl, T7 RNA polymerase mix: 0.3 - 0.8 μl, Rnase inhibitor murine: 0.5 - 2 μl, NTP buffer mix: 0.5 - 1 μl, 10×PCR std buffer: 1 - 3 μl, Cas13a (50 μM): 1 - 2 μl, crRNA: 1 - 2 μl, probe-polyU (10 μM) 1 - 2 μl, DEPC water: 9 - 11 μl. The preferred reaction reagent is a reaction mixture composed of the aforementioned primer (10 μM): 1 - 3 μl, Buffer A 40 - 45 μl, and Buffer B plus 2 - 3 μl.

[0036] The present invention also provides a kit for detecting canine adenovirus type 2, comprising the aforementioned RPA primer, the aforementioned crRNA, or the aforementioned reagent.

[0037] The present invention also provides a visual detection method for canine adenovirus type 2 CRISPR-Cas13a, the method using the aforementioned RPA primer, the aforementioned crRNA, or the aforementioned reagent to perform the detection reaction steps of CRISPR-lwCas13a on a lateral flow chromatographic test strip; preferably: further comprising a HUDSON treatment step for the sample to be tested.

[0038] The present invention also provides an application of the aforementioned RPA primer, the aforementioned crRNA, or the aforementioned reagent in a product for detecting or diagnosing canine adenovirus type 2.

[0039] The beneficial effect of the present invention is that the present invention relates to a nucleic acid detection platform based on SHERLOCK technology for diagnosing CAV-2. SHERLOCK composed of recombinase polymerase nucleic acid pre-amplification (RPA) and CRISPR-Cas13a mainly activates the non-specific "collateral cleavage activity" of lwCas13a by specifically recognizing the conserved sequence of CAV-2 RNA through crRNA, thereby degrading the reporter RNA. The fluorescence signal generated by the cleavage of the reporter molecule is collected through a real-time fluorescence quantitative PCR (qPCR) system or a lateral flow test strip, and its visual result is displayed. In addition, after HUDSON treatment, RPA-CRISPR can be amplified at room temperature without virus nucleic acid extraction. The detection limit of this method is 1.1×10 2copies / μL and has no cross-reaction with other canine infectious viruses. From sample collection to result output, the entire reaction of RPA-CRISPR can be completed within two hours, suitable for rapid testing of clinical samples and can work well in the field or primary laboratories. This method can get rid of the limitations of detection instruments and complex operations and is suitable for rapid batch detection on-site. Conduct a preliminary verification of this method and further optimize its application. Brief Description of the Drawings

[0040] Figure 1 . Screening of RPA primers and CRISPR RNA;

[0041] Figure 2 . Screening of RPA primers and CRISPR RNA with lateral flow test strips;

[0042] Figure 3 . PCR results of the target fragment;

[0043] Figure 4 . Optimization and verification of the fluorescence kinetics detection method based on RPA-CRISPR technology;

[0044] Figure 5 . Verification of the method for detecting CAV-2 with lateral flow test strips;

[0045] Figure 6 . Sensitivity and specificity of the lateral flow strip based on RPA-CRISPR;

[0046] Figure 7 . Detection of 20 clinical samples by three methods. Detailed Implementation Manner

[0047] Term Explanation:

[0048] SHELOCK (Specific High-sensitivity Enzymatic Reporter unLOCKing), specific high-sensitivity enzymatic unlocking, is a CRISPR detection technology.

[0049] CRISPR RNA (crRNA) is a key component in the CRISPR-Cas system. It is a small RNA molecule used to guide the Cas nuclease to recognize and cut specific DNA sequences.

[0050] lwCas13a (also known as LwaCas13a or C2c2) is a crRNA-dependent RNA endonuclease.

[0051] The HUDSON (Heating Unextracted Diagnostic Samples to Obliterate Nucleases) process, which involves heating unextracted diagnostic samples to eliminate nucleases, is prior art. See: Cameron Myhrvold et al. Field-deployable viral diagnostics using CRISPR-Cas13. Science, 27 Apr 2018, 360(6387):444-448, doi:10.1126 / science.aas8836.

[0052] DNAStar is a sequence analysis software based on Windows and Macintosh platforms.

[0053] Materials:

[0054] 1.1 Viruses and clinical samples

[0055] CAV-2 Manhattan strain

[0056] 1.2 Main reagents and instruments

[0057] The viral DNA extraction kit was purchased from OMEGA BioTek, USA; Cas13a (Lwa) was purchased from Guangzhou Bolaisi Biotechnology Co., Ltd.; T7Quick High Yield RNA Synthesis Kit( T7 rapid high-yield RNA synthesis kit), RNA Cleanup Kit(500μg)( RNA purification kit (500μg) by centrifugal column method), RNase inhibitor Murine (murine RNase inhibitor) were all purchased from New England Biolabs; Milenia HybriDetect 1 (lateral flow test strip) was purchased from TwistDx; TaKaRa Ex Taq was purchased from TaKaRa; RT-fluorescent nucleic acid amplification kit was purchased from Hangzhou Zhongce Biotechnology Co., Ltd.; DEPC sterile water was purchased from Beijing Solarbio Science & Technology Co., Ltd. The CFX96 Touch real-time fluorescence quantitative PCR instrument was purchased from Bio-Rad, USA.

[0058] Example 1 Preparation of nucleic acids

[0059] Extract the viral DNA or RNA of CPIV, CDV, CHV, CHPV, CCOV and CAV-2 respectively according to the instructions of the viral DNA extraction kit and the viral RNA extraction kit. All the extracted viral nucleic acids are stored at -80°C and avoid repeated freezing and thawing.

[0060] Example 2 Preparation of RPA primers and crRNA

[0061] Table 1 shows the RPA primers and Table 2 shows the crRNA. The DNA templates of the RPA primers and crRNA are synthesized by Jilin Kumei Biotechnology Co., Ltd.

[0062] Table 1 Related RPA primer sequences

[0063]

[0064] Table 2 Related CRISPR RNA sequences

[0065]

[0066] Synthesis of CRISPR RNA:

[0067] Use the TaKaRa Ex Taq kit to anneal the DNA template of crRNA into double-stranded DNA. Annealing system: crRNAsIVT tempaltes (100uM) 1ul, T7-3G IVT (100uM)

[0068] 1ul, 10×PCR std buffer 1ul, dNTP (2.5mM) 0.8ul, Ex Taq 0.05ul, and DEPC H2O is added to make up the total system to 10ul. Perform the annealing reaction. Annealing program: 95°C for 5min; 94°C to 4°C (0.5°C / s); 72°C for 1min. According to the instructions of the HiScribe T7 Quick High Yield RNA Synthesis Kit, add 10ul NTP buffer mix, 2ul T7 RNA polymerase mix and 18ul DEPC H2O to the annealing product obtained in the previous step. Transcribe the double-stranded DNA into crRNA by incubating overnight at 37°C. According to the manufacturer's instructions, use RNA Cleanup Kit to purify crRNA, and adjust the concentration to 10ng / ul with DEPC H2O (aliquot 20ul per tube and store at -80°C).

[0069] Example 3 Construction of standard plasmid

[0070] Using the MANHATTAN strain cDNA as a template, PCR amplification was performed using the primers CAV-2F1 (5'-TGTCAACAAGGTTTTGTCTTTT-3') / R1 (5'-TTTTCAAGGGAGGTGCGT-3'). The reaction system was the same as in Table 2-2, and the PCR reaction was carried out at an annealing temperature of 52°C. After cloning and ligating into the pMD-19T vector and correct identification, the plasmid was named pMD-19T-RPAZL and stored at -80°C for later use. The concentration of pMD-19T-RPAZL was measured and serially diluted 10-fold, which was used as the standard for the sensitivity experiment in the CRISPR–Cas 13a visual detection method.

[0071] Example 4 One-step Recombinase Polymerase Amplification (RPA)

[0072] According to the instructions of the domestic RAA kit, 40.9 μl of Buffer A, 2 μl each of the upstream and downstream primers RPA F1 / R1 (10 μM), 2 μl of the viral genomic template, and 2.5 μl of Buffer B were added to each tube of reaction dry powder to form a 50 μl reaction mixture. After adding, cover the tube cap, invert and mix well 5-6 times, centrifuge at low speed for 10 s, and react at 42°C for 30 min for viral nucleic acid pre-amplification.

[0073] Example 5 Optimization of the CRISPR-Cas 13a Detection Reaction System

[0074] Using the RPA pre-amplified product obtained in Example 4 as a template, 2 μl was taken and added to a total reaction system of 20 μl. The crRNA transcribed by T7 in Example 2 and the lwCas13a protein purchased from a reagent company were serially diluted 2-fold in RNase-free water to obtain crRNA with final concentrations of 0.625 ng / μl, 1.25 ng / μl, 2.5 ng / μl, 5 ng / μl, 10 ng / μl and Cas13a protein with final concentrations of 2 ng / μl, 4 ng / μl, 8 ng / μl, 10 ng / μl. Using the checkerboard method, under the condition of 2 μl LF-polyU, fluorescence kinetics detection was performed on crRNA and Cas13a protein with different final concentrations in turn to explore their optimal working concentrations. The amount of LF-polyU and reaction time were explored using the optimized reaction system to obtain the best working conditions.

[0075] Example 6 Establishment of Two CRISPR-Cas13a Detection Methods

[0076] The first is the fluorescence kinetics detection of CRISPR-lwCas13a. When the RNA reporter labeled with FAM fluorophore at the 5' end and TAMRA quencher at the 3' end is cleaved by the activated CRISPR-Cas13a complex, it will be quenched and emit fluorescence. Therefore, the prepared reaction system is placed in a Bio-Rad CFX96 real-time fluorescence quantitative analyzer, and fluorescence is collected at 37°C for 2 hours, and the fluorescence value is read every 5 minutes, so as to achieve the purpose of fluorescence kinetics detection. The GraphPad Prism 8 software is used for statistics and the fluorescence intensity differences between samples in the final cycle are analyzed by t-test. Among them, ns represents: P>0.05, * represents: P<0.05, ** represents: P<0.01, *** represents: P<0.001, **** represents: P<0.0001.

[0077] The second is for the lateral flow chromatography strip detection reaction of CRISPR-lwCas13a. FAM is labeled at the 5' end of poly U, and biotin is labeled at the 3' end of poly U. This poly U is added as a reporter gene to the reaction system, and other components remain unchanged. After reacting at a constant temperature of 37°C for half an hour, 20 μL of the reaction product is transferred to a 2 ml nuclease-free EP tube and mixed well with 80 μL of HybriDetect 1 assay buffer. The diluted reaction solution is dropped onto the sample pad of the Milenia HybriDetect 1 test strip, and the color development is observed after 5 minutes. To preserve the best visual effect, the test strip is placed on a white background and photographed immediately. For negative samples, the anti-FAM antibody of the test strip is fully conjugated with FAM-RNA-biotin as the reporter gene, and the conjugate is intercepted by the biotin ligand at the Control (C) line. In the reaction of positive samples, Cas 13a cleaves the reporter gene, and the conjugate of gold particle-anti-FAM antibody-FAM accumulates at the Test (T) line and decreases at the C line.

[0078] The verification of the sensitivity and specificity of the PRA-CRISPR-Cas13a technology based on the lateral flow test strip is shown in Test Example 5.

[0079] Example 7 Clinical sample detection in combination with HUDSON

[0080] According to the prior art, clinical samples are treated by heating and chemical reduction methods to eliminate nucleases and lyse virus particles, and the treated samples can be directly used as templates for RPA reactions. To verify the application of the above two PRA-CRISPR-Cas 13a detection techniques in clinical samples, 20 known positive or negative samples from a pet hospital in Heilongjiang were processed by HUDSON. According to the guidance of the HUDSON method, TCEP and EDTA with final concentrations of 100 mM and 1 mM were added to 20 tissue homogenates. Incubate in a water bath at 42 °C for 20 minutes, and then incubate at 64 °C for 5 minutes to inactivate. Take 2 μL of the treated product and directly add it as a template to the reaction system for CRISPR–Cas13a lateral flow strip detection, and finally collect the results. At the same time, 20 clinical samples were detected by conventional PCR method, and the detection results were compared.

[0081] Experimental Example 1 Screening of RPA Primers and CRISPR RNAs

[0082] The best pre-amplification primers and corresponding crRNAs were screened by fluorescence kinetics detection and the visual effect of the color reaction of the lateral flow strip by pairing each pair of RPA primers with their respective crRNAs. The results combined Figure 1 and Figure 2 It can be seen that when primer F1 / R1 was paired with crRNA-1, F3 / R3 was paired with crRNA-3, and F4 / R4 was paired with crRNA-4, obvious fluorescence collection occurred and color bands appeared on the test line of the lateral flow detection strip, proving that the above pairs of primers and crRNAs were all effectively designed. Among them, the amplified fragment length of primer F3 / R3 was 253 bp, Tm = 65 °C), and when paired with crRNA-3, the fluorescence intensity collected was the highest and the color development effect was the best. This was used as the common primer and sequence for subsequent experiments (Table 3). And on the basis of this primer, a pair of primers without the T7 promoter sequence was designed for the construction of standard plasmids. This result also proved that the CRISPR-Cas13a lateral flow detection method can directly detect CAV-2 visually.

[0083] Table 3 Sequences of Primers, crRNAs and Reporter RNAs in This Experiment

[0084]

[0085] Experimental Example 2 Construction of Plasmid Standard

[0086] As Figure 3, a single band with a length of 254 bp was obtained. After the product was recovered and purified by gel extraction, it was cloned and sequenced, and the results were completely consistent with the expectations. The successfully constructed positive plasmid was named pMD-19T-RPAZL and stored at -80 °C for later use. The concentration of the plasmid standard was measured by spectrophotometer to be 479 ng / μL. According to the formula: copy number (copies / μL) = (6.02×10 23 × concentration × 10 -9 ) / (660 × number of bases), the copy number of pMD-19T-RPAZL was calculated to be 1.1×10 11 copies / μL.

[0087] Experimental Example 3 Construction of a fluorescence kinetics detection method based on CRISPR-Cas13a and optimization of the reaction system

[0088] An RPA experiment was carried out using the CAV-2 genomic RNA extracted from the MANHATTAN strain as a template. 2 μL of the amplification product was used as the input for the optimization experiment of the CRISPR-Cas13a fluorescence kinetics detection ([[]]END] Figure 4 A, B), and finally the optimal working concentrations of crRNA (2.5 ng / μL) and Cas13a protein (2 ng / μL) were determined. The optimized fluorescence kinetics detection reaction system: 2 μL of RPA product, 0.5 μL of T7 RNA polymerase mix, 1 μL of Rnase inhibitor murine, 0.8 μL of NTPbuffer mix, 2 μL of 10×PCR std buffer, 1 μL of Cas13a (50 μM), 1 μL of crRNA, 2 μL of probe-polyU (10 μM), 10.7 μL of DEPC water.

[0089] Experimental Example 4 Lateral flow strip detection combined with CRISPRCas13a

[0090] For lateral flow detection, biotin-labeled LF polyU (5’FAM / UUUUUUUUUUUUUUUU / Bio 3’) was added to the CRISPR-Cas13a reaction system as a reporter gene to replace probe-polyU, and was used to verify the collateral cleavage activity of the CRISPR-Cas13a protein complex. Four CAV-2 strains were selected as reference strains for verification. As Figure 5 shown, in the visual reading, obvious bands were observed at the T line for the four CAV-2 positive samples, while only bands appeared at the C line for the negative samples.

[0091] Experimental Example 5 Sensitivity and specificity of lateral flow strip detection

[0092] To verify the feasibility of lateral flow strip-based CRISPR-Cas13a detection, it is crucial to evaluate the sensitivity and specificity of this method. In the sensitivity test, the lowest copy number with no visible band along the T line was regarded as the detection limit. The results showed that the sensitivity was as low as 10 2 copies / μL.

[0093] In the specificity test, six viral genomes including CAV-2, CPIV, CDV, CHV, CHPV, and CCOV were used as templates for RPA-CRISPR lateral flow strip detection respectively. As Figure 6 shown in B, obvious positive bands were only observed on the test strip for detecting CAV-2. The test strips for other viruses were all judged negative. The results proved that the CAV-2 detection method combining RPA-CRISPR-Cas13a with lateral flow strip had good sensitivity and specificity.

[0094] Test Example 6 Detection of clinical samples by SHERLOCK

[0095] For 20 clinical samples (7 positive and 13 negative) known to be positive or negative collected from pet hospitals in Heilongjiang Province, 2 μL was taken directly from the processed samples for RPA reaction (without dilution or purification) and lateral flow strip detection, and the color reaction was observed. At the same time, our laboratory detected these 20 clinical samples by conventional PCR and SHERLOCK respectively. The results are as Figure 7 shown in A and B. Compared with the two detection methods, there was a difference in 1 sample by conventional PCR, and the coincidence rate reached 95%. All in all, these data fully demonstrated that the combination of SHERLOCK platform and HUDSON could be an effective method for in-situ clinical detection of CAV-2.

[0096] Table 4-7 Detection of 20 clinical samples by SHERLOCK combined with HUDSON and conventional PCR

[0097]

[0098] The above-described embodiments are only described as the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. An RPA primer for detecting canine adenovirus type 2, characterized in that: Include any of the following groups: Group 1: Sequence 1RPAF1: GAAATTAATACGACTCACTATAGGGCTTTTGCTWTGCCTGTACGTTCAGARCCC; Sequence 2RPAR1: CCCCAGGTTTGGCAGACACAAAAATAACTT; Group 3: Sequence 5RPAF3: GAAATTAATACGACTCACTATAGGGGGTTTTGTCTTTTACCTCCCCATTACATAA; Sequence 6RPAR3: TTAAGGGTGCCATTTTCATCTTCTAACCCA; Group 4: Sequence 7RPAF4: GAAATTAATACGACTCACTATAGGGAAACACTGTATCCCTAGCGCTAGGAGATGG; Sequence 8RPAR4: GAATTGTAGCGGGGGAGGGGGAGTAGGGAA.

2. The RPA primer for detecting canine adenovirus type 2 according to claim 1, characterized in that: For the third group: Sequence 5RPAF3: GAAATTAATACGACTCACTATAGGGGGTTTTGTCTTTTACCTCCCCATTACATAA; Sequence 6RPAR3: TTAAGGGTGCCATTTTCATCTTCTAACCCA.

3. A crRNA for detecting canine adenovirus type 2, characterized in that: Include any of the following groups: Group 1: Sequences of 9crRNAs for IVT-1 tempaltes: TTCGGCTGGAGCTGAGGAGGAAGATGATGTTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC; Group 3: Sequences of 11crRNAs IVT-3 tempaltes: TGAAAACACTGTATCCCTAGCGCTAGGAGTTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAA ATCCCCTATAGTGAGTCGTATTAATTTC; Group 4: Sequences of 12crRNAs IVT-4 tempaltes: TTAGAAGATGAANATGGCACCCTTAAAGGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAA ATCCCCTATAGTGAGTCGTATTAATTTC.

4. The crRNA for detecting canine adenovirus type 2 according to claim 3, characterized in that: For the third group: Sequences of 11crRNAs IVT-3 tempaltes: TGAAAACACTGTATCCCTAGCGCTAGGAGTTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAA ATCCCCTATAGTGAGTCGTATTAATTTC.

5. A reagent for detecting canine adenovirus type 2, characterized in that: The reagent includes the RPA primers as claimed in claim 1 or 2, and the crRNA as claimed in claim 3 or 4. Preferably, the first group of RPA primers is matched with the first group of crRNA, the third group of RPA primers is matched with the third group of crRNA, and the fourth group of RPA primers is matched with the fourth group of crRNA; further preferably, the third group of RPA primers is matched with the third group of crRNA.

6. The reagent for detecting canine adenovirus type 2 according to claim 5, characterized in that: It also includes Cas 13a protein, the concentration of the crRNA is 0.5-5ng / ul, and the concentration of the Cas 13a protein is 0.5-5ng / ul; preferably, the concentration of the crRNA is 2.5ng / ul, and the concentration of the Cas 13a protein is 2ng / ul.

7. The reagent for detecting canine adenovirus type 2 according to claim 5, comprising: RPA product: 1-3ul, T7RNA polymerase mix: 0.3-0.8ul, RNaseinhi bitor murine: 0.5-2ul, NTP buffermix: 0.5-1ul, 10×PCR stdbuffer: 1-3ul, Cas 13a (50μm): 1-2ul, crRNA: 1-2ul, probe-polyU (10μm) 1-2ul, DEPC water: 9-11ul, the preferred reaction reagent is the primer (10uM) as described in claim 1 or 2: 1-3ul and BufferA40-45ul and BufferB plus 2-3ul of the reaction mixture.

8. A kit for detecting canine adenovirus type 2, characterized in that: It comprises the RPA primer according to claim 1 or 2, the crRNA according to claim 3 or 4, or the reagent according to any one of claims 5 to 7.

9. A method for visual detection of canine adenovirus type 2 CRISPR-Cas 13a, characterized in that: The method comprises the step of performing a lateral flow chromatography test strip detection reaction of CRISPR-lwCas 13a using the RPA primer described in claim 1 or 2, the crRNA described in claim 3 or 4, or the reagent described in any one of claims 5 to 8; preferably, it also comprises the step of performing a HUDSON treatment on the sample to be tested.

10. Use of the primer according to claim 1 or 2, the crRNA according to claim 3 or 4, and the reagent according to any one of claims 5 to 8 in a product for detecting or diagnosing canine adenovirus type 2.

Images