Method for detecting exfoliation of membrane protein based on two-color co-localization

Abstract

The invention relates to the technical field of biological detection, in particular to a method for detecting exfoliation of a membrane protein based on double-color co-localization, which comprises the following steps: firstly, providing a double-labeled probe which is a fusion protein and comprises a first detectable label, a transmembrane protein or a transmembrane fragment thereof and a second detectable label which are connected in sequence; the first detectable label and the second detectable label are different. According to the present invention, the double-labeled probe is expressed by the host cell, and the first detectable label and the second detectable label are detected in real time, such that the exfoliation ratio and the exfoliation time of the membrane protein can be analyzed in situ, and the method has excellent detection sensitivity and time resolution.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technologies, and particularly to a method for detecting membrane protein shedding based on dual-color colocalization. Background Art

[0002] As the boundary between the intracellular and extracellular spaces of a cell, the cell membrane is extremely important for the interaction and mutual action between the cell and the environment. At the same time, as a two-dimensional confined plane, the cell membrane greatly increases the local concentration of various reactants relative to the three-dimensional space of the cytoplasm, improving the efficiency of biological reactions. A variety of biochemical reactions occur on the membrane, and cell membrane proteins are the main undertakers of these biochemical reactions.

[0003] The extracellular domain shedding of cell membrane proteins is that, under the action of specific shedding enzymes, the extracellular domain of membrane proteins is cleaved and shed, which is a very important post-translational modification of membrane proteins. The extracellular domain shedding of membrane proteins regulates the enzymatic activity, signal transduction, cell adhesion and migration of membrane proteins. For example, the excessive shedding of amyloid precursor protein can lead to Alzheimer's disease. Therefore, it is of great significance to understand in detail the degree of protein extracellular domain shedding.

[0004] Currently, the common method for studying protein extracellular domain shedding is to detect the extracellular fragments of shed membrane proteins in the culture medium, and characterize the change in the degree of protein extracellular domain shedding by immunoblotting or enzyme activity detection. However, this method requires a large amount of samples or a long culture time to concentrate a sufficient amount of membrane proteins. The cumbersome concentration detection steps and low sample concentration pose challenges to the accuracy of detection. Moreover, this method cannot quantitatively study the shedding ratio of membrane proteins in situ and in real time. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for detecting membrane protein shedding based on dual-color colocalization, which can analyze the shedding ratio and shedding time of membrane proteins in situ, and has excellent detection sensitivity and time resolution.

[0006] To this end, in a first aspect, the present invention provides a dual-labeled probe, which is a fusion protein and includes a first detectable label, a transmembrane protein or a transmembrane region fragment thereof, and a second detectable label connected in sequence; the first detectable label and the second detectable label are different.

[0007] In some embodiments, the first detectable label and the second detectable label are each independently selected from the following group: self-labeling labels, fluorescent reporter labels, antibody labels.

[0008] In some embodiments, the self-labeling tag includes at least one of the following: SNAP-tag, Halo-tag, CLIP-tag, Spy-tag, Sortase-tag, FIAsH-tag.

[0009] In some embodiments, the fluorescent reporter tag is selected from fluorescent dyes, fluorescent proteins, or fragments thereof.

[0010] In some embodiments, the fluorescent protein includes at least one of the following: GFP (green fluorescent protein), eGFP (enhanced green fluorescent protein), mGFP (membrane bound form of eGFP), sfGFP (superfolder green fluorescent protein), mNeonGreen, StayGold, mStayGold, tdStayGold, EYFP (enhanced yellow fluorescent protein), ECFP (enhanced cyan fluorescent protein), EBFP2 (enhanced blue fluorescent protein 2), tdTomato, MRFP (monomer red fluorescent protein), mRb3, mScarlet, DsRed, mCherry, Ypet, mKO, mkate, iRFP.

[0011] In some embodiments, the fluorescent dye includes at least one of the following: FITC, TRITC, AMCA, Cy3, Cy5.

[0012] In some embodiments, the first detectable tag and the second detectable tag are tdStayGold and Halo-tag, respectively.

[0013] In some embodiments, there is also a first linker peptide between the first detectable tag and the transmembrane protein or its transmembrane domain fragment; and / or,

[0014] There is also a second linker peptide between the transmembrane protein or its transmembrane domain fragment and the second detectable tag.

[0015] In some embodiments, the first linker peptide and the second linker peptide are each independently selected from flexible linker peptides or rigid linker peptides.

[0016] In a second aspect of the present invention, there is provided a nucleic acid molecule comprising a nucleotide sequence encoding the dual-labeled probe.

[0017] In some embodiments, the nucleic acid molecule further comprises a nucleotide sequence encoding a signal peptide, and the nucleotide sequence encoding the signal peptide and the nucleotide sequence encoding the dual-labeled probe are located within the same open reading frame (ORF); the signal peptide can direct the protein expressed from the nucleic acid molecule to be anchored to the cell membrane.

[0018] In some embodiments, the signal peptide comprises at least one of the following groups: IgK signal peptide, BM40 signal peptide, OSM signal peptide.

[0019] In a third aspect of the present invention, there is provided a host cell comprising the nucleic acid molecule according to the second aspect of the present application.

[0020] In some embodiments, the host cell is a mammalian cell.

[0021] In a fourth aspect of the present invention, there is provided a method for detecting transmembrane protein shedding, which comprises expressing the dual-labeled probe in the host cell according to the third aspect of the present application, and analyzing the shedding of the transmembrane protein by detecting the first detectable label and the second detectable label.

[0022] In some embodiments, the first detectable label and the second detectable label are detected at the single-molecule level.

[0023] In some embodiments, the host cell is imaged by total internal reflection fluorescence microscopy (TIRFM), so as to detect the first detectable label and the second detectable label at the single-molecule level.

[0024] In some embodiments, the following steps are further included between detecting the first detectable label and the second detectable label: fixing the host cell on a transparent carrier (such as a glass slide). It should be understood that those skilled in the art can choose whether to fix the host cell on a transparent carrier according to actual needs. In some embodiments, it is not necessary to fix the host cell on a transparent carrier, but the detection can be carried out by means of in-situ real-time tracking of living cells.

[0025] In some embodiments, the first detectable label releases a first fluorescence signal, and the second detectable label releases a second fluorescence signal; the host cell is imaged in multiple channels (such as dual channels), the multiple channels include channels for the first fluorescence signal and the second fluorescence signal, and a multi-channel image is obtained; the shedding of the transmembrane protein is obtained by analyzing the multi-channel image.

[0026] In some embodiments, the method for analyzing the multi-channel image includes: constructing trajectories for the multi-channel image (for example, constructing trajectories for the multi-channel image through uTrack software) to obtain single-molecule trajectories; analyzing the distance between any two points between the first fluorescence signal channel and the second fluorescence signal channel, and determining that they are co-localized if the distance is less than a threshold (for example, 200 nm), thereby obtaining the number of co-localized points between the first fluorescence signal channel and the second fluorescence signal channel;

[0027] Calculating the co-localization coefficient of the first fluorescence signal, that is, the number of co-localized points divided by the number of points of the first fluorescence signal; calculating the co-localization coefficient of the second fluorescence signal, that is, the number of co-localized points divided by the number of points of the second fluorescence signal;

[0028] Analyzing the change of the co-localization coefficient of the first fluorescence signal and / or the localization coefficient of the second fluorescence signal over time, thereby analyzing the shedding situation of the transmembrane protein.

[0029] In some embodiments, the first detectable tag is fused to the N-terminus of the transmembrane protein, and the second detectable tag is fused to the C-terminus of the transmembrane protein; when the N-terminus of the transmembrane protein is outside the cell, the shedding situation of the transmembrane protein can be analyzed by analyzing the co-localization coefficient of the first fluorescence signal. When the co-localization coefficient of the first fluorescence signal decreases over time, it indicates that the transmembrane protein has shed during this time period. Similarly, when the C-terminus of the transmembrane protein is outside the cell, the shedding situation of the transmembrane protein can be analyzed by analyzing the co-localization coefficient of the second fluorescence. When the co-localization coefficient of the second fluorescence signal decreases over time, it indicates that the transmembrane protein has shed during this time period.

[0030] Compared with the prior art, the technical solution of the present invention has at least the following advantages:

[0031] The present invention provides a dual-label probe, which fuses different detectable tags at both ends of the transmembrane protein, so that during the shedding process of the transmembrane protein, the high signal-to-noise imaging of TIRFM can be used, combined with two-color co-localization, and the shedding ratio and occurrence of shedding events of the membrane protein can be analyzed through a two-color tracking analysis method. Through the above method, it is possible to avoid the masking of heterogeneous behaviors by traditional ensemble methods, achieve in-situ real-time detection, have higher detection sensitivity and time resolution, and be applicable to a variety of detectable tags. It is more accurate, convenient, and easy to expand. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] By reading the following detailed description of the preferred embodiments, various other advantages and benefits will become clear to those of ordinary skill in the art. The drawings are only for the purpose of illustrating the preferred embodiments and are not considered to be a limitation of the present invention. In the drawings:

[0033] Figure 1 : Schematic diagram of the dual-labeled probe in Example 1;

[0034] Among them, (a) is a schematic diagram of the nucleotide sequence encoding the dual-labeled probe; (b) is a schematic diagram of the cleavage of the dual-labeled probe;

[0035] Figure 2 : By applying the dual-labeled probe in Example 1, the shedding of membrane proteins was detected and analyzed;

[0036] Among them, (a) is the trajectory of two-color colocalization. The green represents the trajectory of tdStayGold, the pink represents the trajectory of Halo-JFX650, and the blue represents the trajectory of their colocalization; (b) is an example of the trajectory of shedding. The red represents the colocalized trajectory present in both channels before shedding, and the green represents the trajectory of tdStayGold remaining after extracellular dropping; (c) is the change in the diffusion coefficient of the trajectory before and after shedding. bD represents the diffusion coefficient before shedding, and aD represents the diffusion coefficient after shedding. It can be seen that the diffusion coefficient of most trajectories becomes faster after shedding; (d) is a dual-channel image of the shedding trajectory for a single cell. The first row is the image of the green channel, and the second row is the image of the red channel. Each horizontal image represents a time point. It can be seen that shedding occurs between frames 52 - 53 indicated by the red box, and the fluorescence in the red channel disappears;

[0037] Figure 3 : In-situ tracking of the shedding process of the dual-labeled probe when stimulated by exogenous TEV protease;

[0038] Among them, (a) shows that the colocalization coefficient of Halo-JFX650 does not change significantly before and after TEV protease stimulation. This colocalization coefficient is calculated by dividing the number of colocalized points by the number of Halo-JFX650 points; (b) shows that the colocalization coefficient of tdStayGold decreases significantly 10 minutes after TEV protease stimulation. The colocalization coefficient is obtained by dividing the number of colocalized points by the number of tdStayGold points, indicating that extracellular Halo-JFX650 has shed. Detailed implementation manners

[0039] The exemplary embodiments of the present disclosure will be described in more detail below with reference to the accompanying drawings. Although the exemplary embodiments of the present disclosure are shown in the drawings, it should be understood that the present disclosure can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided to enable a more thorough understanding of the present disclosure and to fully convey the scope of the present disclosure to those skilled in the art.

[0040] Term

[0041] As used herein, a "fusion protein" is a protein formed by linking two or more different proteins or their fragments together through techniques such as genetic engineering. These linked proteins or their fragments usually have certain biological activities and retain their original functions in the fusion protein. In some embodiments, proteins or their fragments including a first detectable tag, a transmembrane protein or a fragment of its transmembrane region, and a second detectable tag are fused. The transmembrane protein in the fusion protein still retains its original structure and function, and its transmembrane localization, shedding, and other behaviors are still retained, so that the shedding of the transmembrane protein can be analyzed based on the fusion protein.

[0042] As used herein, in a "dual-label probe", the first detectable tag and the second detectable tag are different, so as to achieve the function of dual labeling. When a transmembrane protein is shed, by detecting the detectable tag linked to its shed part, the specific situation of shedding can be characterized, such as whether shedding occurs, the trajectory of shedding, the proportion of shedding, etc.

[0043] As used herein, a "self-labeling tag" or "self-labeling protein (SLP)" can covalently bind to a specific labeling molecule (such as a fluorescent dye, a capture tag, etc.), thereby releasing a detectable signal to achieve the labeling and tracking of proteins. In some embodiments, the first detectable tag or the second detectable tag can be Halo-tag. By providing a fluorescent ligand (such as JFX650) to the system, Halo-tag covalently binds to the fluorescent ligand, thereby releasing a fluorescent signal, and has the advantages of high fluorescence brightness, resistance to bleaching, and suitability for long-time time-lapse imaging.

[0044] As used herein, a "fluorescent reporter tag" refers to a tag that is excited by light or emits fluorescence itself, which can be a fluorescent dye or a fluorescent protein. By providing the corresponding excitation light, the fluorescent protein can release a detectable fluorescent signal. In some embodiments, the first detectable tag or the second detectable tag can be tdStayGold.

[0045] As used herein, a "transmembrane protein" refers to a protein that is partially or fully embedded in the cell membrane and can span the cell membrane one or more times. Those skilled in the art can select a transmembrane protein of interest and prepare a dual-label probe containing the transmembrane protein, so that the shedding situation can be analyzed according to the method provided by the present invention.

[0046] As used herein, a "linker peptide" refers to a short peptide that plays a connecting role. The length of the linker peptide is usually 1-20 amino acids. Generally, the linker peptide does not affect the normal folding and spatial conformation of the protein. In some embodiments, a flexible linker peptide can be used, such as (G m St G w )n, (G n S) m , (G) n , (EA3K) n or (XP) n etc., where n, m, t, and w are each independently selected from integers of 0 to 5. In some embodiments, the linker peptide is (G3S)3.

[0047] As used herein, a "signal peptide" is a polypeptide that can direct a newly synthesized protein within a cell to the cell membrane. During protein maturation, the signal peptide is usually excised by an enzyme and thus not retained in the mature protein. In some embodiments, a nucleic acid sequence for constructing a dual-labeled probe with a signal peptide at the N-terminus is used, and the signal peptide is excised during protein maturation, so that the dual-labeled probe does not contain a signal peptide. In mammalian expression systems, commonly used signal peptides include: the signal peptide of mouse Ig heavy chain, the signal peptide of mouse Ig kappa light chain (IgK signal peptide), BM40 signal peptide, OSM signal peptide, etc.

[0048] As used herein, an "open reading frame" refers to a continuous nucleotide sequence that starts from a start codon and ends at a stop codon and encodes a continuous polypeptide or protein.

[0049] Embodiments of the present invention will be listed below, and the advantages and various effects of the present invention will be presented more clearly therefrom. Those skilled in the art should understand that these embodiments are for illustrating the present invention and not for limiting the present invention.

[0050] Example 1

[0051] This example provides a dual-labeled probe. Referring to Figure 1 (a), first, a dual-labeled probe is designed, which consists of a signal peptide, a Holo-tag, a TEV protease cleavage site, a first linker peptide, a transmembrane domain, a second linker peptide, and tdStayGold in sequence. Among them, the signal peptide is the leader sequence of mouse immunoglobulin κ light chain (Igk-leader), which can direct the translated protein to be embedded in the cell membrane. Once the protein is inserted into the endoplasmic reticulum membrane, the signal peptide will be excised by signal peptidase. After complete expression and folding, the dual-labeled probe can be anchored to the cell membrane. Referring to Figure 1 (b), the TEV protease cleavage site is set to simulate the shedding of transmembrane proteins. By adding TEV protease to the system, the TEV protease cleavage site can be cleaved, so that the extracellular part is shed (this process is similar to the shedding of transmembrane proteins), and the shedding situation is detected and analyzed during this process.

[0052] The specific preparation method is as follows:

[0053] Provide the nucleic acid sequence SEQ ID NO: 1 (hereinafter referred to as the target sequence) for encoding a double-labeled probe, and SEQ ID NO: 1 is composed of the following sequences connected in sequence.

[0054] SEQ ID NO: 2 (signal peptide):

[0055] ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCC AGGTTCCACTGGTGAC

[0056] SEQ ID NO: 3 (Halo-tag):

[0057] GCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGTCCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGACCCATCGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAACCAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAGCCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGCGAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCAGAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCGCTGACTGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATCCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCGCCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTGGCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCACCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTGGCTGTCGACGCTCGAGATTTCCGGC

[0058] SEQ ID NO: 4 (TEV cleavage site):

[0059] GAGGATCTGTACTTTCAGAGC

[0060] SEQ ID NO: 5 (First Linker Peptide):

[0061] GGTGGAGGAGGTTCTGGGGGAGGGGGGTCGGGGGGAGGGGGGTCGSEQ ID NO: 6 (Transmembrane Domain):

[0062] GCTGTGGGCCAGGACACGCAGGAGGTCATCGTGGTGCCACACTCCTTGCCCTTTAAGGTGGTGGTGATCTCAGCCATCCTGGCCCTGGTGGTGCTCACCATCATCTCCCTTATCATCCTCATCATGCTTTGGCAGAAGAAGCCACGT

[0063] SEQ ID NO: 7 (Second Linker Peptide):

[0064] GGCGGCGGAGGGAGTGGAGGAGGGGGAAGCGGAGGCGGAGGGAGT TCC

[0065] SEQ ID NO: 8 (tdStayGold):

[0066] GCTTCTACAGGCGAGGAGCTGTTTACCGGCGTGGTGCCCTTCAAGTTCCAGCTGAAGGGCACCATCAACGGCAAGAGCTTCACCGTGGAAGGCGAGGGCGAGGGCAATAGCCACGAGGGCAGCCACAAAGGCAAGTACGTGTGCACCAGCGGCAAACTGCCAATGTCTTGGGCCGCCCTGGGAACTAGCTTCGGCTATGGCATGAAGTACTACACCAAGTACCCCAGCGGCCTGAAGAACTGGTTCCACGAGGTGATGCCCGAGGGCTTCACCTACGACAGACACATCCAGTACAAGGGCGACGGCAGCATCCACGCCAAGCACCAGCACTTCATGAAGAACGGCACCTACCACAACATCGTGGAGTTCACCGGCCAGGACTTCAAGGAGAACAGCCCCGTGCTGACCGGCGACATGAACGTGAGCCTGCCCAACGAGGTGCAGCACATCCCCAGAGATGACGGCGTGGAGTGCCCAGTGACCCTGCTGTACCCTCTGCTGAGCGACAAGAGCAAGTGCGTGGAGGCCCACCAGAACACCATCTGCAAGCCCCTGCACAATCAGCCAGCCCCCGATGTGCCATACCACTGGATCAGAAAGCAGTACACCCAGAGCAAGGACGACACCGAGGAGAGAGACCACATCTGCCAGAGCGAGACCCTGGAGGCCCACCTGGGCAATCCATGGCACGAGCCTTCTGCTTCTGCCGTG

[0067] The above fragments were amplified separately by PCR, and the target sequence was cloned into the mammalian expression vector pEGFP-C1 using molecular cloning, and then transferred into Escherichia coli. After verification, it was correct, cultured, and the recombinant expression plasmid was extracted.

[0068] Example 2

[0069] In this example, the dual-labeled probe in Example 1 was expressed in cells, and the shedding of transmembrane proteins was detected and analyzed. The specific steps are as follows:

[0070] I. Preparation of glass slides and cells

[0071] Place a circular glass slide with a diameter of 25 mm and a thickness of 0.17 mm into a beaker containing 5 mol / L sodium hydroxide aqueous solution. Then place the beaker into an ultrasonic cleaner and ultrasonically clean the glass slide at 70% power for 1 h to eliminate non-specific adsorption sites on the glass slide. After cleaning, rinse the glass slide with deionized water multiple times, and then dry the glass slide in an oven at 60 °C. Then place the glass slide into a 6-well plate in a biosafety cabinet. Wash it 3 times with sterile DPBS to remove the residual sodium hydroxide.

[0072] Digest SUM159 cells and seed them into the 6-well plate containing the glass slide at a ratio of 1:200. Place the 6-well plate in a cell culture incubator and wait for 16 - 24 h for the cells to adhere to the wall.

[0073] II. Cell Transfection

[0074] Use a transfection reagent to first incubate with the recombinant expression plasmid prepared in Example 1 to form liposomes, and then incubate the liposomes with the cells for 6 h to transfer the plasmid into the cells. After 6 h, replace the medium with fresh medium.

[0075] III. Staining

[0076] Continue culturing for 6 h, then replace it with a medium containing 100 nM Halo-JFX650 (Promega HT1070) and incubate at 37 °C for 5 min for staining. Then replace it with pre-warmed fresh medium for incubation to wash away the excess dye, and repeat the incubation 3 times in total, with each incubation for 5 min; after an interval of 30 min, repeat the incubation 3 times again, with each time for 5 min. That is, a glass slide carrying cells is prepared and used for the subsequent steps.

[0077] IV. Single-Molecule Imaging

[0078] First, perform multi-color imaging with four-color labeled fluorescent microspheres (TetraSpeck TM Microspheres, 0.1 μm, blue / green / orange / deep red fluorescence, Thermofisher T7279), and the data is used for subsequent dual-channel aberration correction.

[0079] Place the glass slide with cells on a dedicated adapter and then perform two-color single-molecule imaging on a total internal reflection fluorescence microscope (TIRFM). To track the single-molecule shedding process: Select cells with moderate expression density. After selecting all positions, stimulate with 50 U / ml of TEV protease. Alternately irradiate with 488 nm and 637 nm lasers, collect two-channel fluorescence, with an exposure time of 50 ms, and continuously collect 800 images for each cell for subsequent analysis of bleaching characteristics. To analyze the change in the co-localization ratio after a certain event stimulated by protease: Select cells with moderate expression density. After selecting all cells, alternately irradiate with 488 nm and 637 nm lasers, collect two-channel fluorescence, with an exposure time of 50 ms, and continuously collect 20 images for each cell to analyze the shedding ratio before adding TEV protease. Then add 50 U / ml of TEV protease and stimulate for 10 min. Then alternately irradiate with 488 nm and 637 nm lasers at each position again, collect two-channel fluorescence, with an exposure time of 50 ms, and continuously collect 20 images for each cell to analyze the co-localization ratio after 10 min of stimulation with TEV protease.

[0080] V. Data Analysis

[0081] Draw the cell region for the images obtained by imaging, perform single-molecule recognition using uTrack software, and construct trajectories to obtain two-channel single-molecule trajectories. Analyze the aberration between the two channels using the fluorescence bead image labeled with four colors, and then calibrate the channels. Then, by analyzing the distance between any points between the two channels, a distance less than 200 nm is considered co-localization, and the situation of co-localized points between the two channels is obtained. To exclude random co-localization, a continuous co-localization frame number of more than 5 frames between the two-channel trajectories is considered a co-localized trajectory. Then, determine whether shedding behavior occurs based on the change in the fluorescence intensity of the extracellular red channel.

[0082] See Figure 3 , through co-localization analysis, it was found that after 10 min of stimulation with TEV protease, the co-localization ratio of the extracellular Halo tag did not change significantly, while the co-localization ratio of the intracellular tdStayGold decreased significantly, indicating that a large amount of extracellular fragments were shed. At the same time, two-color tracking was performed, and the trajectories of shedding were tracked. After shedding, the fluorescence of the Halo-JFX650 channel disappeared, and the remaining tdStayGold diffused faster.

[0083] As described above, it is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention should be covered by the protection scope of the present invention. Therefore, the protection scope of the present invention should be subject to the protection scope of the claims.

Claims

1. A dual-labeled probe, characterized in that, The dual-label probe is a fusion protein, which includes a first detectable tag, a transmembrane protein or a fragment of its transmembrane region, and a second detectable tag connected in sequence; the first detectable tag and the second detectable tag are different from each other.

2. The dual-labeled probe according to claim 1, wherein The first detectable tag and the second detectable tag are each independently selected from the following group: self-labeling tag, fluorescent reporter tag, antibody tag; Preferably, the self-labeling tag includes at least one of the following group: SNAP-tag, Halo-tag, CLIP-tag, Spy-tag, Sortase-tag, FIAsH-tag; Preferably, the fluorescent reporter tag is selected from fluorescent dyes, fluorescent proteins or fragments thereof; Preferably, the fluorescent protein includes at least one of the following group: GFP, eGFP, mGFP, sfGFP, mNeonGreen, StayGold, mStayGold, tdStayGold, EYFP, ECFP, EBFP2, tdTomato, MRFP, mRb3, mScarlet, DsRed, mCherry, Ypet, mKO, mkate, iRFP; Preferably, the fluorescent dye includes at least one of the following group: FITC, TRITC, AMCA, Cy3, Cy5.

3. The dual-labeled probe according to claim 1, wherein There is also a first linker peptide between the first detectable tag and the transmembrane protein or the fragment of its transmembrane region; and / or, There is also a second linker peptide between the transmembrane protein or the fragment of its transmembrane region and the second detectable tag; Preferably, the first linker peptide and the second linker peptide are each independently selected from flexible linker peptides or rigid linker peptides.

4. A nucleic acid molecule, characterized in that, The nucleic acid molecule includes a nucleotide sequence encoding the dual-label probe according to any one of claims 1 to 3.

5. The nucleic acid molecule according to claim 4, wherein The nucleic acid molecule further includes a nucleotide sequence encoding a signal peptide, and the nucleotide sequence encoding the signal peptide and the nucleotide sequence encoding the dual-label probe are located in the same open reading frame; the signal peptide can direct the protein obtained by expressing the nucleic acid molecule to be anchored to the cell membrane; Preferably, the signal peptide includes at least one of the following group: IgK signal peptide, BM40 signal peptide, OSM signal peptide.

6. A host cell, characterized in that, Includes the nucleic acid molecule according to claim 4 or 5; Preferably, the host cell is a mammalian cell.

7. A method for detecting transmembrane protein shedding, characterized in that, Includes expressing the dual-label probe according to any one of claims 1 to 3 in the host cell according to claim 6, and analyzing the shedding condition of the transmembrane protein by detecting the first detectable tag and the second detectable tag.

8. The method for detecting transmembrane protein shedding according to claim 7, wherein Detecting the first detectable tag and the second detectable tag at the single-molecule level; Preferably, imaging the host cell by total internal reflection fluorescence microscopy, so as to detect the first detectable tag and the second detectable tag at the single-molecule level; Preferably, the following step is also included between detecting the first detectable tag and the second detectable tag: fixing the host cell on a transparent carrier.

9. The method for detecting transmembrane protein shedding according to claim 8, wherein The first detectable tag releases a first fluorescence signal, and the second detectable tag releases a second fluorescence signal; multi-channel imaging is performed on the host cell, and the multi-channels include a channel for the first fluorescence signal and a channel for the second fluorescence signal to obtain a multi-channel image; by analyzing the multi-channel image, the shedding condition of the transmembrane protein is obtained.

10. The method for detecting transmembrane protein shedding according to claim 9, wherein The method for analyzing the multi-channel image includes: constructing a trajectory for the multi-channel image to obtain a single-molecule trajectory; analyzing the distance between any two points between the first fluorescence signal channel and the second fluorescence signal channel, and determining that it is co-localized if the distance is less than a threshold, so as to obtain the number of co-localized points between the first fluorescence signal channel and the second fluorescence signal channel; Calculating the co-localization coefficient of the first fluorescence signal, that is, the number of co-localized points divided by the number of points of the first fluorescence signal; calculating the co-localization coefficient of the second fluorescence signal, that is, the number of co-localized points divided by the number of points of the second fluorescence signal; Analyzing the change of the co-localization coefficient of the first fluorescence signal and / or the localization coefficient of the second fluorescence signal over time, so as to analyze and obtain the shedding condition of the transmembrane protein.

Images