Method for detecting lung cancer using lung cancer-specific methylation marker gene

Abstract

The present invention relates to a novel use of a pairing related homologous frame 1 (PRRX1) gene and / or an ATP-binding cassette subfamily C member 9 (ABCC9) gene as one or more lung cancer specific methylation markers, and more particularly, to the use of the gene as a marker for one or more lung cancer specific methylation markers. The present invention relates to a composition for diagnosing lung cancer by detecting methylation using a PRRX1 or ABCC9 gene as a biomarker, a kit comprising the same, and a method for providing lung cancer diagnosis information.

Description

Technical Field

[0001] The present invention relates to a novel use of the PRRX1 (paired related homeobox 1) and / or ABCC9 (ATP-binding cassette subfamily C member 9) genes as lung cancer-specific methylation markers, and more particularly, to a composition for diagnosing lung cancer by detecting methylation using the PRRX1 or ABCC9 gene as a biomarker, a kit including the composition, and a method for providing lung cancer diagnosis information. Background Art

[0002] In addition to A, C, G, and T, the genomic DNA of mammalian cells also contains a fifth base, 5-methylcytosine (5-mC), which has a methyl group attached to the fifth carbon of the cytosine ring. 5-mC is always attached to the C of a CG dinucleotide (5'-mCG-3'), and this CG is commonly referred to as CpG. Most of the C of CpG is methylated by having a methyl group attached thereto. Methylation of CpG suppresses the expression of repetitive sequences in the genome, such as Alu or transposons, and CpG is the site where epigenetic changes most frequently occur in mammalian cells. The 5-mC of CpG is naturally converted to T by deamination, and thus, CpG in the mammalian genome appears only at a frequency of 1%, far lower than the normal frequency (1 / 4 x 1 / 4 = 6.25%).

[0003] There are regions where CpG is abnormally dense, called CpG sites (CpG islands). The length of a CpG site is 0.2 to 3 kb, and it is a highly concentrated region where the distribution percentage of C and G bases is greater than 50%, and the distribution percentage of CpG is 3.75% or higher. Approximately 45,000 CpG sites appear in the entire human genome and are concentrated in the promoter regions that regulate gene expression. In fact, CpG sites appear in the promoters of housekeeping genes, which account for about half of human genes (Cross, S. et al., Curr. Opin. Gene Develop., 5:309, 1995). It is known that abnormal DNA methylation mainly occurs in the 5' regulatory region of related genes, thereby reducing their expression.

[0004] Meanwhile, in the somatic cells of normal humans, the CpG islands in the promoter regions of housekeeping genes are not methylated, but the imprinted genes and inactivated genes on the X chromosome are methylated, thereby preventing their expression during development.

[0005] During tumorigenesis, methylation occurs in the promoter CpG islands, and the expression of the corresponding genes is impaired. In particular, when methylation occurs in the CpG islands of the regulatory regions of tumor suppressor genes, the expression and function of these genes are blocked, just like mutations in the coding sequences, leading to the promotive development and progression of cancer, where the tumor suppressor genes regulate the cell cycle or apoptosis, repair DNA, participate in cell adhesion and cell - cell interaction, and inhibit invasion and metastasis. In addition, with aging, partial methylation may occur on CpG islands.

[0006] Methylation of the regulatory regions of tumor - related genes is an important indicator of cancer and can thus be used in various ways, such as for cancer diagnosis and early diagnosis, predicting carcinogenic risk, predicting cancer prognosis, follow - up after treatment, predicting response to anticancer treatment, etc. Recently, there have been active attempts to study the promoter methylation of tumor - related genes in blood, sputum, saliva, feces, urine, etc. and use the results for treating various types of cancer (Ahlquist, D.A. et al., Gastroenterol., 119:1219, 2000).

[0007] Against this technical background, the inventors of the present application have made great efforts to develop effective lung - cancer - specific methylation markers capable of early diagnosis, predicting carcinogenic risk or cancer prognosis, etc. As a result, it was determined that the PRRX1 or ABCC9 gene is lung - cancer - specific, thus completing the present invention. Summary of the Invention

[0008] One object of the present invention is to provide a lung - cancer - specific methylation biomarker and a composition for diagnosing lung cancer using the biomarker.

[0009] Another object of the present invention is to provide a method for diagnosing lung cancer using a lung - cancer - specific methylation biomarker.

[0010] Another object of the present invention is to provide the use of a lung - cancer - specific methylation biomarker for the diagnosis of lung cancer.

[0011] Another object of the present invention is to provide a kit for diagnosing lung cancer comprising the composition.

[0012] Yet another object of the present invention is to provide a method for providing information for the diagnosis of lung cancer using a methylated lung - cancer marker gene as a lung - cancer - specific methylation biomarker.

[0013] To achieve the above objects, the present invention provides a composition for diagnosing lung cancer, which comprises a substance capable of detecting the CpG island methylation of the PRRX1 (paired - related homeobox 1) gene and / or the ABCC9 (ATP - binding cassette sub - family C member 9) gene.

[0014] In addition, the present invention provides a method for diagnosing lung cancer, including administering to a patient a substance capable of detecting the methylation of CpG islands of the PRRX1 (paired related homeobox 1) gene and / or the ABCC9 (ATP-binding cassette subfamily C member 9) gene, or treating a sample of the patient with a material capable of detecting the methylation of CpG islands of the PRRX1 (paired related homeobox 1) gene and / or the ABCC9 (ATP-binding cassette subfamily C member 9) gene.

[0015] In addition, the present invention provides the use of a substance capable of detecting the methylation of CpG islands of the PRRX1 (paired related homeobox 1) gene and / or the ABCC9 (ATP-binding cassette subfamily C member 9) gene in the preparation of a composition for diagnosing lung cancer.

[0016] The present invention also provides a kit for diagnosing lung cancer, including the above composition.

[0017] The present invention also provides a method for providing information for lung cancer diagnosis, including treating a sample with a substance capable of detecting the methylation of CpG islands of the PRRX1 (paired related homeobox 1) gene and / or the ABCC9 (ATP-binding cassette subfamily C member 9) gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Shows the CpG microarray analysis design for discovering novel methylation biomarker candidates in lung cancer tissues;

[0019] Figure 2 Shows the process of discovering novel methylation biomarker candidates in lung cancer tissues through statistical analysis;

[0020] Figure 3 Shows the methylation status of two biomarker candidate genes in lung cancer cell lines (A) and tissues (B) measured by pyrosequencing;

[0021] Figure 4 Shows the methylation status of two biomarker genes in bronchoalveolar lavage fluid of lung cancer patients and patients with benign pulmonary diseases measured by methylation-specific real-time PCR, and the sensitivity and specificity for lung cancer diagnosis measured by ROC analysis; and

[0022] Figure 5 Shows the methylation status of the PRRX1 gene in the blood of healthy people and lung cancer patients measured by methylation-specific real-time PCR. DETAILED DESCRIPTION OF THE INVENTION

[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well-known and typical in the art.

[0024] One aspect of the present invention relates to the novel use of the lung cancer-specific methylated genes PRRX1 (paired related homeobox 1) and / or ABCC9 (ATP-binding cassette subfamily C member 9), namely their use for the diagnosis of lung cancer, and more specifically, to a composition for the diagnosis of lung cancer, which comprises a substance capable of detecting the CpG island methylation of the PRRX1 (paired related homeobox 1) gene and / or the ABCC9 (ATP-binding cassette subfamily C member 9) gene.

[0025] Furthermore, the present invention provides a method for diagnosing lung cancer, which includes administering to a patient a substance capable of detecting the CpG island methylation of the PRRX1 (paired related homeobox 1) gene and / or the ABCC9 (ATP-binding cassette subfamily C member 9) gene, or treating a sample of the patient with a substance capable of detecting the CpG island methylation of the PRRX1 (paired related homeobox 1) gene and / or the ABCC9 (ATP-binding cassette subfamily C member 9) gene.

[0026] In addition, the present invention provides the use of a substance capable of detecting the CpG island methylation of the PRRX1 (paired related homeobox 1) gene and / or the ABCC9 (ATP-binding cassette subfamily C member 9) gene in the preparation of a composition for the diagnosis of lung cancer.

[0027] Another aspect of the present invention relates to a method for providing information for the diagnosis of lung cancer, which includes treating a sample with a substance capable of detecting the CpG island methylation of the PRRX1 (paired related homeobox 1) gene and / or the ABCC9 (ATP-binding cassette subfamily C member 9) gene.

[0028] The present invention provides information for the diagnosis of lung cancer by measuring the methylation of the PRRX1 and / or ABCC9 genes that are specifically methylated in lung cancer cells. In addition, it has been confirmed that these novel markers are very useful for the diagnosis of lung cancer, because lung cancer can be diagnosed by detecting the CpG island methylation with excellent sensitivity and specificity.

[0029] As used herein, the term "methylation" refers to the modification of cytosine to 5-methylcytosine (5-mC), where the methyl group is attached to the fifth carbon of the cytosine base ring. 5-Methylcytosine is always attached only to the C of the CG dinucleotide (5'-mCG-3'), and such CG is commonly referred to as CpG. Methylation of CpG suppresses the expression of repetitive sequences in the genome, such as Alu or transposons, and CpG is the site where epigenetic changes most frequently occur in mammalian cells. This 5-mC of CpG is naturally converted to T by deamination, and thus, CpG in the mammalian genome appears only at a frequency of 1%, far lower than the normal frequency (1 / 4 x 1 / 4 = 6.25%).

[0030] There are regions where CpG is abnormally dense, called CpG islands. CpG islands are 0.2 to 3 kb in length and are highly enriched sites where the distribution percentage of C and G bases is greater than 50%, and the distribution percentage of CpG is 3.75% or higher. Approximately 45,000 CpG islands appear in the entire human genome and are concentrated in the promoter regions that regulate gene expression. CpG islands actually appear in the promoters of housekeeping genes, which account for approximately half of human genes.

[0031] CpG islands can be located in any region of the PRRX1 or ABCC9 gene. In particular, CpG islands can be located in the promoter region of the PRRX1 or ABCC9 gene, or can be present in the upstream or downstream regions of the PRRX1 or ABCC9 gene. In particular, CpG islands can be present in the introns, exons, or enhancers of the PRRX1 or ABCC9 gene, but the present invention is not limited thereto.

[0032] According to a specific embodiment of the present invention, it has been confirmed that lung cancer-specific hypermethylation occurs in the CpG islands in the promoter regions of the PRRX1 or ABCC9 gene. Based on this, CpG islands can be located in the promoters of the PRRX1 or ABCC9 gene.

[0033] The PRRX1 gene can include, for example, the sequence of SEQ ID NO:1. The CpG island of the PRRX1 gene can be present, for example, at positions -1,505 to -1,299 from the transcription start site (+1) in the sequence of SEQ ID NO:1. In particular, the CpG island of the PRRX1 gene can be present at positions -1,505, -1,411, and -1,343 from the transcription start site (+1) in the sequence of SEQ ID NO:1.

[0034] [SEQ ID NO:1]

[0035]

[0036] The ABCC9 gene may include, for example, the sequence of SEQ ID NO:2. The CpG island of the ABCC9 gene may be present, for example, at positions -373 to -220 from the transcription start site (+1) in the sequence of SEQ ID NO:2. In particular, the CpG island of the ABCC9 gene may be present, for example, at positions -373 to -264 from the transcription start site (+1) in the sequence of SEQ ID NO:2.

[0037] [SEQ ID NO:2]

[0038]

[0039] Genes of methylation biomarkers for lung cancer diagnosis according to the present invention are described below.

[0040]

[0041] *Sequence distance (bp) from the transcription start site (+1)

[0042] In particular, the PRRX1 gene may include, for example, the sequence of SEQ ID NO:1. The CpG island of the PRRX1 gene may be present, for example, at positions -1,505 to -1,299 from the transcription start site (+1: in SEQ ID NO:1 A with underline A ). The PRRX1 target positions may be -1,505 to -1,460 CTGCTCTATTTCTAGGGAGGTTTTGG GGAGACTGATCAGCTCCAAG , -1,411 to -1,366 GATGGAAACCTCTCTGCGCTATTAGACTGCGTCCAGTACAG CAGAT , or -1,343 to -1,299 AGCTTAGGCTCTCGGAGGCAGCTGAGTTGGAAATCCCGACGGAAA (based on the transcription start point in SEQ ID NO:1 A with underline A ).

[0043] In particular, the ABCC9 gene may include, for example, the sequence of SEQ ID NO:2. The CpG island of the ABCC9 gene may be present, for example, at positions -373 to -220 from the transcription start site (+1: in SEQ ID NO:2 G with underline G ). The ABCC9 target positions may be -373 to -326 AGAAACCAAGTTTTCTAGGTCGCCGGGGAAAAGC GGAAAATTAGACTT or -264 to -220 CTAGAATGAGCCCTTCATTTCCCGGATCCGTTCAGGGGGAAACAG (based on the transcription start point G in SEQ ID NO:2 G with underline ).

[0044] CpG island methylation can be detected by real-time quantitative amplification, for example, real-time polymerase chain reaction (real-time PCR), and the amount of PCR amplicon in real-time polymerase chain reaction can be detected based on fluorescence signals. As the real-time polymerase chain reaction proceeds, the intensity of the fluorescence signal increases with the increase in the amount of polynucleotide, and an amplification profile curve showing the dependence of the fluorescence signal intensity on the number of amplification cycles is obtained.

[0045] Generally, the amplification profile curve is divided into: a baseline region, which shows fluorescence signals in the background that do not reflect the actual amount of polynucleotide; an exponential region, where the fluorescence signal increases with the increase in the amount of polynucleotide product; and a plateau region, where PCR reaches saturation and thus the intensity of the fluorescence signal does not increase.

[0046] Usually, at the transition point from the baseline region to the exponential region, that is, the point where the amount of PCR amplicon reaches the amount detectable by fluorescence, the intensity of the fluorescence signal is called the threshold, and the number of amplification cycles corresponding to the threshold on the amplification profile curve is called the threshold cycle (Ct) value.

[0047] By measuring the Ct value, analyzing a standard curve in which the concentration is determined based on the Ct (threshold cycle) value of a reference substance, and confirming the concentration of the amplified gene, methylation specificity sensitivity and / or specificity can be determined.

[0048] In one embodiment, methylation can be detected by any method selected from the group consisting of: PCR, methylation-specific PCR, real-time methylation-specific PCR, PCR using a methylation-DNA specific binding protein, PCR using a methylation-DNA specific binding antibody, quantitative PCR, gene chip, sequencing method, sequencing by synthesis, and sequencing by ligation.

[0049] (1) Methylation-specific PCR: For detection by methylation-specific PCR, when treated with bisulfite, in the case of methylation, cytosine in the 5'-CpG-3' region remains as cytosine, while in the case of non-methylation, it is converted to uracil. Therefore, primers corresponding to the region where the 5'-CpG-3' sequence exists can be constructed for the sequence transformed after bisulfite treatment. When PCR is performed using the primers, since primers corresponding to the methylated sequence are used in the case of methylation, a PCR product is generated, and methylation can be confirmed by agarose gel electrophoresis. Here, the methylation detection probe can be, but is not limited to, TaqMan, Molecular Beacon, a probe with a self-reporting function, or a probe with an energy transfer labeling function.

[0050] (2) Real-time methylation-specific PCR: Real-time methylation-specific PCR is a real-time measurement method improved from methylation-specific PCR, and includes treating genomic DNA with bisulfite, designing PCR primers corresponding to the methylated sequence, and performing real-time PCR using the primers. Therefore, there are two methods: detection using a TaqMan probe complementary to the amplified sequence and detection using SYBR Green. Therefore, real-time methylation-specific PCR can selectively and quantitatively analyze only methylated DNA. Similarly, a standard curve can be created using an in vitro methylated DNA sample, and genes without 5'-CpG-3' in the sequence can also be amplified as a standardized negative control to quantitatively analyze the degree of methylation.

[0051] (3) PCR or quantitative PCR and DNA chip assay using a methylated DNA-specific binding protein: In the method of PCR or DNA chip using a methylated DNA-specific binding protein, when a protein that binds specifically only to methylated DNA is mixed with DNA, the protein binds specifically only to methylated DNA, so methylated DNA can be selectively isolated.

[0052] In addition, methylation can be measured by quantitative PCR. The methylated DNA isolated using a methylated DNA-specific binding protein can be labeled with a fluorescent dye and hybridized with a DNA chip integrated with a complementary probe to measure methylation.

[0053] (4) Detection by differential methylation-bisulfite sequencing: Another method for detecting nucleic acids containing methylated CpG includes contacting a nucleic acid-containing sample with a reagent that modifies unmethylated cytosine, and amplifying the CpG-containing nucleic acid in the sample using a CpG-specific oligonucleotide primer. Here, the oligonucleotide primer can be characterized by detecting methylated nucleic acids by distinguishing between modified methylated nucleic acids and unmethylated nucleic acids. The amplification step is optional and desirable, but not essential. This method relies on PCR to distinguish between modified (e.g., chemically modified) methylated DNA and unmethylated DNA.

[0054] (5) Bisulfite sequencing: Another method for detecting nucleic acids containing methylated CpG includes contacting a nucleic acid-containing sample with a reagent that modifies unmethylated cytosine, and amplifying the CpG-containing nucleic acid in the sample using a methylation-dependent oligonucleotide primer. Here, the oligonucleotide primer can be characterized by amplifying nucleic acids without distinguishing between modified methylated nucleic acids and unmethylated nucleic acids. The amplified product is described in combination with bisulfite sequencing for detecting methylated nucleic acids by next-generation sequencing methods, or for sequencing using sequencing primers by the Sanger method.

[0055] (6) Examples of next-generation sequencing methods may include sequencing-by-synthesis and sequencing-by-ligation. These methods are characterized in that individual DNA fragments are spatially separated, amplified in situ (clonal amplification), and sequenced, rather than generating bacterial clones. Here, this method is also referred to as massively parallel sequencing because thousands of fragments are read simultaneously.

[0056] Basically, sequencing-by-synthesis is performed, and methods for obtaining signals by sequentially ligating single nucleotides or dinucleotides are used. Examples thereof may include pyrosequencing, Ion Torrent, Solexa, etc.

[0057] Examples of NGS instruments based on sequencing-by-synthesis include Roche's 454 platform, Illumina's HiSeq platform, Life Technology's Ion PGM platform, and Pacific BioSciences' PacBio platform. For 454 and Ion PGM, emersion PCR is used as the clonal amplification method, and for HiSeq, bridge amplification is used. Sequencing-by-synthesis is used to read the sequence by detecting phosphoric acid, protons, or pre-ligation fluorescence generated when synthesizing DNA by sequentially ligating one nucleotide at a time. In the sequence detection method, pyrosequencing using phosphoric acid is performed for 454, and proton detection is performed for Ion PGM. For HiSeq and PacBio, fluorescence is detected to decode the sequence.

[0058] Sequencing-by-ligation is a sequencing technique that uses DNA ligase to identify nucleotides at specific positions in a DNA sequence. Different from most sequencing techniques that use polymerase, sequencing-by-ligation does not use polymerase, and is characterized in that DNA ligase does not ligate mismatched sequences. An example thereof is the SOLiD system. In this technique, two bases are read at a certain interval at a time, and are independently repeated five times by primer resetting so that each base is ultimately read twice in duplicate, thereby improving accuracy.

[0059] In sequencing-by-ligation, among a set of dinucleotide primers formed by 16 combinations, the dinucleotide primers corresponding to the relevant sequence are sequentially ligated, and these ligated combinations are finally analyzed, thereby completing the sequence of the corresponding DNA.

[0060] Here, next-generation sequencing methods can be illustrated by sequencing-by-synthesis or sequencing-by-ligation. Methylated-DNA specific binding proteins are but not limited to MBD2bt, and antibodies are but not limited to 5'-methyl-cytosine antibodies.

[0061] Therefore, substances capable of detecting CpG island methylation are not limited as long as they can detect positive methylation specific to lung cancer at a relatively high level and frequency, and can be, for example, primers or primer pairs capable of amplifying fragments including methylated CpG islands, probes capable of hybridizing with methylated CpG islands, sequencing primers, synthetic sequencing primers, or ligation sequencing primers.

[0062] As used herein, the term "primer" refers to a single-stranded oligonucleotide that can serve as an initiation point for template-directed DNA synthesis in a buffer at an appropriate temperature under appropriate conditions (i.e., four different nucleoside triphosphates and a polymerase).

[0063] Primers can be constructed to have "substantial" complementarity to each strand of the locus to be amplified. This means that the primers have sufficient complementarity to hybridize with the corresponding nucleic acid strand under the conditions for carrying out the polymerization reaction.

[0064] A primer can refer to, for example, a region of 5 bp to 50 bp, or 10 bp to 30 bp in length for a target gene or any region thereof.

[0065] As used herein, the term "complementary binding" means that a primer hybridizes with the corresponding nucleic acid strand under the conditions for carrying out the polymerization reaction, thereby forming a duplex structure. Complementary binding can occur when Watson-Crick pairing is formed between paired nucleotide sequences, or even when some non-Watson-Crick base pairing exists.

[0066] As used herein, a "probe" is a single-stranded nucleic acid molecule capable of hybridizing, including a sequence substantially complementary to the target nucleic acid sequence.

[0067] In a hybridization reaction, the conditions for achieving a certain stringency vary depending on the nature of the nucleic acid to be hybridized. For example, when selecting hybridization conditions, the length of the nucleic acid site to be hybridized, the degree of homology, the nucleotide sequence composition (e.g., GC / AT composition ratio), and the type of nucleic acid (e.g., RNA, DNA) are considered. Further considerations are, for example, whether the nucleic acid is immobilized on a filter or the like.

[0068] Examples of very stringent conditions are as follows: 2X SSC / 0.1% SDS at room temperature (hybridization condition); 0.2X SSC / 0.1% SDS at room temperature (low stringency condition); 0.2X SSC / 0.1% SDS at 42 °C (moderate stringency condition); and 0.1X SSC at 68 °C (high stringency condition). Any of these conditions can be used for the washing process, and for example, high stringency conditions or each of the above conditions can be used, each condition can be applied for 10 to 15 minutes in the above order, or all or some of the above conditions can be applied repeatedly. However, as described above, the optimal conditions vary depending on the specific hybridization reaction involved and can be determined experimentally. Generally, hybridization of the probe of interest uses high stringency conditions.

[0069] In some cases, the primer or probe can be detectably labeled, for example, with a radioisotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelate, or an enzyme. Appropriate labeling of the primer or probe is a technique well known in the art and can be carried out by typical methods.

[0070] The amount of the amplicon can be detected based on a fluorescence signal. The detection method can include an intercalation method using an intercalating agent that fluoresces by binding to the double-stranded DNA of the amplicon that binds to the primer or probe, a method using an oligonucleotide in which the 5'-end is labeled with a fluorescent substance and the 3'-end is labeled with a quencher, and the like.

[0071] In one embodiment, the substance capable of detecting CpG island methylation can be a primer or a primer pair capable of amplifying a fragment containing a methylated CpG island and / or a sequencing primer.

[0072] In a specific embodiment according to the present invention, PCR and sequencing primers are designed for pyrosequencing of the PRRX1 or ABCC9 gene. CpG islands located at positions -1,361, -1,355, -1,351, and -1,348 from the transcription start site (+1) in the sequence of the PRRX1 gene SEQ ID NO:1 can be amplified.

[0073] Specifically, the PCR primers for measuring methylation of the PRRX1 gene can include primers containing the sequences of SEQ ID NO:3 and SEQ ID NO:4, and a sequencing primer containing the sequence of SEQ ID NO:7.

[0074] CpG islands located at positions -242 and -236 from the transcription start site (+1) in the sequence of the ABCC9 gene SEQ ID NO:2 can be amplified.

[0075] Specifically, PCR primers for measuring the methylation of the ABCC9 gene may include primers containing the sequence of SEQ ID NO:5 and the sequence of SEQ ID NO:6, as well as sequencing primers containing the SEQ ID NO:8 sequence.

[0076]

[0077] Distance from the transcription start site (+1) (nucleotides): Position of the CpG site on genomic DNA for methylation measurement

[0078] Among the primers, the reverse primer may additionally include a marker.

[0079] The marker included in the reverse primer may be, but is not limited to, biotin, FAM, Cy5, Cy3, FITC, EDANS (5-(2'-aminoethyl)amino-1-naphthalenesulfate), tetramethylrhodamine (TMR), tetramethylrhodamine isocyanate (TMRITC), x-rhodamine, DIG, or an antibody or nanoparticle conjugated thereto.

[0080] Here, by reacting with a binder that induces the color development of the marker, it can be confirmed whether color development or fluorescence is expressed, and the amplification of the target nucleic acid can be detected. Therefore, the binder may be, but is not limited to, streptavidin.

[0081] In one embodiment, CpG island methylation can be detected by quantitative methylation-specific real-time PCR (qMSP). Primers and probes can be used for methylation analysis by qMSP.

[0082] The primers can be used simultaneously, for example, by pairing forward and reverse primers. The forward primer specifically amplifying the methylated PRRX1 gene may include, for example, the sequence of SEQ ID NO:9. The reverse primer may include, for example, the sequence of SEQ ID NO:10. The primers specifically amplifying the methylated PRRX1 gene may include the primer pair of SEQ ID NO:9 and 10.

[0083] The forward primer specifically amplifying the methylated ABCC9 gene may include, for example, the sequence of SEQ ID NO:11. The reverse primer may include, for example, the sequence of SEQ ID NO:12. The primers specifically amplifying the methylated ABCC9 gene may include the primer pair of SEQ ID NO:11 and 12.

[0084] Among the primers, the reverse primer may additionally include a marker.

[0085] The markers included in the reverse primer can be, but are not limited to, biotin, FAM, Cy5, Cy3, FITC, EDANS (5-(2'-aminoethyl)amino-1-naphthalenesulfate), tetramethylrhodamine (TMR), tetramethylrhodamine isocyanate (TMRITC), x-rhodamine, DIG, or an antibody or nanoparticle conjugated thereto.

[0086] Here, by reacting with a binder that induces the development of color of the marker, it is possible to confirm whether color development or fluorescence is expressed and detect the amplification of the target nucleic acid. Therefore, the binder can be, but is not limited to, streptavidin.

[0087] It may further include a step of treating with a probe that can hybridize complementarily with the methylated PRRX1 or ABCC9 gene specifically amplified by the primer.

[0088] In the hybridization reaction, the conditions for achieving a certain degree of stringency vary depending on the nature of the nucleic acid to be hybridized. For example, when selecting hybridization conditions, the length of the nucleic acid site to be hybridized, the degree of homology, the nucleotide sequence composition (e.g., GC / AT composition ratio), and the type of nucleic acid (e.g., RNA, DNA) are considered. Further considerations are, for example, whether the nucleic acid is immobilized on a filter or the like.

[0089] Examples of very stringent conditions are as follows: 2X SSC / 0.1% SDS at room temperature (hybridization conditions); 0.2X SSC / 0.1% SDS at room temperature (low stringency conditions); 0.2X SSC / 0.1% SDS at 42 °C (moderate stringency conditions); and 0.1X SSC at 68 °C (high stringency conditions). Any of these conditions can be used for the washing process, and for example, high stringency conditions or each of the above conditions can be used, each condition can be applied for 10 to 15 minutes in the above order, or all or some of the above conditions can be applied repeatedly. However, as described above, the optimal conditions vary depending on the specific hybridization reaction involved and can be determined experimentally. Generally, hybridization of the probe of interest uses high stringency conditions.

[0090] Probes that can hybridize complementarily with the amplified methylated PRRX1 or ABCC9 gene may include, for example, the sequences of SEQ ID NO:13 or 14. Probes that can hybridize complementarily with the amplified methylated PRRX1 gene may include the sequence of SEQ ID NO:13. Probes that can hybridize complementarily with the amplified methylated ABCC9 gene may include the sequence of SEQ ID NO:14.

[0091] In particular, the primers and probes for detecting methylation of the PRRX1 gene and / or ABCC9 gene according to the present invention are described as follows.

[0092]

[0093] In some cases, at least one reagent can be additionally included, which differentially modifies the methylated PRRX1 gene and / or ABCC9 gene and the unmethylated PRRX1 gene and / or ABCC9 gene.

[0094] As long as it is possible to distinguish between unmethylated cytosine and methylated cytosine, at least one reagent that differentially modifies methylated DNA and unmethylated DNA can be used without limitation, and examples thereof can include bisulfite, hydrogen sulfite, disulfite, and combinations thereof, but are not limited thereto. In particular, when using the above reagents, methylated cytosine is not converted, while unmethylated cytosine can be converted to a base other than uracil or cytosine.

[0095] When genomic DNA is treated with bisulfite, in the case of methylation, the cytosine in the 5'-CpG-3' region remains as cytosine, and in the case of non-methylation, it is converted to a base other than uracil or cytosine. Therefore, primers corresponding to the region where the 5'-CpG-3' sequence exists can be constructed for the sequence converted after bisulfite treatment.

[0096] The nucleic acid isolated from the sample is obtained from a biological sample of the specimen. To diagnose lung cancer or the stage of progression of lung cancer, nucleic acid must be isolated from lung tissue by scraping or biopsy. Such samples can be obtained by various medical procedures known in the art.

[0097] By comparing with the same part of the nucleic acid from a sample without abnormal cell growth in lung tissue, the degree of methylation of the nucleic acid in the sample obtained from the sample is measured. Hypermethylation indicates the presence of methylated alleles in at least one nucleic acid. When the same nucleic acid is tested in a sample without abnormal cell growth in lung tissue, methylated alleles do not appear.

[0098] The present invention is based on the discovery of the relationship between lung cancer and the hypermethylation of the PRRX1 (paired related homeobox 1) and / or ABCC9 (ATP-binding cassette subfamily C member 9) genes.

[0099] "Normal" cells are cells that do not show changes in abnormal cell morphology or cytological characteristics. "Tumor" cells are cancer cells, and "non-tumor" cells are part of diseased tissue but are not considered to be cells at the tumor site.

[0100] According to the present invention, by determining the methylation stage of at least one nucleic acid isolated from a sample, abnormal cell growth in the lung tissue of the sample can be diagnosed at an early stage. The methylation stage of the at least one nucleic acid can be compared with the methylation state of at least one nucleic acid isolated from a sample without abnormal cell growth in the lung tissue. Preferably, the nucleic acid is a CpG-containing nucleic acid, such as a CpG island.

[0101] According to the present invention, the susceptibility to abnormal cell growth in the lung tissue of a sample can be diagnosed, including determining the methylation of at least one nucleic acid isolated from the sample. The methylation stage of the at least one nucleic acid can be compared with the methylation state of at least one nucleic acid isolated from a sample that is not susceptible to abnormal cell growth in the lung tissue.

[0102] As used herein, the term "susceptibility" refers to the characteristic of being prone to abnormal cell growth. A sample with susceptibility is a sample that has not yet exhibited abnormal cell growth, but in which there is a possibility of abnormal cell growth or an increased likelihood of developing into abnormal cell growth.

[0103] The presence of CpG methylation in the target DNA can be an indicator of lung cancer. For example, CpG methylation in the promoter region of the target DNA can be measured.

[0104] Genes containing CpG are usually DNA. However, the method of the present invention can be carried out using samples containing, for example, DNA or DNA and RNA containing mRNA, where the DNA or RNA can be single-stranded or double-stranded, or using samples containing DNA-RNA hybrids.

[0105] Mixtures of nucleic acids can also be used. As used herein, the term "plurality" includes cases where there are multiple specific nucleic acid sequence sites to be detected in one gene and cases where multiple target DNA sequences are contained in a single tube (single reactor). The specific nucleic acid sequence to be detected can be part of a macromolecule or can initially exist in the form of discrete molecules, where the specific sequence constitutes a complete nucleic acid sequence. The nucleic acid sequence does not need to be a nucleic acid in pure form, and the nucleic acid can be a small part of a complex mixture (such as the complex mixture contained in whole human DNA).

[0106] In particular, the present invention relates to the detection of methylation of multiple target DNA sequences in a sample in a single reactor, where the sample can include multiple target DNA sequences, and any target DNA can be used without limitation as long as it is a gene that affects the development or progression of lung cancer when its expression is inhibited due to abnormal methylation, as well as a control gene.

[0107] As used herein, the terms "sample", "clinical sample" and "specimen" refer to a wide range of body fluids, including any biological fluid obtained from an individual, body fluid, cell line, tissue culture, etc., depending on the type of analysis being performed. Methods for obtaining body fluids and tissue biopsies from mammals are generally well known.

[0108] In the present invention, the sample can be from a human body, and for example, the sample can include lung cancer tissue, cells, feces, urine, blood, serum, respiratory lavage fluid (such as bronchoalveolar lavage fluid) or plasma.

[0109] Regarding the primers used in the present invention, when treated with a reagent such as bisulfite in step (a), in the case of methylation, the cytosine in the 5'-CpG-3' region remains as cytosine, while in the case of non-methylation, it is converted to uracil. Thus, for example, primers corresponding to the region where the 5'-CpG-3' sequence exists can be constructed for the sequence converted after treatment with a reagent (such as bisulfite).

[0110] Primers can be constructed to have "substantial" complementarity to each strand of the locus to be amplified. This means that the primers have sufficient complementarity to hybridize with the corresponding nucleic acid strand under the conditions for performing the polymerization reaction.

[0111] Another aspect of the present invention relates to a kit for detecting target DNA methylation comprising the above-described composition.

[0112] In one embodiment, the kit can include a compartmentalized carrier device for accommodating the sample, a container containing the reagent, and a container containing a substance capable of detecting the CpG island methylation of the PRRX1 gene and / or a substance capable of detecting the CpG island methylation of the ABCC9 gene. In some cases, it can also include a container containing a probe for detecting each of the amplicons of the methylated PRRX1 gene and / or the methylated ABCC9 gene.

[0113] The carrier device is adapted to accommodate one or more containers, such as bottles or tubes, and each container contains an independent component for the method of the present invention. In the context of the present invention, those of ordinary skill in the art can easily determine the distribution of the necessary reagents in the containers.

[0114] According to the present invention, lung cancer can be diagnosed by examining the methylation of the marker genes PRRX1 or ABCC9.

[0115] Using a sample showing a normal phenotype, the possibility of progression to lung cancer can be diagnosed by examining the methylation of the marker genes PRRX1 or ABCC9.

[0116] "Cell transformation" refers to the change in characteristics of a cell from one type to another, such as from normal to abnormal, from non-cancerous to cancerous, from undifferentiated to differentiated, or from stem cell to non-stem cell. In addition, transformation can be identified by the morphology, phenotype, biochemical properties, etc. of the cell.

[0117] In this article, "early detection" of cancer means the possibility of detecting cancer before metastasis, preferably before observing morphological changes in the tissue or cells of the sample being observed. In addition, "early detection" of cell transformation means a high probability that a cell undergoes transformation at an early stage before it is morphologically designated as transformed.

[0118] In the present invention, the PRRX1 or ABCC9 gene can be used alone or in combination as a diagnostic or predictive marker for lung cancer. When the PRRX1 and ABCC9 genes are used in combination, they can be used in a panel display form. In this way, according to the number of genes that are co-methylated and their importance, the genes can be graded and weighted, and the level of probability of developing into cancer can be specified.

[0119] The present invention can be better understood through the following examples. These examples are merely presented to illustrate the present invention and should not be construed as limiting the scope of the present invention, which will be obvious to those skilled in the art.

[0120] Example 1: Discovery of Lung Cancer-Specific Methylated Genes

[0121] To select biomarkers specifically methylated in lung cancer, genomic DNA (500 ng) from cancer tissues and adjacent tissues presenting as normal obtained from surgical tissues of 13 lung cancer patients (stages I-III, provided by Chungnam National University Hospital) was sonicated (Vibra Cell, SONICS) to generate genomic DNA fragments of approximately 200 - 300 bp.

[0122] According to the method described in Oh et al. (J. Mol. Diag. 2013; 15(4):498 - 507), only methylated DNA was obtained from the genomic DNA using a methyl-binding domain (MBD) known to bind to methylated DNA. The methylated DNA thus obtained, i.e., the methylated DNA bound to MBD2bt obtained according to the method described in Oh et al. (J. Mol. Diag. 2013; 15(4):498 - 507), was amplified and then hybridized with a human 244K human CpG microarray (Agilent, USA) Figure 1) After hybridization, a series of washing processes were carried out and then scanned with a laser scanner (Agilent, USA). Using the Feature Extraction program v.9.5.3.1 (Agilent, USA), the relative intensity difference of the signals between the lung cancer tissues of lung cancer patients and the adjacent tissues presented as normal was calculated to determine the signal values from the microarray images.

[0123] To select probes with reliable hybridization signals, the GeneSpring 7.3.1 program (Agilent, USA) was used. To select probes specifically hypermethylated in lung cancer, an ANOVA test was performed by comparing lung cancer tissues and the adjacent tissues presented as normal to lung cancer, and 6,854 probes with a P-value of 0.05 or less were selected. In addition, 621 probes with at least four-fold average hypermethylation in lung cancer tissues compared to the tissues presented as normal were selected again, and among the genes showing hypermethylation simultaneously in two or more adjacent probes in the promoter region, two novel biomarker candidate genes (PRRX1 and ABCC9) not reported to be methylated in lung cancer were selected ( Figure 2 )

[0124] The two biomarker candidate genes analyzed by the above method are shown in Table 1 below. In addition, the sequences of the regions corresponding to each probe of these two genes showing hypermethylation in the CpG microarray analysis were analyzed using MethPrimer (http: / / itsa.ucsf.edu / ~urolab / methprimer / index1.html), and the presence of CpG islands was confirmed.

[0125] [Table 1] List of methylated biomarker candidate genes for lung cancer diagnosis

[0126]

[0127] * Sequence distance (bp) from the transcription start site (+1)

[0128] Example 2: Confirmation of methylation of two biomarker candidate genes in lung cancer cell lines

[0129] To further confirm the methylation status of the biomarker candidate genes selected in Example 1, pyrosequencing was performed on each promoter region.

[0130] To convert unmethylated cytosine to uracil using bisulfite, total genomic DNA was isolated from the lung cancer cell line H358 (Korea Cell Line Bank, KCLB No. 25807), and 200 ng of genomic DNA was treated with bisulfite using the EZ DNA Methylation-Gold Kit (Zymo Research, USA). When DNA is treated with bisulfite, unmethylated cytosine is converted to uracil, and methylated cytosine remains unchanged. The bisulfite-treated DNA was eluted with 20 μl of sterile distilled water and subjected to pyrosequencing.

[0131] PCR and sequencing primers for pyrosequencing of two genes were designed using PyroMark Assay Design 2.0 (QIAGEN, Germany). The PCR and sequencing primers for measuring methylation of each gene are listed in Table 2 below.

[0132] [Table 2] Bisulfite PCR and pyrosequencing primers

[0133]

[0134] *Distance from the transcription start point (+1) (nucleotides): Position of the CpG site on the genomic DNA for methylation measurement

[0135] 20 ng of bisulfite-converted genomic DNA was amplified by PCR. The PCR solution (20 ng of bisulfite-converted genomic DNA, TOPsimple TM DryMIX-HOT (Enzynomics, P581H, Korea), 2 μl (10 pmol) of PCR primer) was treated at 95 °C for 5 minutes, followed by a total of 45 cycles with 30 seconds at 95 °C, 30 seconds at 60 °C, and 30 seconds at 72 °C, and then a reaction at 72 °C for 5 minutes. Amplification of the PCR product was confirmed by electrophoresis using a 2.0% agarose gel.

[0136] After treating the amplified PCR product with PyroMark Q48 Advanced CpG Reagent (QIAGEN, Germany), pyrosequencing was performed using the PyroMark Q48 Autoprep System (QIAGEN, Germany). After pyrosequencing, the degree of methylation was measured by calculating the methylation index. The methylation index was calculated by determining the average rate of cytosine binding to each CpG site.

[0137] As Figure 3As shown in A, based on the quantitative measurement results of the methylation levels of biomarker candidate genes in lung cancer cell lines using pyrosequencing, it was confirmed that both of the two biomarker genes were methylated at very high levels of 80% or higher in the H358 cell line. These two genes showed high methylation levels in lung cancer cell lines, indicating their potential utility as biomarkers for lung cancer diagnosis. Therefore, additional methylation verification experiments using tissue samples were conducted as described below.

[0138] Example 3: Measurement of Methylation of Biomarker Genes in Cancer Tissues and Adjacent Tissues Presenting as Normal in Lung Cancer Patients

[0139] For the two new biomarker candidate genes of Example 1 used as lung cancer diagnostic markers, they should show low methylation levels in normal lung tissues but high methylation levels in lung cancer tissues.

[0140] Therefore, the effectiveness of these two genes as biomarkers was verified using tissues from lung cancer patients. For this purpose, DNA from surgical tissues (lung cancer tissues and adjacent tissues presenting as normal) of 13 lung cancer patients used in the microarray experiment of Example 1 was treated with bisulfite, eluted with 20 μl of sterile distilled water, and used for pyrosequencing.

[0141] 20 ng of bisulfite-converted genomic DNA was amplified by PCR. The PCR solution (20 ng of bisulfite-converted genomic DNA, TOPsimple TM DryMIX-HOT (Enzynomics, P581H, Korea), 2 μl (10 pmol) of PCR primers) was treated at 95 °C for 5 minutes, followed by a total of 45 cycles, with 30 seconds at 95 °C, 30 seconds at 60 °C, and 30 seconds at 72 °C, and then a reaction at 72 °C for 5 minutes. The amplification of the PCR product was confirmed by electrophoresis using a 2.0% agarose gel.

[0142] Pyrosequencing was performed in the same manner as in Example 2.

[0143] Therefore, as Figure 3 shown in B, it was confirmed that both genes showed higher levels of methylation in lung cancer tissues than in tissues presenting as normal. PRRX1 showed higher methylation levels in the lung cancer tissues of 13 out of 13 patients (100%), and ABCC9 showed higher methylation levels in the lung cancer tissues of 12 out of 13 patients (92.3%) than in the adjacent tissues presenting as normal.

[0144] Table 3 below shows the average methylation values of PRRX1 and ABCC9 genes in lung cancer tissues and adjacent tissues presenting as normal. To determine whether there is a statistically significant difference in methylation levels between lung cancer tissues and tissues presenting as normal, a chi-square test was performed, and the results showed that the P value was 0.0001 or less, indicating a high level of significance (Table 3).

[0145] [Table 3] Results of quantitative methylation analysis of novel biomarkers PRRX1 and ABCC9

[0146]

[0147] *P value obtained from the chi-square test results

[0148] Example 4: Evaluation of the ability of novel biomarker genes PRRX1 and ABCC9 to diagnose lung cancer in bronchoalveolar lavage fluid

[0149] To further evaluate the ability of the two candidate genes to diagnose lung cancer, methylation in bronchoalveolar lavage fluid from lung cancer patients and non-lung cancer patients with benign lung diseases was analyzed.

[0150] For methylation analysis, a quantitative methylation-specific real-time PCR (qMSP) technique was established, and the primer and probe sequences used for methylation analysis are shown in Table 4 below.

[0151] [Table 4] Primer and probe sequences for qMSP of PRRX1 and ABCC9 genes

[0152]

[0153] After confirming methylation in lung cancer cell lines, methylation in DNA from bronchoalveolar lavage fluid was measured using relevant techniques. Genomic DNA was isolated from bronchoalveolar lavage fluid of 20 non-lung cancer patients and 20 lung cancer patients (provided by Konyang University Hospital). Then, 40 ng of the isolated genomic DNA was treated with bisulfite using the EZ DNA Methylation-Gold kit (Zymo Research, USA), eluted with 10 μl of sterile distilled water, and qMSP was performed. The PCR conditions and reaction solution composition for bronchoalveolar lavage fluid are shown in Table 5, and the PCR results were analyzed after normalization using the 35-ΔC T (biomarker gene C T - control gene C T ) value.

[0154] [Table 5] qMSP conditions and reaction solution composition

[0155]

[0156] *Enzynomics, South Korea, Cat No. GT-RT650 (customized)

[0157] **20 ng of bisulfite-treated genomic DNA

[0158] Based on the measurement results of methylation of two biomarker candidates in bronchoalveolar lavage fluid, the methylation in lung cancer patients was higher than that in non-lung cancer patients ( Figure 4 ). To evaluate the ability of these two genes to diagnose lung cancer, ROC (Receiver Operating Characteristic) curve analysis was performed, the optimal cut-off value for lung cancer diagnosis was set, and the sensitivity and specificity were evaluated ( Figure 4 ). Therefore, the PRRX1 gene had a sensitivity of 80% (16 / 20) and a specificity of 100% (20 / 20) for lung cancer diagnosis (Table 6). The ABCC9 gene had a sensitivity of 75% (15 / 20) and a specificity of 80% (16 / 20) for lung cancer diagnosis (Table 6).

[0159] [Table 6] Analysis of qMSP results of bronchoalveolar lavage fluid

[0160] gene PRRX1 ABCC9 cut-off value >26.5 >28.0 Sensitivity (n = 20) 80％(16 / 20) 75％(15 / 20) Specificity (n = 20) 100％(20 / 20) 80％(17 / 20)

[0161] In summary, among these two genes, due to its excellent sensitivity and specificity, PRRX1 was confirmed to be applicable to lung cancer diagnosis and was determined as the final biomarker.

[0162] Example 5: Evaluation of the ability of the novel biomarker gene PRRX1 to diagnose lung cancer in blood

[0163] The ability of the novel biomarker PRRX1 to diagnose lung cancer in plasma was evaluated using the same technique as in Example 4. For this purpose, DNA was isolated from 1.0 ml of plasma from 5 normal individuals (provided by Eulji University Hospital) and 5 lung cancer patients (provided by Chungnam National University Hospital), treated with bisulfite using the EZ DNA Methylation-Gold Kit (Zymo Research, USA), and then eluted with 5 μl of sterile distilled water. qMSP was performed and methylation was measured in the same manner as in Example 4.

[0164] Thereby, it was confirmed that the methylation in lung cancer patients was higher than that in normal individuals ( Figure 5 ). These results indicate that the novel biomarker gene PRRX1 can also be used for lung cancer diagnosis using blood.

[0165] Industrial applicability

[0166] According to the present invention, the PRRX1 or ABCC9 gene is provided as a lung cancer-specific methylation marker, and the PRRX1 or ABCC9 gene is used as a biomarker to detect methylation, thereby making it possible to detect methylation with high detection sensitivity, and ultimately enabling useful diagnosis of lung cancer through accurate and rapid lung cancer detection.

[0167] After the specific parts of the present invention have been described in detail above, it will be clear to those skilled in the art that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereto. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0168] Sequence Listing Free Text

[0169] An electronic file is attached.

Claims

1. A composition for diagnosing lung cancer, which comprises a substance capable of detecting the CpG island methylation of the PRRX1 (paired related homeobox 1) gene and / or the ABCC9 (ATP-binding cassette subfamily C member 9) gene.

2. The composition according to claim 1, wherein The CpG island is located in the promoter of the PRRX1 or ABCC9 gene.

3. The composition according to claim 1, wherein The CpG island of the PRRX1 gene is present at positions -1,505 to -1,299 from the transcription start site in the SEQ ID NO:1 sequence.

4. The composition according to claim 1, wherein, The CpG island of the ABCC9 gene is present at positions -373 to -220 from the transcription start site in the SEQ ID NO:2 sequence.

5. The composition according to claim 1, wherein, The substance capable of detecting CpG island methylation is a primer or primer pair capable of amplifying a fragment including the methylated CpG island, a probe capable of hybridizing with the methylated CpG island, a sequencing primer, a synthetic sequencing primer, or a ligation sequencing primer.

6. The composition according to claim 1, wherein The substance capable of detecting CpG island methylation is at least one primer selected from the group consisting of the sequences of SEQ ID NOs: 3 to 12 or a probe comprising the sequence of SEQ ID NO: 13 or 14.

7. The composition according to claim 1, which further comprises at least one reagent that differentially modifies methylated PRRX1 and / or ABCC9 and unmethylated PRRX1 and / or ABCC9.

8. The composition according to claim 7, wherein The reagent is bisulfite, acid bisulfite, pyrosulfite, or a combination thereof.

9. A kit for diagnosing lung cancer, which comprises the composition according to any one of claims 1 to 8.

10. A method for providing information for lung cancer diagnosis, which comprises treating a sample with a substance capable of detecting the CpG island methylation of the PRRX1 (paired related homeobox 1) gene and / or the ABCC9 (ATP-binding cassette subfamily C member 9) gene.

11. The method according to claim 10, wherein, The CpG island is located in the promoter of the PRRX1 or ABCC9 gene.

12. The method according to claim 10, wherein The CpG island of the PRRX1 gene is present at positions -1,505 to -1,229 from the transcription start site in the SEQ ID NO:1 sequence.

13. The method according to claim 10, wherein, The CpG island of the ABCC9 gene is present at positions -373 to -220 from the transcription start site in the SEQ ID NO:2 sequence.

14. The method according to claim 10, wherein The substance capable of detecting CpG island methylation is a primer or primer pair capable of amplifying a fragment including the methylated CpG island, a probe capable of hybridizing with the methylated CpG island, a sequencing primer, a synthetic sequencing primer, or a ligation sequencing primer.

15. The method according to claim 10, wherein, The substance capable of detecting CpG island methylation is at least one primer selected from the group consisting of the sequences of SEQ ID NOs: 3 to 12 or a probe comprising the sequence of SEQ ID NO: 13 or 14.

16. The method according to claim 10, which further comprises treating with at least one reagent that differentially modifies methylated PRRX1 and / or ABCC9 and unmethylated PRRX1 and / or ABCC9.

17. The method according to claim 16, wherein, The reagent is bisulfite, acid bisulfite, pyrosulfite, or a combination thereof.

Images