Application of morchella enzymolysis polysaccharide in regulating lipid metabolism disorder

Abstract

The invention discloses an application of morchella enzymolysis polysaccharide in regulating lipid metabolism disorder. The morchella enzymolysis polysaccharide disclosed by the invention can be used for regulating lipid metabolism disorder, regulating intestinal flora and preventing liver injury, oxidative stress and inflammation. The morchella esculenta adopted by the invention is medicinal and edible morchella esculenta, is free of chemical modification and is high in safety; and the enzymolysis process is low in cost, easy to scale and suitable for functional food or medicine development. In addition, the invention provides the application value of 8-aminooctanoic acid as a lipid metabolism disorder marker for the first time, and expands the application scene of EMIP in preparation of diversified products for regulating intestinal flora, improving liver injury, reducing oxidative stress and the like.

Description

Technical Field

[0001] The present invention relates to the application of enzymatically hydrolyzed polysaccharide from Morchella esculenta in regulating lipid metabolism disorder, belonging to the field of biotechnology. Background Art

[0002] Lipid metabolism disorder, a common metabolic disease in modern society, is closely related to chronic diseases such as obesity, non-alcoholic fatty liver disease, and atherosclerosis. Although traditional drug therapies can effectively regulate blood lipid levels, long-term use is prone to side effects such as liver injury and muscle toxicity, prompting researchers to turn their attention to the development of natural active substances. As a type of biological macromolecule with multi-target regulatory functions, polysaccharides have shown great potential in the fields of functional food and drug development due to their high safety and wide sources. Morchella esculenta, a fungus with both medicinal and edible properties, is rich in polysaccharide active components in its fruiting body. Existing studies have shown that it has biological activities such as antioxidant, immunomodulatory, and lipid-lowering effects. However, problems such as low bioavailability and poor permeability of high-molecular-weight polysaccharides severely limit the efficient expression of their functional activities.

[0003] Morchella esculenta, a fungus with both medicinal and edible properties, has functions such as promoting defecation and improving metabolism, and its polysaccharide component is considered to be one of the main biological active components. However, the relatively large molecular weight of Morchella esculenta polysaccharides may limit their absorption and utilization in the body, thus affecting the exertion of their biological activities. Therefore, moderately degrading Morchella esculenta polysaccharides to improve their lipid-lowering activity and deeply studying their action mechanisms are of great significance for the development of new lipid-lowering drugs or dietary supplements. Summary of the Invention

[0004] The object of the present invention is to provide the application of enzymatically hydrolyzed polysaccharide from Morchella esculenta in regulating lipid metabolism disorder, and the enzymatically hydrolyzed polysaccharide from Morchella esculenta can regulate lipid metabolism disorder, regulate intestinal flora, and prevent liver injury, oxidative stress, and inflammation.

[0005] The enzymatically hydrolyzed polysaccharide from Morchella esculenta involved in the present invention is prepared by the following method:

[0006] The polysaccharide from Morchella esculenta is enzymatically hydrolyzed using glucoamylase, and the obtained enzymatic hydrolysis product is successively inactivated, centrifuged, dialyzed, ethanol-precipitated, and freeze-dried to obtain the enzymatically hydrolyzed polysaccharide from Morchella esculenta.

[0007] Among them, the conditions for the enzymatic hydrolysis are as follows:

[0008] The enzymatic hydrolysis temperature is 60 - 65 °C, the pH is 4.3 - 4.7, the enzyme addition amount is 45 - 55 U / mL, and the enzymatic hydrolysis time is 2.5 - 3.5 h;

[0009] Preferably, the enzymatic hydrolysis temperature is 65 °C, the pH is 4.5, the enzyme addition amount is 50 U / mL, and the enzymatic hydrolysis time is 3 h.

[0010] Preferably, the morchella polysaccharide is prepared by a hot water extraction method;

[0011] The conditions of the hot water extraction method are as follows:

[0012] The solid-liquid ratio of morchella frondosa powder to water is 1:30, and it is extracted at 75-85 °C for 1.5-3 hours, and the extraction is repeated 2-4 times.

[0013] The pancreatic lipase inhibitory rate of the morchella enzymolysis polysaccharide used in the present invention is significantly higher than that of the original polysaccharide (MIP). When the concentration is 2.5 mg / mL, they reach 64.72% and 42.42% respectively; the total sugar content of the morchella enzymolysis polysaccharide decreases. Both polysaccharides contain more sulfate groups, and EMIP is slightly higher than MIP.

[0014] The results of scanning electron microscopy, molecular weight and particle size all prove that degradation makes the morchella polysaccharide particles smaller. The Mw values of MIP are 3.98×10 5 Da and 2.15×10 4 Da respectively, and the Mw of EMIP is 2.08×10 4 Da; the particle size results of the two are MIP (255.16 nm) and EMIP (164.32 nm) respectively. The HPIC results show that both MIP and EMIP are composed of GlcN, Gal, Glc, and Man, and the molar ratios are 0.023∶0.136∶0.668∶0.173 and 0.046∶0.398∶0.085∶0.471 respectively. It can be seen that degradation does not change the monosaccharide types of morchella polysaccharide, but significantly changes its molar ratio.

[0015] In addition, MIP and EMIP have similar ultraviolet spectra, thermogravimetric and congo red curves, indicating that degradation does not destroy the main structure of morchella polysaccharide. However, in the FT-IR spectral analysis, EMIP shows a β-glycosidic bond signal at 890 cm -1 which does not appear in MIP, indicating that degradation changes the functional groups of MIP.

[0016] In the in vitro antioxidant test, EMIP shows better antioxidant ability than MIP, indicating that degradation can not only improve the pancreatic lipase inhibitory ability of morchella polysaccharide, but also enhance its antioxidant ability. These changes may be related to the changes in the molecular weight, structure and chemical composition of the polysaccharide.

[0017] Specifically, the morchella enzymolysis polysaccharide can reduce the levels of total cholesterol, triglyceride, low-density lipoprotein cholesterol in serum and / or increase the level of high-density lipoprotein cholesterol.

[0018] Specifically, the enzymatically hydrolyzed polysaccharide of Morchella can reduce the levels of total cholesterol, triglyceride, and low-density lipoprotein cholesterol in liver tissues and / or increase the level of high-density lipoprotein cholesterol.

[0019] Specifically, the enzymatically hydrolyzed polysaccharide of Morchella can reduce liver fat deposition.

[0020] Specifically, the enzymatically hydrolyzed polysaccharide of Morchella can improve liver injury, oxidative stress, and / or intestinal permeability.

[0021] Specifically, the enzymatically hydrolyzed polysaccharide of Morchella can enrich Lactobacillus in the intestine and / or inhibit Dubosiella in the intestine.

[0022] Specifically, the enzymatically hydrolyzed polysaccharide of Morchella can regulate liver metabolites, specifically manifested as:

[0023] 1) Up-regulating the levels of 8-aminooctanoic acid and NADPH;

[0024] 2) Down-regulating the levels of lysophosphatidylglycerol and cholestenone.

[0025] Through the glucose amylase-directed enzymatic hydrolysis technology, the present invention successfully prepared EMIP with a smaller molecular weight and smaller particle size. Compared with the original polysaccharide, the pancreatic lipase inhibition rate of EMIP was significantly increased (more than 2 times), and it had stronger in vitro antioxidant ability (the DPPH, hydroxyl radical, ABTS scavenging rates and total antioxidant capacity were all superior to MIP), significantly enhancing the regulatory effect on lipid metabolism disorders.

[0026] EMIP of the present invention significantly reduced the levels of total cholesterol (TC), triglyceride (TG), and low-density lipoprotein cholesterol (LDL-C) in the serum and liver of high-fat diet mice (p<0.05), and increased the content of high-density lipoprotein cholesterol (HDL-C), effectively restoring lipid metabolism balance, specifically manifested as:

[0027] EMIP reduced the levels of serum ALT, AST and liver MDA, enhanced the activities of antioxidant enzymes such as SOD, GSH-Px, and CAT, and alleviated liver fat deposition and inflammatory infiltration.

[0028] EMIP enriched the probiotic Lactobacillus, inhibited the potential pathogenic bacterium Dubosiella, and reshaped the intestinal flora imbalance induced by high-fat diet.

[0029] EMIP up-regulated 8-aminooctanoic acid and NADPH (a key coenzyme for antioxidant) in the liver, down-regulated lysophosphatidylglycerol (LPG) and cholestenone (related to cholestasis), and achieved multi-pathway synergistic intervention through KEGG pathways (such as fatty acid metabolism, oxidative phosphorylation).

[0030] The morel used in the present invention is a morel that is both a medicine and a food, without chemical modification and with high safety; moreover, the enzymatic hydrolysis process has low cost and is easy to scale up, being suitable for the development of functional foods or drugs. Additionally, the present invention for the first time provides the application value of 8 - aminooctanoic acid as a lipid metabolism disorder marker, and expands the application scenarios of EMIP in the preparation of diversified products such as regulating the intestinal flora, improving liver injury, and reducing oxidative stress. Description of the Drawings

[0031] Figure 1 are the results of the pancreatic lipase inhibition rate after the polysaccharide from morel is hydrolyzed by different enzymes.

[0032] Figure 2 are the results of the pancreatic lipase inhibition rate of the polysaccharide from morel under different enzymatic hydrolysis temperatures (A), enzymatic hydrolysis pH (B), enzyme addition amount (C), and enzymatic hydrolysis time (D).

[0033] Figure 3 are the response surface plots (A, B, C) and contour plots (D, E, F) of the interaction of enzymatic hydrolysis conditions on the pancreatic lipase inhibition rate.

[0034] Figure 4 are the pancreatic lipase inhibition abilities of MIP and EMIP.

[0035] Figure 5 are the scanning electron microscope results of MIP (A, B) and EMIP (C, D) at 3000× and 10000×.

[0036] Figure 6 are the ultraviolet (A) and infrared (B) spectral analyses of MIP and EMIP.

[0037] Figure 7 are the high - performance ion chromatogram (A), high - performance gel chromatogram (B), particle size distribution curve (C), thermogravimetric curve (D), and Congo red (E) of MIP and EMIP.

[0038] Figure 8 are the DPPH (A), ·OH (B), ABTS (C) radical scavenging abilities and total antioxidant capacity (D) of MIP and EMIP.

[0039] Figure 9 are the effects of MIP and EMIP on the body weight (A), body weight gain (B), liver index (C), and fasting blood glucose (D) of high - fat diet mice.

[0040] Figure 10 are the effects of MIP and EMIP on the contents of serum TC (A), TG (B), LDL - C (C), HDL - C (D) and the ratios of TC / HDL - C (E), LDL - C / HDL - C (F) in high - fat diet mice.

[0041] Figure 11 Effects of MIP and EMIP on the contents of TC (A), TG (B), LDL-C (C) and HDL-C (D) in the livers of high-fat diet mice.

[0042] Figure 12 Pathological changes in the livers of high-fat diet mice after MIP and EMIP interventions (H&E, 100× and 200×).

[0043] Figure 13 Effects of MIP and EMIP on the contents of serum ALT (A), AST (B), TBA (C), and liver ALT (D), AST (E), TBA (F), SOD (G), MDA (H), GSH-Px (I) and CAT (J) in high-fat diet mice.

[0044] Figure 14 Effects of MIP and EMIP on the contents of serum LPS (A), TNF-α (B), IL-6 (C) and the gene expression levels of colon ZO-1 (D), Occludin (E), Claudin-1 (F) in high-fat diet mice.

[0045] Figure 15 Effects of MIP and EMIP interventions on the intestinal microbial diversity of high-fat diet mice (n = 3): petal diagram (A), α-diversity (B), principal component analysis (C).

[0046] Figure 16 Effects of MIP and EMIP interventions on the intestinal microbial abundance of high-fat diet mice (n = 3): phylum level (A), genus level (B).

[0047] Figure 17 Microbial differential contribution at the genus level between different groups and the MC group (A) and LDA distribution histogram (B).

[0048] Figure 18 Effects of H-MIP and H-EMIP on liver metabolites in high-fat diet mice (n = 5): PCA (A); OPLS-DA (B).

[0049] Figure 19 Volcano plots of metabolites in MC.vs.NC (A), H-MIP.vs.MC (B), H-EMIP.vs.MC (C); ROC curve of 8-aminooctanoic acid (D).

[0050] Figure 20 Heat map of potential metabolic biomarkers.

[0051] Figure 21 Spearman correlation analysis of metabolites with physiological indexes and intestinal flora.

[0052] Figure 22 These are KEGG metabolic pathway enrichment diagrams: MC.vs.NC (A), H-MIP.vs.MC (B), and H-EMIP.vs.MC. Detailed implementation manners

[0053] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0054] Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels.

[0055] Example 1: Preparation of enzymatically hydrolyzed polysaccharide from Morchella

[0056] The fruiting bodies of Morchella importuna were provided by the Edible Fungi Center of Shanxi Agricultural University.

[0057] α-amylase, β-amylase, glucoamylase, and Triton X-100 were purchased from Shanghai Yuanye Bio-Technology Co., Ltd.; cellulase was purchased from Beijing Bio-ATech Co., Ltd.; pancreatic lipase was purchased from Sigma-Aldrich, USA.

[0058] I. Extraction of Morchella polysaccharide (MIP)

[0059] The Morchella fruiting bodies were placed in an oven at 50 °C until constant weight, ultrasonically pulverized and passed through a 100-mesh sieve. 1 g of the powder was extracted at 80 °C for 2 h according to a solid-liquid ratio of 1:30, and the extraction was repeated three times. The supernatant was concentrated by centrifugation at 6000 r / min for 10 min. After deproteinization with zinc acetate-potassium ferrocyanide, it was centrifuged at 6000 r / min for 10 min, precipitated with alcohol overnight and then centrifuged at 6000 r / min for 10 min. The precipitate was redissolved and dialyzed against running water (3500 Da), and then freeze-dried to obtain MIP (total carbohydrate content was 62.60%).

[0060] II. Preparation of enzymatically hydrolyzed polysaccharide from Morchella (EMIP)

[0061] 1. Single-factor experiment

[0062] The 20 mg / mL pancreatic lipase solution was prepared with 0.2 mmol / L phosphate buffer (PBS) at pH 8.0, and the 0.8 mg / mL 4-nitrophenyl laurate was prepared with 5 mmol / L anhydrous sodium acetate solution (pH 5.0, containing 1% Triton X-100). In a 1.5 mL centrifuge tube, 200 μL of 2 mg / mL polysaccharide solution, 100 μL of PBS, and 100 μL of pancreatic lipase solution were added in sequence. After incubation in a metal bath at 37 °C for 30 min, 200 μL of 4-nitrophenyl laurate substrate solution was added, and after incubation at 37 °C for 60 min, the absorbance was measured at 405 nm.

[0063]

[0064] Where: A1: Absorbance value of 200 μL polysaccharide, 100 μL PBS, 100 μL pancreatic lipase, and 200 μL substrate

[0065] A2: Absorbance value of 200 μL polysaccharide, 100 μL PBS, 100 μL distilled water, and 200 μL substrate

[0066] A3: Absorbance value of 300 μL PBS, 100 μL pancreatic lipase, and 200 μL substrate

[0067] A4: Absorbance value of 300 μL PBS, 100 μL distilled water, and 200 μL substrate

[0068] In the present invention, α-amylase, β-amylase, glucoamylase, and cellulase were used to hydrolyze MIP under the optimal conditions respectively. The enzyme concentration was 40 U / mL, the MIP concentration was 4 mg / mL. After enzymatic hydrolysis for 3 h, it was inactivated at 100 °C for 15 min. After centrifugation to obtain the supernatant, it was dialyzed and ethanol-precipitated, and then freeze-dried. For the enzymes screened according to the pancreatic lipase inhibition rate, the method of controlling variables was adopted, and different enzymatic hydrolysis temperatures (35 °C, 45 °C, 55 °C, 65 °C, 75 °C), different enzymatic hydrolysis pH values (3.5, 4.0, 4.5, 5.0, 5.5), different enzyme addition amounts (30 U / mL, 40 U / mL, 50 U / mL, 60 U / mL, 70 U / mL), and different enzymatic hydrolysis times (2.0 h, 2.5 h, 3.0 h, 3.5 h, 4.0 h) were set respectively to determine the optimal enzymatic hydrolysis conditions.

[0069] 1) Determination of enzymes

[0070] The inhibitory effects of the products obtained by hydrolyzing MIP with various enzymes under the optimal pH and temperature conditions on pancreatic lipase are as Figure 1As shown, from high to low, they are glucoamylase (51.80%), cellulase (48.56%), β - amylase (46.72%), α - amylase (44.30%), and no enzyme added (40.38%), indicating that enzymatic hydrolysis can improve the pancreatic lipase inhibitory ability of Morchella polysaccharides. Among them, glucoamylase has the best effect. Therefore, glucoamylase was selected for the subsequent single - factor experiments.

[0071] 2) Determination of enzymatic hydrolysis temperature

[0072] As Figure 2 , under the conditions of pH 4.5, glucoamylase concentration of 40 U / mL, and temperatures of 35℃, 45℃, 55℃, 65℃, and 75℃ respectively, the inhibitory effects of the products of each group on pancreatic lipase showed a trend of first increasing and then decreasing with the increase of temperature. This is because before 65℃, as the temperature rises, the movement rates of Morchella polysaccharides and glucoamylase molecules increase, the effective collision frequency between the two improves, and the degradation effect is strengthened accordingly. When the temperature rises to 75℃, it exceeds the tolerance range of glucoamylase, and the enzyme molecular bonds begin to break, and the polysaccharide degradation efficiency also decreases rapidly. Therefore, it was considered to set the enzymatic hydrolysis temperature at 65℃ in the subsequent experiments.

[0073] 3) Determination of enzymatic hydrolysis pH

[0074] Too high or too low pH will affect the dissociation of active groups on the enzyme molecule, affect the binding efficiency of the enzyme. In addition, it will also change the conformation of the enzyme or even inactivate it. The optimal pH range of glucoamylase is around 4.0 - 4.5. As Figure 2 shown, when the pH is between 3.5 and 4.5, the pancreatic lipase inhibition rate of enzymatically hydrolyzed Morchella polysaccharides increases steadily, indicating that the enzymatic hydrolysis reaction becomes more and more sufficient. However, as the pH value further increases, the inhibitory effect weakens greatly, which may be because it exceeds the optimal pH range of glucoamylase, resulting in a decrease in enzyme activity and affecting the degradation efficiency. Therefore, it was considered to select pH 4.5 as the enzymatic hydrolysis condition in the subsequent experiments.

[0075] 4) Determination of enzyme addition amount

[0076] From Figure 2 it can be seen that as the enzyme addition amount increases, the pancreatic lipase inhibitory activity of the polysaccharide also increases. However, after exceeding 50 U / mL, the inhibition rate begins to decline significantly. It may be that the increase in enzyme concentration leads to excessive degradation of the polysaccharide, too small molecular weight, and the inability to form an active polymer structure, resulting in a decrease in polysaccharide activity. Therefore, the addition amount of glucoamylase was determined to be 50 U / mL.

[0077] 5) Determination of enzymatic hydrolysis time

[0078] See Figure 2When the enzymatic hydrolysis time is less than 3 h, the polysaccharide cannot reach the optimal inhibitory activity, which may be due to insufficient degradation. After more than 3 h, the inhibitory effect shows a downward trend, indicating that 3 h is the most suitable enzymatic hydrolysis time. From the above results, it can be seen that the change of enzymatic hydrolysis time has little effect on the inhibitory activity of the polysaccharide. Therefore, three factors, namely enzymatic hydrolysis temperature, enzymatic hydrolysis pH, and enzyme addition amount, are selected for the subsequent response surface optimization experiment.

[0079] 2. Response surface experiment

[0080] According to the results of the single-factor experiment, with the pancreatic lipase inhibition rate (Y) as the response index, enzymatic hydrolysis temperature (A), enzymatic hydrolysis pH (B), and enzyme addition amount (C) as the response variables, the Box-Behnken test was used to optimize the degradation conditions of MIP by response surface. The detailed data are shown in Table 1, and EMIP prepared under the optimal degradation process was obtained.

[0081] Table 1 Variables and levels in Box-Behnken design

[0082]

[0083] 1) Model fitting

[0084] According to the results of the single-factor experiment, Design Expert software was used to perform response surface analysis on the hydrolysis conditions of glucoamylase, and the operation data are shown in Table 2.

[0085] Table 2 Variance analysis table of pancreatic lipase inhibition rate

[0086]

[0087] 2) Response surface analysis

[0088] The correlation between the dependent variable and the independent variables can be intuitively reflected by 3D response surface plots and 2D contour plots ( Figure 3 ), observing the 3D response surface plots ( Figure 3 Figures A, B, and C therein), it can be seen that the pancreatic lipase inhibition rate shows a trend of first increasing and then decreasing with the increase of any two of the factors. Corresponding to the 2D contour plots ( Figure 3 Figures D, E, and F therein), it can be seen that the interaction between pH and temperature and enzyme addition amount is relatively strong. The optimal conditions predicted by the response surface are that the glucoamylase addition amount is 50.42 U / mL, the temperature is 64.96 °C, the pH is 4.46, and the pancreatic lipase inhibition rate is 60.9673%. For the convenience of actual experimental operation, the predicted optimal conditions are modified to an enzyme addition amount of 50 U / mL, a temperature of 65 °C, and a pH of 4.5. Under these conditions, the result of the verification experiment is that the pancreatic lipase inhibition rate is 59.81%.

[0089] 3) In vitro pancreatic lipase inhibitory activities of MIP and EMIP

[0090] As Figure 4 shown, after hydrolysis by glucoamylase, the inhibitory ability of Morchella polysaccharide against pancreatic lipase was significantly improved. In the concentration range of 0.5 - 2.5 mg / mL, the inhibitory rate of EMIP was always higher than that of MIP, and showed concentration dependence. When the concentration was 0.5 mg / mL, the pancreatic lipase inhibitory rates of MIP and EMIP were 16.74% and 37.52% respectively, and the inhibitory effect of EMIP was 2.24 times that of MIP. Therefore, enzymolysis can effectively improve the inhibitory ability of MIP against pancreatic lipase.

[0091] 3. Determination of Chemical Components of MIP and EMIP

[0092] The total carbohydrate, protein, uronic acid, reducing sugar, sulfate group and total polyphenol contents in MIP and EMIP were determined by phenol - sulfuric acid method, Coomassie brilliant blue method, sulfuric acid - carbazole method, DNS method, barium chloride - gelatin turbidimetry and Folin - Ciocalteu method.

[0093] The chemical component results of MIP and EMIP are shown in Table 3. After degradation by glucoamylase, the contents of total carbohydrate, protein and total phenol in MIP decreased, while the contents of reducing sugar and sulfate group increased. This may be due to the cleavage of glycosidic bonds, which changed the molecular conformation and exposed the sulfate groups. Some studies have found that the components with better obesity inhibitory effects in fucoidan contain more sulfate groups. The increase in sulfate groups may be one of the reasons for the stronger pancreatic lipase inhibitory ability of EMIP.

[0094] Table 3 Chemical Compositions of MIP and EMIP

[0095] Sample MIP EMIP Carbohydrate content (%) <![CDATA[62.60% ± 1.89 a > <![CDATA[41.11% ± 1.68 b > Protein content (%) <![CDATA[1.81% ± 0.03 a > <![CDATA[1.02% ± 0.05 b > Uronic acid content (%) NA NA Reducing sugar content (%) <![CDATA[4.25% ± 0.05 b > <![CDATA[5.11% ± 0.02 a > Sulfate content (%) <![CDATA[21.79% ± 0.46 b > <![CDATA[23.01% ± 0.20 a > Total phenol content (%) <![CDATA[7.21% ± 0.11 a > <![CDATA[5.11% ± 0.19 b >

[0096] 4. Structural Characterization of MIP and EMIP

[0097] 1). Scanning Electron Microscopy

[0098] An appropriate amount of dry MIP and EMIP powders were placed on the sample stage. After coating with gold powder using a vacuum sputtering coater, the morphological characteristics of the samples were observed through a scanning electron microscope.

[0099] The micro - morphologies of MIP and EMIP were observed by scanning electron microscope at 3000× and 10000× (Figure 5 ). MIP presented as reticular fragments of different sizes, with irregular internal structures, loose arrangements and large pores, while EMIP was composed of smooth flakes and irregular small particles, with close packing and uniform distribution, indicating that after degradation, the polysaccharide molecular chains were damaged, the particle size decreased and became more uniform.

[0100] 2) Ultraviolet and infrared spectrum scanning

[0101] Prepare 0.5 mg / mL MIP and EMIP solutions, and use a UV-visible spectrophotometer to detect the UV-visible absorption spectra of the samples in the range of 190 - 800 nm; use the KBr pellet method to process MIP and EMIP powders, and scan the infrared absorption spectra of the samples in the range of 4000 - 500 cm -1 range by a spectrometer.

[0102] The results of the ultraviolet spectrum scanning are shown in Figure 6 Figure A therein. There are no obvious absorption peaks for MIP and EMIP at 260 nm and 280 nm, indicating that there is no nucleic acid and protein residue. Moreover, the absorbance values of EMIP at these two wavelengths are lower than those of MIP, indicating that degradation can reduce the nucleic acid and protein content, which is consistent with the change trend of the protein content in 2.3.5.

[0103] The results of the FT-IR spectrum scanning are shown in Figure 6 Figure B therein. The absorption peak near 3400 cm -1 is caused by the OH stretching vibration of the polysaccharide molecule, and the peak at 2930 cm -1 represents the stretching vibration peak of C-H; the peak observed at 1652 cm -1 is not only attributed to the adsorbed water in the sample, but also the stretching vibration peak of C=O. The absorption peak at 1400 cm -1 is the characteristic peak of the symmetric stretching vibration of the carboxyl group, while the absorption peaks at 1030 cm -1 and 1066 cm -1 indicate the presence of pyranose rings in MIP and EMIP. Signals of α-type glycosidic bonds appear at 814 cm -1 for both polysaccharides, but the signal of β-type glycosidic bonds at 890 cm -1 only appears in the EMIP spectrum.

[0104] 3) Determination of monosaccharide composition

[0105] Add 2 mL of 3M TFA to 5 mg of the polysaccharide sample, hydrolyze at 120 °C for 3 h and then dry. Add 5 mL of water, vortex and mix well, then dilute ten times, centrifuge at 12000 rpm for 5 min, and take the supernatant for IC analysis. NaOH (15 mM) is used as the eluent, flow rate: 0.3 mL / min; injection volume: 25 μL; column temperature: 30 °C.

[0106] As shown in Table 4 and Figure 7As shown in Figure A, both MIP and EMIP are composed of glucosamine hydrochloride, galactose, glucose, and mannose, with molar ratios of 0.023∶0.136∶0.668∶0.173 and 0.046∶0.398∶0.085∶0.471, respectively. Glucoamylase hydrolysis increased the contents of galactose and mannose and decreased the glucose content, but did not affect the types of monosaccharides.

[0107] 5. Determination of Molecular Weight and Particle Size Distribution

[0108] The molecular weight distribution characteristics of MIP and EMIP were analyzed by HPGPC, and the particle sizes of MIP and EMIP solutions were determined using a nanoparticle size analyzer.

[0109] Enzymatic hydrolysis can break the glycosidic bonds of polysaccharides and reduce the molecular weight. As can be seen from Table 4, MIP has two main peaks, with weight-average molecular weights of 3.98×105 Da (27.876%) and 2.15×104 Da (72.124%), respectively. After degradation, EMIP has only one peak, with a weight-average molecular weight of 2.08×104 Da, and the Mw / Mn value is close to 1. And Figure 7 As can be seen in Figure B, EMIP shows a single-peak symmetric state (the peak of the mobile phase is at 45.5 min), indicating that the molecular weight distribution is relatively uniform. As shown in Table 4 and Figure 7 As shown in Figure C, the particle sizes of MIP and EMIP are 255.16±1.36 nm and 164.32±1.94 nm, respectively. This result corresponds to the molecular weight, both indicating that glucoamylase can effectively degrade Morchella polysaccharides.

[0110] 5. Thermogravimetric Determination

[0111] Accurately weigh 5 mg of the sample and place it in a crucible. Set the heating rate to 10℃ / min, and use a thermogravimetric analyzer to analyze the thermal stability of the sample during the heating process from 25℃ to 600℃.

[0112] The thermograms of MIP and EMIP are shown in Figure 7 Figure D. The TGA curves of the two polysaccharides contain two main weight loss processes. First, there is a slight mass loss between 30-100℃, which belongs to the bound water and free water in the polysaccharides. Secondly, the mass rapidly decreases in the temperature range of 250-400℃, and the weight loss rate is nearly 60%, which is due to the large amount of degradation of the polysaccharides at high temperatures. After that, the temperature continues to rise, but the mass loss of the polysaccharides begins to enter a plateau stage.

[0113] 6. Congo Red Test

[0114] Using the Congo red solution without the polysaccharide sample as the experimental control, the triple helix structures of MIP and EMIP were determined.

[0115] Figure 7 Figure E shows the maximum absorption wavelength of the polysaccharide-Congo red solution after mixing with NaOH solutions of different concentrations. Congo red can bind to polysaccharides containing a triple-helical conformation, causing a red shift in the maximum absorption wavelength of the solution. A red shift phenomenon occurred for both polysaccharides in the figure, indicating that they both have a triple-helical structure and the degradation did not cause the disappearance of the triple-helical structure.

[0116] Table 4 Monosaccharide composition, molecular weight, and particle size of MIP and EMIP

[0117]

[0118]

[0119] Example 2, in vitro antioxidant activities of MIP and EMIP

[0120] Prepare MIP and EMIP solutions at different concentrations (0.25, 0.5, 1.0, 2.0, 4.0 mg / mL). Using VC as a positive control, measure the DPPH radical scavenging ability and hydroxyl radical scavenging ability; use an ABTS detection kit and a total antioxidant capacity (T-AOC) detection kit (Beijing Solarbio Science & Technology Co., Ltd.) to measure the ABTS radical scavenging ability and total antioxidant capacity.

[0121] Use Design Expert 8.0.6 Trial, Excel, and SPSS Statistics 26 for data analysis. Different lowercase letters indicate statistical significance between groups (p < 0.05).

[0122] 1. DPPH radical scavenging ability

[0123] From Figure 8 Figure A, it can be seen that at different concentration gradients, the DPPH radical scavenging ability of EMIP is stronger than that of MIP, and both are positively correlated with the concentration. The IC50 values of MIP and EMIP are 0.306 and 0.258 mg / mL, respectively, which are much lower than those of ginseng polysaccharide GPS-1A (12.45 mg / mL) and degraded ginseng polysaccharide DGPS-1A (2.32 mg / mL), indicating that MIP and EMIP can be used as natural antioxidants, and the effect of EMIP is better.

[0124] 2. Hydroxyl radical scavenging ability

[0125] Hydroxyl radicals are considered the most active oxygen radicals and can easily penetrate cell membranes, causing oxidative damage to cells. From Figure 8As can be seen from Figure B, MIP and EMIP have different scavenging abilities for hydroxyl radicals (IC50 values are 0.368 and 0.268 mg / mL respectively). The results are the same as the trend of DPPH radical scavenging rate. When the concentration is 0.5 and 1 mg / mL, the difference in scavenging ability between the two polysaccharides is relatively large, which are 15.71% and 16.60% respectively. Wu et al. found that the enzymolysis products of Auricularia auricula polysaccharide (AAP) have improved scavenging ability for hydroxyl radicals, which is similar to the results of the present invention, indicating that enzymolysis can be an effective method to improve the antioxidant activity of polysaccharides.

[0126] 3. ABTS Radical Scavenging Ability

[0127] The ABTS radical scavenging abilities of MIP and EMIP are shown in Figure 8 Figure C. With the increase of concentration, the scavenging abilities of MIP and EMIP also increase. After calculation, the IC50 values of MIP and EMIP are 0.424 mg / mL and 0.281 mg / mL respectively. At low concentrations, there are significant differences in the scavenging abilities of the two. When the concentration is 1 mg / mL, the scavenging rate of MIP reaches 75.56%, and the scavenging rate of EMIP is 87.59% at this time, which is higher than that of the polysaccharide from the cap of Boletus luridus (21.17%) at the same concentration, indicating that MIP and EMIP have good ABTS radical scavenging abilities.

[0128] 4. Total Antioxidant Capacity

[0129] As can be seen from Figure 8 Figure D, in the concentration range of 0.25 - 4 mg / mL, the total antioxidant capacities of MIP and EMIP are positively correlated with the concentration. Although the T-AOC of MIP and EMIP is always lower than that of ascorbic acid within the test concentration range, EMIP still shows a higher total antioxidant capacity than MIP.

[0130] Based on the above four antioxidant capacity tests, it is found that the degraded Morchella polysaccharide shows better antioxidant activity than the original one. The stronger antioxidant ability of MIP may be related to the decrease in molecular weight, the increase in the content of sulfate groups and galactose. The molecular weight, monosaccharide molar ratio, functional groups and sulfate group content of polysaccharides are closely related to antioxidant activity.

[0131] Example 3. Regulation of Lipid Metabolism Disorder by Enzymatically Hydrolyzed Morchella Polysaccharide

[0132] Experimental animals: 60 6-week-old SPF-grade male C57BL / 6J mice were provided by Beijing Spearf Bio-Technology Co., Ltd., with the license number SCXK(Beijing)2019 - 0010.

[0133] Standard feed, high-fat feed (D12492) (Spevogen (Beijing) Biotechnology Co., Ltd.); kits for TC, TG, HDL-C, LDL-C, AST, ALT, TBA, CAT, GSH-Px, SOD, MDA (Nanjing Jiancheng Bioengineering Institute); ELISA kits for LPS, TNF-α, IL-6 (Wuhan Fine Biotech Co., Ltd.); hematoxylin-eosin staining solution, neutral resin (Beijing Solarbio Science & Technology Co., Ltd.); RNAiso Plus (TAKARA, Japan); HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Nanjing Novoprotein Co., Ltd.).

[0134] 1. Experimental methods

[0135] 1) Establishment of experimental animal models

[0136] After one week of adaptive feeding, 60 male C57BL / 6J mice were randomly divided into 6 groups (n = 10), namely the normal diet group (NC group), high-fat diet group (MC), low-dose Morchella polysaccharide group (L-MIP) and high-dose group (H-MIP), low-dose enzymatically hydrolyzed Morchella polysaccharide group (L-EMIP) and high-dose group (H-EMIP). During the following experiment, except for the NC group which was given normal feed, the remaining groups of mice were provided with high-fat feed. At the same time, the mice were gavaged daily according to their body weight. The NC group and the MC group were gavaged with normal saline; the L-MIP group and the H-MIP group were gavaged with MIP solution at 100 mg / kg and 400 mg / kg respectively; the L-EMIP group and the H-EMIP group were gavaged with EMIP solution at 100 mg / kg and 400 mg / kg respectively, and gavaging continued for 8 weeks. The body weight of the mice was monitored and recorded once a week. After the experiment, the mice were fasted for 12 h, and blood was taken from the orbital cavity. After the blood was allowed to stand for a period of time, it was centrifuged (3000 r / min, 15 min) to obtain the supernatant, which was stored in a -80 °C refrigerator. The remaining organs and feces were collected and stored for later use according to the corresponding operations.

[0137] 2) Determination of body weight, liver, kidney, spleen indexes and fasting blood glucose values of mice

[0138] During the feeding period, body weight was monitored once a week. The complete liver of the mice was collected, rinsed with pre-cooled normal saline and then dried with sterile filter paper, and weighed to calculate the liver index. Liver index (%) = liver weight (g) / mouse weight (g) × 100%. Before the end of the experiment, the fasting blood glucose of the mice (fasted for 12 h) was measured using a blood glucose meter.

[0139] 3) Determination of serum biochemical indexes of mice

[0140] The contents of TC, TG, HDL-C, LDL-C, ALT, AST, and TBA in serum were detected using the kits from Nanjing Jiancheng, and the levels of LPS, TNF-α, and IL-6 factors in serum were detected using ELISA kits.

[0141] 4) Determination of biochemical indexes in mouse liver

[0142] The contents of TC, TG, HDL-C, LDL-C, ALT, AST, SOD, MDA, GSH-Px, CAT, and TBA in liver tissues were detected using the kits from Nanjing Jiancheng.

[0143] 5) H&E staining of liver

[0144] Mouse liver tissues were taken, fixed in 4% paraformaldehyde for 48 h, and then the paraffin sectioning and H&E staining procedures were carried out according to the method of Guo Dongdong et al.

[0145] 6) RT-qPCR analysis of the expression of related genes in colon tissues

[0146] Total RNA was extracted from tissues according to the instructions of the RNAiso Plus kit. The total RNA was reverse transcribed into cDNA using the reverse transcription kit HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) and stored at -20 °C for later use. Using a real-time fluorescence quantitative PCR instrument, with β-actin as the internal reference gene, the expression of ZO-1, Occludin, and Claudin-1 genes in colon tissues was quantified. The details of the primer sequences are shown in Table 5.

[0147] Table 5 RT-qPCR primer sequences

[0148] Primer name Forward primer (5′→3′) Reverse primer (5′→3′) β-actin ACTGTCGAGTCGCGTCCA ATCCATGGCGAACTGGTGG ZO-1 GCTTTAGCGAACAGAAGGAGC TTCATTTTTCCGAGACTTCACCA Occludin TGAAAGTCCACCTCCTTACAGA CCGGATAAAAAGAGTACGCTGG Claudin-1 GGGGACAACATCGTGACCG GGGGACAACATCGTGACCG

[0149] 7) Data statistics

[0150] Excel was used to draw charts, and SPSS software was used for significance analysis. Different lowercase letters indicate statistical significance among groups (p < 0.05).

[0151] 2. Experimental results

[0152] 1) Effects of MIP and E-MIP on mouse body weight, liver, kidney, spleen indexes, and fasting blood glucose

[0153] As Figure 9In Figure A, before the start of the experiment, the body weights of mice in each group were similar. After 8 weeks of feeding, the body weights of all groups showed an upward trend. The body weight gain in the MC group was significantly higher than that in other groups. Although the polysaccharide group also used a high-fat diet as the daily ration, the process of weight gain was similar to that in the NC group, indicating that Morchella polysaccharide has a good effect on reducing weight gain caused by a high-fat diet. From Figure 9 As can be seen from Figure B, the weight gain amounts of each group during the experiment were NC (5.57±0.74bg), MC (8.04±0.71a g), L-MIP (5.19±0.81bc g), H-MIP (4.85±0.49c g), L-EMIP (4.92±0.61bc g), and H-EMIP (4.90±0.72bc g), respectively. The weight gain of mice in the MC group was significantly higher than that in other groups (p<0.05). Except for the high-dose MIP group, there was no significant difference between other polysaccharide groups and the normal group, indicating that the high-dose MIP had the best effect on reducing body weight.

[0154] The effect of Morchella polysaccharide on the organ index of high-fat diet mice is shown in Figure 9 Figure C. A high-fat diet increased the liver ratio of mice, and intragastric administration of polysaccharide could significantly restore the liver state of mice. From Figure 9 As can be seen from Figure D, the intervention of polysaccharide significantly reduced the fasting blood glucose index of high-fat diet mice, and the effect of EMIP was better than that of MIP.

[0155] 2) Effects of MIP and E-MIP on improving serum lipid levels in high-fat diet mice

[0156] After 8 weeks of feeding with a high-fat diet, the amount of TC in the serum of mice increased from 4.39 mM to 5.97 mM, and the intervention of Morchella polysaccharide significantly reduced the content of TC in the serum of mice ( Figure 10 Figure A); a high-fat diet increased the contents of TG and LDL-C in the serum of mice to 1.68 times and 2.28 times that of the normal group (NC) respectively, and intragastric administration of Morchella polysaccharide could significantly improve this pathological change. For the reduction of TG, the effect of EMIP was more prominent, and the effect of the low dose alone reached that of the high dose of MIP ( Figure 10 Figure B); but for the reduction of the content of LDL-C, the effect of MIP was a little better ( Figure 10 Figure C). As can be seen from Figure 10 Figure D, a high-fat diet significantly reduced the level of HDL-C in the serum of mice, while MIP and EMIP significantly increased the level of HDL-C, and showed a dose-dependent relationship, and the effect of EMIP was better.

[0157] As Figure 10In Figures E and F, as the polysaccharide concentration increased, the ratios of TC / HDL-C and LDL-C / HDL-C both decreased significantly, and the effect of EMIP was significantly better than that of MIP. Considering the above blood lipid indicators, the lipid-lowering effect of EMIP is stronger than that of MIP.

[0158] 3) Effects of MIP and E-MIP on improving liver lipid levels and fat accumulation in high-fat diet mice

[0159] As can be seen from Figure 11 it, the contents of TC, TG, and LDL-C in the livers of mice in the MC group were significantly higher than those in the NC group, indicating that high-fat diet caused severe lipid deposition in the livers of mice. The intake of MIP and EMIP could alleviate the symptoms of high-fat diet mice, and polysaccharides could also increase the HDL-C level in mice and relieve the disorder of liver lipid metabolism.

[0160] As shown in the liver H&E sections Figure 12 high-fat diet would cause a large amount of lipid accumulation in the body, and the liver's inability to transport excess lipids in time would result in fat deposition in liver tissue. It can be observed from the figure that there were a large number of lipid droplets in the livers of mice in the MC group, the arrangement of hepatocytes was disordered, the cell nucleus was squeezed to one side by the enlarged fat and atrophied or dissolved, and a large area of inflammatory infiltration was visible, indicating that the liver fat deposition and inflammatory response caused by high-fat diet were very serious. By ingesting different doses of polysaccharides, the liver fat deposition in mice could be improved to varying degrees. Low-dose MIP reduced lipid droplets, but the inflammatory infiltration was not much improved, while high-dose MIP effectively reduced lipid droplets and alleviated inflammatory infiltration; the effect of L-EMIP on reducing lipid droplets was similar to that of H-MIP, and the hepatic plates were radial. There were almost no lipid droplets in the livers of mice intervened with high-dose EMIP, and the edges of hepatocytes were clear, approaching the normal group. The above results indicate that EMIP can effectively reduce liver fat deposition in high-fat diet mice.

[0161] 4) Effects of MIP and E-MIP on improving liver injury in high-fat diet mice

[0162] As can be seen from Figure 13 it, high-fat diet significantly increased the levels of ALT, AST, and TBA in the serum and livers of mice (p<0.05), but EMIP inhibited the changes caused by high-fat diet in mice to varying degrees, and at the same concentration, EMIP showed a stronger inhibitory ability than MIP.

[0163] 5) Effects of MIP and E-MIP on improving liver oxidative stress in high-fat diet mice

[0164] As Figure 13, a high-fat diet led to a significant increase in the MDA level in the livers of mice, while reducing the activities of antioxidant enzymes SOD, GSH-Px, and CAT. MIP and EMIP can enhance the antioxidant capacity of the livers of mice by increasing the level of antioxidant enzymes and reducing the MDA content, showing significant differences compared with the MC group (p<0.05).

[0165] 6) Effects of MIP and E-MIP on improving inflammation and intestinal permeability in high-fat diet mice

[0166] As Figure 14 shown, the intake of MIP and EMIP can reduce the contents of LPS, TNF-α, and IL-6 in the serum, improve the LPS leakage and inflammatory state caused by a high-fat diet. At the same time, EMIP can also significantly increase the mRNA expression of intestinal tight junction proteins ZO-1, Occludin, and Claudin-1, protect the intestinal mucosal barrier, and maintain the integrity of intestinal function.

[0167] Example 4. Effects of enzymatically hydrolyzed polysaccharides from Morchella esculenta on the intestinal flora and liver metabolites of high-fat diet mice

[0168] The feces and liver tissues of the mice collected in Example 3 were used.

[0169] The fecal DNA extraction kit was purchased from Beijing Novogene Bioinformatics Technology Co., Ltd.; the mass spectrometer was purchased from ThermoFisher Q Exactive TM HF / Q Exactive TM HF-X; the chromatograph was purchased from Thermo Fisher Vanquish UHPLC, Thermo Fisher Hypesil Gold column; the chromatographic column (100×2.1mm, 1.9μm).

[0170] 1. Test method

[0171] 1) Intestinal flora analysis

[0172] The total DNA in the feces of mice was extracted using a fecal DNA extraction kit. The V3-V4 region of the 16S rRNA gene was amplified with reference to the method of Liu et al., and the amplified product was sequenced using NovaSeq6000.

[0173] 2) Liver untargeted metabolomics analysis

[0174] Metabolites in mouse liver tissue were extracted and detected by LC-MS. The chromatographic column was Hypersil Gold column (C18), and the column temperature and flow rate were 40°C and 0.2 mL / min, respectively. In positive ion mode, 0.1% formic acid was used as mobile phase A and methanol was used as mobile phase B; in negative ion mode, 5 mM ammonium acetate was used as mobile phase A and methanol was used as mobile phase B; the scanning range was m / z 100-1500; the ESI source settings were as follows: spray voltage: 3.5 kV; sheath gas flow rate: 35 psi; auxiliary gas flow rate: 10 L / min; ion transfer tube temperature (Capillary Temp): 320°C; ion introduction RF level (S-lens RF level): 60; auxiliary gas heater temperature (Aux gas heater temp): 350°C.

[0175] 3) Data statistics

[0176] The QIIME2 software was used to annotate 16S species, and the database was Silva 138.1. The obtained ASVs were analyzed by abundance, Alpha diversity calculation, and petal diagram to obtain information on species richness and uniformity within the sample, and information on common and unique ASVs between different groups. On the other hand, PCA was used to explore the differences in community structure between different groups. In order to further explore the differences in community structure between grouped samples, statistical analysis methods such as Simper and LEfSe were used to test the significance of differences in species composition and community structure of grouped samples.

[0177] The metabolite raw data files were imported into CD 3.3 search software for screening, and compared with mzCloud, mzVault and Masslist databases to obtain metabolite identification and relative quantification results. The data processing part was based on the Linux operating system (CentOS version 6.6) and software R and Python. The metabolites were annotated using the KEGG database. In the multivariate statistical analysis part, principal component analysis (PCA) and orthogonal partial least squares analysis (OPLS-DA) were performed using metaX, and the VIP value of each metabolite was obtained. In the univariate analysis part, the statistical significance (P value) of each metabolite between the two groups was calculated based on the t-test, and the fold change (FC value) of the metabolite between the two groups was calculated. The three parameters of the comprehensive metabolite VIP value, log2 (FoldChange) and -log10 (p value) were used to screen the differential metabolites. The obtained differential metabolites were subjected to hierarchical cluster analysis, correlation analysis and KEGG pathway enrichment analysis.

[0178] 2. Test Results

[0179] 1) Effects of MIP and EMIP on the Intestinal Microbial Diversity of Mice

[0180] Figure 15 The petal diagram in Figure A shows the overlap of OTUs among groups. There are a total of 60 OTUs. The number of unique OTUs in the NC group is 362, 131 in the MC group, 76 in the L-MIP group, 86 in the H-MIP group, 89 in the L-EMIP group, and 89 in the H-EMIP group. Alpha diversity can characterize the abundance and evenness of intestinal microorganisms. The Chao 1 index represents the number of OUTs in the sample; the Shannon index represents the species richness in the sample; the Simpson index represents the species distribution evenness in the sample. As Figure 15 shown in Figure B, a high-fat diet reduces the richness and diversity of intestinal microorganisms in mice, but the intervention with Morchella polysaccharide does not show an obvious improvement effect. Beta diversity can directly reflect the differences in species composition among different samples. It can be seen from the PCoA diagram ( Figure 15 Figure C) that there is a significant separation between the NC group and the MC group, and the groups of Morchella polysaccharide are distributed between the NC group and the MC group, indicating that the intervention with Morchella polysaccharide has a certain effect on the change of the flora structure caused by a high-fat diet. Therefore, further research can be carried out from the perspective of intestinal microorganisms.

[0181] 2) Effects of MIP and EMIP on the Intestinal Microbial Community Composition of Mice

[0182] Figure 16 Figures A and B respectively show the species abundance composition of mouse intestinal microorganisms at the phylum level and genus level. At the phylum level, the flora of each group is mainly composed of Firmicutes, Verrucomicrobia, Bacteroidetes, Deferribacteres, and Actinobacteria, which account for more than 99.3% of the intestinal flora. Since a high-fat diet will increase the F / B ratio in the intestinal flora, similar results also appeared in the test of the present invention, and supplementing high-dose EMIP can reverse this change.

[0183] Next, a species difference analysis was carried out between each group and the MC group at the genus level. From Figure 17 Figure A, the two genera with the largest contribution to the difference (contribution > 0.2) were selected, namely Akkermansia and Dubosiella; Figure 17Two families and two genera with significant differences between groups (LDA > 4) were screened out from Figure B, namely Lactobacilaceae, Lachnospiraceae, Lactobacillus, and Blautia. Among them, Lactobacillus belongs to Lactobacilaceae, and Blautia belongs to Lachnospiraceae. Many strains in the genus Lactobacillus play important roles in reducing lipid accumulation, alleviating oxidative stress, preventing intestinal inflammation, and lowering blood sugar. From Figure 17 Figure B, it can be observed that Morchella polysaccharide significantly increased the relative abundance of Lactobacillus, namely the L-MIP group (14.18%), the H-MIP group (10.05%), the L-EMIP group (3.07%), and the H-EMIP group (11.84%), while the relative abundance of Lactobacillus in the MC group of mice was only 0.29%. Wu et al. reported that Panax japonicus Torr. polysaccharide could improve the intestinal flora disorder induced by high-fat diet, mainly by reducing the abundances of Turicibacter, Dubosiella, and Staphylococcus and increasing the abundances of Bacteroides, Blautia, and Lactobacillus; while Xu et al.'s research showed that tartary buckwheat flavonoids alleviated the intestinal flora imbalance caused by high-fat diet by increasing the relative abundances of Dubosiella and Bacteroidetes; the association between Dubosiella and high-fat diet is still unclear. In this experiment, it was found that the relative abundance of Dubosiella in the MC group was increased compared with that in the NC group, and the intake of Morchella polysaccharide could regulate its abundance. The increase in the abundances of Akkermansia and Blautia is considered to be of great significance in reducing inflammation, enhancing immunity, lowering blood lipids and blood sugar, but Morchella intervention did not increase their abundances. Therefore, it is speculated that Morchella polysaccharide may alleviate the lipid metabolism disorder in high-fat diet mice by enriching Lactobacillus and inhibiting Dubosiella.

[0184] 3) PCA and PLS-DA analysis of liver metabolites

[0185] Liver tissues of mice in the NC group, MC group, H-MIP group, and H-EMIP group were collected for untargeted metabolomics analysis, and a total of 810 metabolites were identified. As Figure 18, the PCA plot (A) and OPLS-DA plot (B) were drawn using R language. The results of PCA and OPLS-DA were similar, both showing that the distance between the MC group and the H-MIP group was relatively close, indicating that H-MIP had no significant effect on the metabolite changes caused by high-fat diet; while the NC group and the H-EMIP group were distributed at both ends and had a good separation effect from the MC group, which indicated that there were significant differences in metabolites between them and the MC group; the QC samples were collected closely, indicating that LC-MS had good stability.

[0186] 4) Screening of differential metabolites in the liver

[0187] Figure 19 The results of differential metabolites between each group and the MC group were shown (VIP > 1, P < 0.05). 271, 39, and 236 differential metabolites were identified between the MC group and the NC group, the H-MIP group and the MC group, and the H-EMIP group and the MC group, respectively. Among them, high-fat diet led to a significant decrease in eicosapentaenoic acid (EPA), LPE(20:5), LPC(20:5-SN1), LPC(20:5), and 8-aminooctanoic acid in the livers of mice, and a significant increase in estradiol-17β-D-glucuronide, LPG(18:1), LPG(16:2), and cholest-4-en-3-one. EPA is an ω-3 fatty acid that can reduce the content of TG in serum and is used to prevent cardiovascular diseases; LPE(20:5) is a lysophosphatidylethanolamine. Some studies have shown that the activation of brown fat can cause a significant increase in the level of LPE(20:5) in plasma; both LPC(20:5-SN1) and LPC(20:5) belong to lysophosphatidylcholines. It has been found in lipid-lowering treatment that administration can increase the content of LPC(20:5) and its high-density lipoprotein level in the plasma of patients; 8-aminooctanoic acid is an octanoic acid with an amino group at the 8th position and belongs to medium-chain fatty acids. A number of studies have shown that octanoic acid can improve lipid metabolism in obese rats by promoting adipose tissue browning and increasing fat decomposition. However, the biological activity of 8-aminooctanoic acid has not been reported yet. Therefore, it can be used as a new potential biomarker waiting for further verification, and the AUC value of 1 indicates its good prediction effect ( Figure 19In the middle D figure). Estradiol-17-β-D-glucuronide has been shown to cause cholestasis in humans; both LPG(18:1) and LPG(16:2) are lysophosphatidylglycerols, and it has been reported that a decrease in plasma LPG is related to a reduction in fat mass in rats; Jin Fangsha constructed a mouse model of lipid metabolism disorder under BPA exposure and found that cholestenone was significantly upregulated in lipid-disordered mice. After H-MIP intervention, the levels of LPG(16:0) and LPG(16:2) in the mouse liver were significantly decreased, and the contents of 8-aminocaproic acid and reduced nicotinamide adenine dinucleotide phosphate (NADPH) were significantly increased. Gavage with H-EMIP significantly reduced cholestenone, LPG(18:1), and LPG(16:2) in the mouse liver, and significantly increased the levels of LPC(18:2-SN1), LPC(20:5-SN1), LPC(20:5), 8-aminocaproic acid, and NADPH. And NADPH plays an important role in the cellular antioxidant system and can scavenge ROS generated by the oxidative degradation of fat.

[0188] 5) Correlation analysis of liver differential metabolites with physiological indexes and intestinal flora

[0189] According to significance, 38 metabolites most likely to be biomarkers of the effect of Morchella polysaccharide on liver lipid metabolism were selected ( Figure 20 ), and correlation analysis was performed with the significantly different flora (2 families and 4 genera) and physiological indexes in each group ( Figure 21 ). The data showed that compared with the NC group, a high-fat diet upregulated 20 metabolites such as estradiol-17-β-D-glucuronide, LPG, adipic acid, cholestenone, 20-hydroxy eicosatetraenoic acid (20-HETE), acylcarnitine, and hydroxy acid in the mouse liver, and downregulated 18 metabolites such as inosine, phosphatidylcholine (PC), LPC, LPE, 20-hydroxy prostaglandin F2α (20hydroxy PGF2α), 5'-cytidine monophosphate (CMP), and hexosylceramide (HexCer 14:0; 3O / 18:1; (2OH)). After H-MIP and H-EMIP intervention, the levels of these metabolites approached the normal group to varying degrees. Among them, H-MIP mainly alleviated the liver oxidative stress in mice by increasing the levels of NADPH and NADH, while H-EMIP could improve the lipid metabolism disorder in mice by increasing the levels of LPC, inosine, hexosylceramide, and CMP, and decreasing the contents of LPG, 20-HETE, and cholestenone. At the same time, the levels of NADPH and NADH were also increased, indicating that H-EMIP has more diverse effects in regulating mouse lipid metabolism.

[0190] From Figure 21It can be seen that Blautia, Dubosiella and Lachnospiraceae are extremely positively correlated with 20-HETE, CAR 21:1, cholestenone, LPG 18:1, LPG 22:4 and LPS22:5, and extremely negatively correlated with 20-hydroxy PGF2α, 8-aminocaproic acid, LPC and LPE. Lactobacilaceae and Lactobacillus showed similar trends, negatively correlated with hydroxy acids and LPG, and positively correlated with NADH, NADPH and LPC. Some studies have shown that Lachnospiraceae is related to the development of non-alcoholic fatty liver and diabetes; Lactobacilaceae plays an important role in preventing diabetes and obesity, regulating lipid metabolism and inflammation. It is inferred that Morchella polysaccharide may affect liver metabolism and improve liver injury by changing the abundances of multiple gut microbes such as Lachnospiraceae and Lactobacilaceae.

[0191] The correlation analysis of the physiological indexes of mouse serum and liver with liver metabolites was carried out, and it was found that hydroxy acids, CAR21:1, cholestenone, estradiol-17-β-D-glucuronide, LPC 20:2, LPG were closely positively correlated with TC, TG, TBA, LDL-C, ALT, AST, MDA, LPS and TNF-α, while EPA, daidzein and other LPCs showed negative correlations. Therefore, reducing the contents of metabolites such as hydroxy acids and LPG by supplementing EMIP may help regulate the lipid levels of hyperlipidemic mice, reduce lipid peroxidation and inflammatory responses.

[0192] 6) KEGG metabolic pathway enrichment analysis

[0193] The screened differential metabolites were subjected to KEGG enrichment analysis, and the results are as Figure 22As shown. The main differential metabolic pathways between the MC group and the NC group are sulfur metabolism, ferroptosis, primary bile acid biosynthesis, arachidonic acid metabolism, and biosynthesis of unsaturated fatty acids. Ferroptosis is a death process driven by iron-dependent phospholipid peroxidation in cells and plays a key role in various disease processes. The regulation of biological lipid metabolism is inseparable from the regulation of ferroptosis. Primary bile acid synthesis, arachidonic acid metabolism, and unsaturated fatty acid synthesis are important metabolic processes in the glycolipid metabolism of organisms. Disorders in bile acid secretion can affect the digestion and absorption of lipids; arachidonic acid metabolites (such as prostaglandin G2, E2, D2, etc.) are related to inflammation, thrombosis, and atherosclerosis; unsaturated fatty acids such as EPA and docosapentaenoic acid (DPA) play important roles in promoting endothelial cell migration, reducing inflammation, and decreasing the triglyceride content in the blood. H-MIP mainly affects the calcium signaling pathway and amino acid metabolism in mice; the metabolites affected by H-EMIP are mainly enriched in pathways such as aldosterone synthesis and secretion, synaptic vesicle cycle, amino acid synthesis and metabolism. An increase in aldosterone content is positively correlated with the risk of atherosclerosis and can also lead to aggravated inflammatory infiltration. Extracellular vesicles play a key role in cell-to-cell communication. The lipid composition of vesicles can lead to their dysfunction. A high-fat diet promotes metabolic processes such as inflammation, insulin resistance, and obesity by affecting the structure and function of vesicles. Amino acids play important roles in lipid metabolism. Glycine inhibits the production of inflammatory cytokines by regulating genes related to adipose tissue storage and energy burning, improves the inflammatory condition in mice, and can also reduce fat accumulation and adipocyte hypertrophy in rats; threonine can lower blood lipids and inhibit fat gain, regulating lipid metabolism, while deficiencies in threonine and lysine can lead to fatty liver and various metabolic disorders. The results show that EMIP can affect lipid metabolism in mice by regulating the synthesis and metabolism of various amino acids, hormones, etc. and cell signal transduction.

Claims

1. Application of enzymatically hydrolyzed Morchella polysaccharide in regulating lipid metabolism disorder or preparing a product for regulating lipid metabolism disorder; The enzymatically hydrolyzed Morchella polysaccharide is prepared by a method comprising the following steps: The Morchella polysaccharide is enzymatically hydrolyzed with glucoamylase, and the obtained enzymatic hydrolysis product is successively inactivated, centrifuged, dialyzed, ethanol-precipitated, and freeze-dried to obtain the enzymatically hydrolyzed Morchella polysaccharide; The conditions for the enzymatic hydrolysis are as follows: The enzymatic hydrolysis temperature is 60 - 65 °C, the pH is 4.3 - 4.7, the enzyme addition amount is 45 - 55 U / mL, and the enzymatic hydrolysis time is 2.5 - 3.5 h.

2. The application according to claim 1, wherein: The product reduces the levels of total cholesterol, triglyceride, and low-density lipoprotein cholesterol in serum and / or increases the level of high-density lipoprotein cholesterol.

3. The application according to claim 1 or 2, characterized in that: The product reduces the levels of total cholesterol, triglyceride, and low-density lipoprotein cholesterol in liver tissue and / or increases the level of high-density lipoprotein cholesterol.

4. The application according to any one of claims 1-3, characterized in that: The product reduces liver fat deposition.

5. The application according to any one of claims 1-4, characterized in that: The product improves liver injury, oxidative stress, and / or intestinal permeability.

6. The application according to any one of claims 1-5, characterized in that: The product enriches Lactobacillus in the intestine and / or inhibits Dubosiella in the intestine.

7. The application according to any one of claims 1-6, characterized in that: The product regulates liver metabolites, specifically manifested as: 1) Up-regulating the levels of 8-aminooctanoic acid and NADPH; 2) Down-regulating the levels of lysophosphatidylglycerol and cholestenone.

8. Application of enzymatically hydrolyzed Morchella polysaccharide in preparing a product with any one of the following functions: 1) Reducing fat deposition; 2) Improving liver injury; 3) Reducing oxidative stress; 4) Regulating intestinal permeability.

9. Application of enzymatically hydrolyzed Morchella polysaccharide in preparing a product with any one of the following functions: 1) Enriching Lactobacillus in the intestine; 2) Inhibiting Dubosiella in the intestine; 3) Up-regulating the levels of 8-aminooctanoic acid and NADPH; 4) Down-regulating the levels of lysophosphatidylglycerol and cholestenone.

10. Application of 8-aminooctanoic acid as a biomarker for lipid metabolism disorder.

Images