Soybean cyst nematode gene Hg-tax-4 and application thereof in nematode control

Abstract

The invention discloses a soybean cyst nematode gene Hg-tax-4 and application thereof in nematode prevention and control, and relates to a soybean cyst nematode gene and application thereof. The method solves the problems that an existing chemical prevention and control method for soybean cyst nematode pollutes the environment, and resistance is extremely prone to losing in a disease-resistant variety combination and non-host rotation method. The nucleotide sequence of the soybean cyst nematode gene Hg-tax-4 is as shown in SEQ ID NO: 1 in a sequence table. The dsRNA of the soybean cyst nematode gene Hg-tax-4 is applied to prevention and treatment of nematodes. The gene Hg-tax-4 provided by the invention is derived from a cyclic nucleotide gated ion channel subunit of soybean cyst nematode, and the test result shows that the gene is expressed in a tail sensor of a second-stage larva. The soybean cyst nematode gene Hg-tax-4 participates in regulation and control of infection and reproduction of soybean cyst nematode on hosts, and can be used as a target gene for development of soybean cyst nematode prevention and control drugs.

Description

Technical Field

[0001] The present invention relates to a soybean cyst nematode gene and its application. Background Art

[0002] Soybean is an important crop for both food and oil. Soybean cyst nematode disease is one of the important soil-borne diseases caused by the root-settling soybean cyst nematode (SCN). Soybean cyst nematode disease occurs in soybean-producing areas in China, resulting in an annual economic loss of up to 600 million yuan. After SCN invades the roots, it is easy to cause the host root development to be retarded and the leaves to turn yellow, generally reducing production by 30-50%, and even causing a complete crop failure in severe cases. Due to the change of China's industrial structure, the planting area of soybeans has increased year by year, and this disease has become more and more serious. In addition, the wounds caused by soybean cyst nematode infection can induce secondary diseases, such as sudden death syndrome of soybean, Phytophthora sojae, soybean stem rot, etc.

[0003] Although the current chemical control of soybean cyst nematode disease is effective, it has great destructiveness to the environmental ecology and the safety of humans, livestock and poultry. The combination of disease-resistant varieties and non-host rotation is also an effective control strategy, but the resistance sources are single, there are multiple physiological races in the field and they are prone to variation, resulting in the easy loss of resistance. The limited arable land resources limit the rotation.

[0004] Based on the above problems, it is urgent to establish a new control strategy. At present, developing efficient, non-toxic and broad-spectrum new biogenic nematicides from the interaction mechanism between nematodes and plants is the top priority in nematology research. Mining and screening new genes of soybean cyst nematode, analyzing their functions in the infection and development process of soybean cyst nematode, and further developing new biogenic nematicides with them as targets have important theoretical guiding significance and practical application value for the green and sustainable control of soybean cyst nematode. Summary of the Invention

[0005] In order to solve the problems of environmental pollution in the existing chemical control methods of soybean cyst nematode and the easy loss of resistance in the rotation method, the present invention provides a soybean cyst nematode gene Hg-tax-4 and its application in nematode control.

[0006] The nucleotide sequence of the soybean cyst nematode gene Hg-tax-4 of the present invention is shown as SEQ ID NO: 1 in the sequence listing.

[0007] Furthermore, the amino acid sequence of the protein encoded by the soybean cyst nematode gene Hg-tax-4 is shown as SEQ ID NO: 2 in the sequence listing.

[0008] Further, the dsRNA sequence dsRNA-Hg-tax-4 of the soybean cyst nematode gene Hg-tax-4, and the nucleotide sequence of dsRNA-Hg-tax-4 is as shown in SEQ ID NO: 3.

[0009] Use of the dsRNA of the soybean cyst nematode gene Hg-tax-4 described above in controlling nematodes.

[0010] Further, the method for applying to control nematodes is: soaking the second-stage larvae of soybean cyst nematodes with a treatment solution containing dsRNA of the soybean cyst nematode gene Hg-tax-4, and incubating with shaking in the dark at room temperature.

[0011] Advantages of the present invention:

[0012] The gene Hg-tax-4 of the present invention is derived from the cyclic nucleotide-gated ion channel subunit of soybean cyst nematode, and the test results show that this gene is expressed in the amphid sensilla of the second-stage larvae.

[0013] For the base sequence of the gene Hg-tax-4, specific functional regions were screened to synthesize dsRNA. For the soybean cyst nematode gene Hg-tax-4, specific functional regions were screened to synthesize the double-stranded RNA fragment dsRNA-Hg-tax-4. By in vitro interfering with soybean cyst nematodes, it can significantly inhibit the expression of the soybean cyst nematode gene Hg-tax-4, and the number of second-stage larvae invading into the roots and the number of female worms 35 days after infection decreased by 37.2% and 27.37% respectively. It shows that this gene is involved in regulating the invasion of soybean cyst nematodes into hosts and their development process.

[0014] The soybean cyst nematode gene Hg-tax-4 of the present invention is involved in regulating the invasion and reproduction of soybean cyst nematodes to hosts, and can be used as a target gene for the development of drugs for controlling soybean cyst nematodes.

[0015] The present invention reports for the first time the cloning and functional analysis of the gene encoding cyclic nucleotide-gated ion channel in plant parasitic nematodes. The present invention has great application value for the research on the pathogenic mechanism of soybean cyst nematodes and nematode control. Description of the drawings

[0016] Figure 1 It is a partial fragment of RT-PCR cloning of the soybean cyst nematode gene Hg-tax-4 in Example 1;

[0017] Figure 2 It is the in situ hybridization localization of the gene Hg-tax-4 expressed in the amphid sensilla cells of the second-stage larvae of soybean cyst nematodes in Example 2;

[0018] Figure 3 It is the fluorescence micrograph of the second-stage larvae in treatment solution 1 group in Example 3;

[0019] Figure 4 For the effect of exogenous dsRNA treatment on the expression level of Hg-tax-4 in second-instar larvae in Example 3;

[0020] Figure 5 For the number of J2 in the roots of soybean roots 48 h after J2 of the second-instar larvae in the treatment group (dsRNA-Hg-tax-4) and the control group (dsRNA-GFP) in Example 3 invaded the soybean roots;

[0021] Figure 6 For the number of female adults on the root surface of soybean 35 days after inoculating J2 of the second-instar larvae in the treatment group (dsRNA-Hg-tax-4) and the control group (dsRNA-GFP) in Example 3. Detailed implementation manners

[0022] The following will combine the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention.

[0023] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other.

[0024] Detailed implementation manner one: The nucleotide sequence of the soybean cyst nematode gene Hg-tax-4 in this implementation manner is as shown in SEQ ID NO: 1 in the sequence listing.

[0025] Detailed implementation manner two: The amino acid sequence of the encoded protein of the soybean cyst nematode gene Hg-tax-4 in this implementation manner is as shown in SEQ ID NO: 2 in the sequence listing.

[0026] Detailed implementation manner three: The dsRNA sequence dsRNA-Hg-tax-4 of the soybean cyst nematode gene Hg-tax-4 in this implementation manner, and the nucleotide sequence of dsRNA-Hg-tax-4 is as shown in SEQ ID NO: 3.

[0027] Detailed implementation manner four: Application of the dsRNA of the soybean cyst nematode gene Hg-tax-4 described in detailed implementation manner one in controlling nematodes.

[0028] Detailed implementation manner five: Different from detailed implementation manner four in this implementation manner: The application method for controlling nematodes is: soaking the second-instar larvae of soybean cyst nematodes with a treatment solution containing dsRNA of the soybean cyst nematode gene Hg-tax-4, and incubating with shaking in the dark at room temperature.

[0029] Embodiment 6: The difference between this embodiment and Embodiment 4 is that: incubation is carried out with shaking in the dark at room temperature for 40 - 50 h. Others are the same as Embodiment 4.

[0030] Example 1 Cloning of the Cyclic Nucleotide-Gated Ion Channel Gene Hg-tax-4 of Soybean Cyst Nematode

[0031] 1. Collect freshly hatched second-stage larvae of soybean cyst nematode, put them into a biological freezing grinder, add an appropriate amount of liquid nitrogen and quickly grind. After grinding, transfer the nematode powder to a 1.5 mL centrifuge tube, add 1 mL of Trizol, shake and mix well to extract the total RNA of the nematode.

[0032] 2. Using the total RNA in Step 1 as a template, use One-Step gDNA Removal and cDNA Synthesis SuperMix kit to synthesize nematode cDNA, and store the synthesized cDNA in a -80 °C refrigerator for later use.

[0033] 3. Using the cDNA synthesized in Step 2 as a template, perform PCR amplification on the gene Hg-tax-4 with the upstream primer and the downstream primer.

[0034] The upstream primer and downstream primer of the gene Hg-tax-4 are as follows:

[0035] Hg-tax-4-F: 5’-TGGCACTTTGGCACATTGGGC-3’

[0036] Hg-tax-4-R: 5’-CCTGAAAAAGTCGGACTTTGCG-3’

[0037] Amplification reaction system: 2×Phanta Master Mix, 5 μL, cDNA template, 0.2 μL, upstream primer, 0.4 μL, downstream primer, 0.4 μL, RNase-free Water, 4 μL, total reaction system 10 μL.

[0038] Reaction conditions: Denaturation at 95 °C for 3 min, 95 °C, 15 s, 50 - 65 °C, 15 s, extension at 72 °C for 1 min, 35 cycles; extension at 72 °C for 5 min, store at 4 °C. The PCR product is separated and identified by 1% agarose gel electrophoresis, and the result is as Figure 1 shown ( Figure 1 is a partial fragment of the RT-PCR cloning of the soybean cyst nematode gene Hg-tax-4).

[0039] 4. Sequence the PCR amplification product in Step 3. The sequencing results show that the amplified product contains the gene fragment shown in SEQ ID NO: 1 in the sequence listing, and the coding sequence encodes the protein shown in SEQ ID NO: 2 in the sequence listing. The protein with the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing is named protein Hg-TAX-4, and the encoding gene is named Hg-tax-4.

[0040] Example 2 Tissue Localization Analysis of Gene Hg-tax-4

[0041] Perform gene tissue localization analysis on the second-stage larvae of soybean cyst nematode according to the method of DIG High Prime DNA Labeling and Detection Starter Kit Ι.

[0042] 1. Based on the Hg-tax-4 gene sequence cloned in Example 1, apply asymmetric PCR to synthesize digoxigenin (DIG)-labeled sense-strand probe and antisense-strand probe.

[0043] Use the gene fragment recovered in Step 1 of this example as a template to label DIG, and obtain a sense-strand probe and an antisense-strand probe with a length of 436 bp.

[0044] 2. Perform in situ hybridization.

[0045] The results of in situ hybridization are shown in Figure 2 ( Figure 2 For in situ hybridization to localize the expression of gene Hg-tax-4 in the amphidial cells of the second-stage larvae of soybean cyst nematode). As can be seen from Figure 2 the results, after treatment with the antisense-strand probe-labeled Hg-tax-4, chromogenic reactions occurred in the tissue cells of the nematode amphidial sensilla. The results show that Hg-tax-4 is mainly expressed in the amphidial sensilla tissue of the second-stage larvae of soybean cyst nematode, and the amphidial sensilla is an important organ for nematode allelopathic regulation.

[0046] Example 3 Verification of the Function of Hg-tax-4 by in vitro RNAi Interference Experiment

[0047] 1. Synthesis of dsRNA: According to the Hg-tax-4 gene fragment cloned in Example 1, design specific primers:

[0048] Hg-tax-4-si-T7F:

[0049] 5’-TAATACGACTCACTATAGGGAGTGGCACTTTGGCACATTGGGC-3’

[0050] Hg-tax-4-si-R:

[0051] 5’-CCTGAAAAAGTCGGACTTTGCG-3’

[0052] Hg-tax-4-si-F:

[0053] 5’-TGGCACTTTGGCACATTGGGC-3’

[0054] Hg-tax-4-si-T7R:

[0055] 5’-TAATACGACTCACTATAGGGAGCCTGAAAAAGTCGGACTTTGCG-3’

[0056] Introduce the T7 promoter sequence TAATACGACTCACTATAGGGAG at the 5'-end of the specific primer. Using the Hg-tax-4 gene fragment as a template, amplify the gene fragment template required for dsRNA synthesis by PCR, and after purification, use it for the next experiment.

[0057] 2. Synthesize dsRNA-Hg-tax-4 according to the MEGAscript TM RNAi Kit instruction manual

[0058] Reaction system: 1 μg of the recovered gene fragment template, 2 μL of 10×T7 reaction buffer, 2 μL of ATP, 2 μL of CTP, 2 μL of GTP, 2 μL of UTP, 2 μL of T7 Enzyme Mix, make up to 20 μL with nuclease-free water, incubate at 37°C in the dark for 4 h, and place at -20°C overnight. The product is identified by 1% agarose gel electrophoresis, the concentration of dsRNA-Hg-tax-4 is detected at a wavelength of 260 nm, and the synthesized dsRNA-Hg-tax-4 is stored at -80°C. The sequence of dsRNA-Hg-tax-4 is shown in SEQ ID NO: 3.

[0059] 3. Collect freshly hatched second-stage larvae of soybean cyst nematode, and wash them three times with 1 / 4 M9 buffer for later use.

[0060] 4. The in vitro RNAi interference of the second-stage larvae of soybean cyst nematode refers to the method in the article (Urwin PE, Lilley CJ, Atkinson HJ. Molecular Plant-Microbe Interactions, 2002, 15: 747-752.). Take 500 second-stage larvae collected in step 3 of this example and soak them in treatment solution 1, treatment solution 2, and treatment solution 3 respectively, 500 larvae / sample, and repeat each treatment three times. Incubate with shaking in the dark at room temperature for 48 h.

[0061] Treatment solution 1 contains 50 mM octopamine, 3 mM spermidine, 0.05% gelatin, 1.5 mg / mL dsRNA, and 0.1 mg / mL FITC.

[0062] Treatment solution 2 (control group) contains 50 mM octopamine, 3 mM spermidine, 0.05% gelatin, and 1.5 mg / mL dsRNA-GFP (sequence shown in SEQ ID NO: 4).

[0063] Treatment solution 3 (treatment group) contains 50 mM octopamine, 3 mM spermidine, 0.05% gelatin, and 1.5 mg / mL dsRNA-Hg-tax-4.

[0064] 5. Use a pipette to pick up several second-instar larvae in the treatment solution 1 group, and use a fluorescence microscope to detect whether green fluorescence is visible in the nematodes at a wavelength of 488 - 525 nm. Figure 3 is the fluorescence micrograph of the second-instar larvae in the treatment solution 1 group. From Figure 3 it can be seen that dsRNA was successfully ingested by the second-instar larvae, achieving silencing of the target gene Hg-tax-4 expression, and ultimately inhibiting the infectivity and fecundity of the nematodes.

[0065] 6. Extract the total RNA of soybean cyst nematodes soaked in treatment solution 2 and treatment solution 3 and reverse transcribe it into cDNA. Since nematodes do not contain the GFP gene sequence, under normal circumstances, dsRNA-GFP treatment (sequence shown in SEQ ID NO: 4) will not affect the expression level of the target gene Hg-tax-4, thereby proving the specificity of dsRNA-Hg-tax-4 for silencing Hg-tax-4. Using the dsRNA-GFP treatment group as a control, apply fluorescence quantitative PCR to detect the expression level of the gene Hg-tax-4 (using the actin gene as an internal reference). The results are as Figure 4 ( Figure 4 is the effect of exogenous dsRNA treatment on the expression level of Hg-tax-4 in second-instar larvae). After treatment with dsRNA-Hg-tax-4, the expression level of Hg-tax-4 in soybean cyst nematodes decreased significantly.

[0066] Primers for fluorescence quantitative PCR detection:

[0067] Hg-tax-4F: 5’-GCATCGGTCGGTCGGTAAAA-3’

[0068] Hg-tax-4R: 5’-CGCAGCGTCTCAAAATGCAC-3’

[0069] Hg-actin F: 5’-GCGTGGTTACTCCTTCGTG-3’

[0070] Hg-actin R: 5’-CGGGCAGTTCGTAGCTCTTC-3’

[0071] 250 second-instar larvae treated with treatment solution 2 and treatment solution 3 were inoculated onto soybean seedlings. After culturing in the dark for 24 h, the infection rate was detected by the fuchsin method. The above-ground parts of the soybeans were removed, and the soybean roots were rinsed clean with water and then soaked in a 1.5% sodium hypochlorite solution for 3 min. The soybean roots were taken out, and the sodium hypochlorite was thoroughly washed off with sterile water. The washed soybean roots were soaked in the fuchsin solution and heated until the solution boiled. After boiling for 30 s, it was left at room temperature until the fuchsin solution cooled to room temperature. One soybean root was taken, the surface fuchsin was washed with water, and then a slide was made. The number of nematodes invading the roots was counted under a stereomicroscope. Figure 5 The number of J2 in the roots 48 h after the second-instar larvae J2 of the treatment group (dsRNA-Hg-tax-4) and the control group (dsRNA-GFP) invaded the soybean roots; Figure 6 The number of female worms on the root surface 35 days after the second-instar larvae J2 of the treatment group (dsRNA-Hg-tax-4) and the control group (dsRNA-GFP) were inoculated onto soybeans. From Figure 5 and Figure 6 It can be seen that for the soybean cyst nematode gene Hg-tax-4 of the present invention, after treatment with the double-stranded RNA fragment dsRNA-Hg-tax-4, the expression of the gene Hg-tax-4 was significantly inhibited, and the number of second-instar larvae invading the roots and the number of female worms 35 days after infection decreased by 37.2% and 27.37% respectively. The results show that dsRNA can interfere with the expression of Hg-tax-4, and after the silencing of Hg-tax-4, it affects the infection and development of nematodes, and can be used as a target gene for nematicidal drugs for nematode control.

Claims

1. The soybean cyst nematode gene Hg-tax-4, characterized in that The nucleotide sequence of the soybean cyst nematode gene Hg-tax-4 is shown in SEQ ID NO:

1.

2. The protein encoded by the soybean cyst nematode gene Hg-tax-4 as described in claim 1, characterized in that The amino acid sequence of the protein encoded by the soybean cyst nematode gene Hg-tax-4 is shown in SEQ ID NO:

2.

3. The dsRNA of the soybean cyst nematode gene Hg-tax-4 as described in claim 1, characterized in that The dsRNA sequence dsRNA-Hg-tax-4 of the soybean cyst nematode gene Hg-tax-4, and the nucleotide sequence of dsRNA-Hg-tax-4 is shown in SEQ ID NO:

3.

4. Use of the dsRNA of the soybean cyst nematode gene Hg-tax-4 described in claim 3 in controlling nematodes.

5. Use of dsRNA of soybean cyst nematode gene Hg-tax-4 according to claim 4 in controlling nematodes, characterized in that, The method for using in controlling nematodes is: soaking the second-stage larvae of soybean cyst nematodes with a treatment solution containing dsRNA of the soybean cyst nematode gene Hg-tax-4, and incubating with shaking in the dark at room temperature.

6. Use of dsRNA of soybean cyst nematode gene Hg-tax-4 according to claim 5 in controlling nematodes, characterized in that, The incubation time with shaking in the dark at room temperature is 40 - 50 h.

Images