Carbonyl reductase mutant and application thereof in enzymatic synthesis of chiral alcohol

Abstract

The invention relates to the technical field of biology, and discloses a carbonyl reductase mutant and application thereof in enzymatic synthesis of chiral alcohol. The amino acid sequence as shown in SEQ ID NO.2 is subjected to mutation that 36th lysine is mutated into any one of aspartic acid, threonine and valine, or / and 125th histidine is mutated into any one of lysine, serine and leucine, or 170th histidine is mutated into any one of lysine, cysteine and leucine. The carbonyl reductase mutants, especially single-site mutants Mut-T75K, Mut-T75D and Mut-E216M and a combined mutant Mut-T75K-E216M, with activity improved to different extents compared with that of a wild type are obtained, have excellent relative enzyme activity, thermal stability and substrate tolerance, have relatively high activity and stability for various chiral alcohols, and can be used for preparing the carbonyl reductase mutants. The catalyst has the advantages of high catalytic activity, high thermal stability, strong substrate tolerance, easiness in fermentation and the like.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a carbonyl reductase mutant and application thereof in enzymatic synthesis of chiral alcohols. Background Art

[0002] Chiral alcohols are a class of optically active alcohol compounds with one or more chiral centers in their molecular structure, rendering the molecule non-superimposable from its mirror image. Chiral alcohols are widely used in the asymmetric synthesis of pharmaceuticals, pesticides, fragrances, flavorings, and natural products. Carbonyl reductase-mediated biocatalytic asymmetric reduction is an important pathway for the synthesis of chiral alcohols.

[0003] Carbonyl reductase (Carbonyl Reductase, EC1.1.1.148), a member of the oxidoreductase family, uses the coenzyme NADPH (nicotinamide adenine dinucleotide phosphate) as a hydrogen donor to catalyze the reductive hydrogenation of a series of potential chiral ketones or aldehydes into the corresponding secondary alcohols. Carbonyl reductase can catalyze the asymmetric reduction of a series of carbonyl compounds under the condition that the coenzyme provides H. Its catalytic mechanism is as follows: carbonyl reductase first binds to the coenzyme to form a complex, then collides with the substrate, transferring hydrogen from the coenzyme to the carbonyl group of the oxidative substrate to form the corresponding chiral alcohol. At the same time, the coenzyme NAD(P)H is oxidized to NAD(P)+. Finally, the product is released from the enzyme-coenzyme complex, completing the catalytic process. The coenzyme NAD(P)H attacks the carbonyl carbon from different directions, resulting in products with different stereochemical configurations. When [H] on the C4 position of the NAD(P)H nicotinamide ring attacks the substrate carbonyl carbon from the Re-face, it follows the PRelog rule, generating an S-type product. However, when [H] attacks the substrate carbonyl carbon from the Si-face, it follows the anti-PRelog rule, generating an R-type product. Most carbonyl reductase-catalyzed reactions follow the PRelog rule.

[0004] Florfenicol is a widely used veterinary chloramphenicol antibiotic. (2S,3R)-p-methylsulfonylphenylserine ethyl ester (D-ethyl ester) and its analogs, key precursors for the synthesis of florfenicol, contain adjacent chiral centers, making their synthesis challenging. Currently, the industrial production of D-ethyl esters primarily relies on aldol condensation and L-(+)-tartaric acid resolution. This method produces copper ammonia wastewater and copper sulfide solid waste, and the chiral resolution yield is only 41%, resulting in poor atom economy and high production costs. A method for the asymmetric synthesis of D-ethyl esters and their analogs using carbonyl reductase-mediated kinetic resolution of p-methylsulfonylphenyl-α-amino-β-ketoester substrates could address the shortcomings of this traditional route.

[0005] Vibelong is the first β3-adrenergic receptor agonist (β3-AR agonist) drug used to treat overactive bladder (OAB). Methyl (2S,3R)-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropanoate ((2S,3R)-aminohydroxy ester) is a key chiral intermediate in the synthesis of Vibelong. In the prior art, a coupling system of NADPH-dependent carbonyl reductase KRED and glucose dehydrogenase GDH was constructed, and methyl (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropionate (methyl (S)-2-((tert-butoxycaRbonyl)amino) The asymmetric reduction of (S)-aminoketoester (2S,3R)-aminohydroxyester (2S,3R) was performed with a substrate concentration of 85 g / L and a cosubstrate glucose concentration of 70 g / L. After 4 hours of reaction, the product yield was >95.0% and the ee was >99.9%. However, the yield of chiral alcohols synthesized by this enzymatic asymmetric reduction reaction was relatively low.

[0006] In addition, the key chiral intermediates of 5-hydroxytryptamine norepinephrine re-extraction inhibitor duloxetine (Duloxetine) (Ethyl (S)-3-hydroxy-3-(2-thienyl) propionate (Ethyl (S)-3-hydRoxy-3-(thiophen-2-yl) pRopanoate, (S)-HEES), the key chiral intermediates of selective HMG-CoA reductase inhibitor rosuvastatin (RoSuvaStatin) (3R, 5S) The carbonyl reductase-catalyzed asymmetric synthesis of (3R,5S)-CDHH, such as tert-butyl-6-chloro-3,5-dihydroxyhexanoate (tert-Butyl(3R,5S)-6-chloRo-3,5-dihydRoxyh-exanoate, (3R,5S)-CDHH) and (3R,5R)-tert-butyl-6-cyano-3,5-dihydroxyhexanoate, a key chiral intermediate of the lipid-lowering drug atorvastatin, is also an important challenge in the field of green biomanufacturing of pharmaceutical chemicals.

[0007] Currently, the yield of the above key chiral intermediates synthesized by biocatalytic asymmetric reduction reactions mediated by carbonyl reductase is low. Carbonyl reductase is a versatile biocatalyst with a broad substrate spectrum, but its low thermal stability limits its application. Summary of the Invention

[0008] In order to solve the technical problem of low yield in the synthesis of chiral alcohols mediated by carbonyl reductase, the present invention provides a carbonyl reductase mutant and its application in the enzymatic synthesis of chiral alcohols.

[0009] The specific technical solutions of the present invention are: In a first aspect, the present invention provides a recombinant carbonyl reductase mutant, which is obtained by subjecting the amino acid sequence shown in SEQ ID NO. 2 to single point mutation or multiple point combination mutation at the following sites: Threonine at position 75 is mutated to any of lysine, leucine, or aspartic acid; The glutamic acid at position 216 is mutated to any one of methionine, serine, and lysine.

[0010] In a second aspect, the present invention provides a gene encoding the above-mentioned carbonyl reductase mutant.

[0011] In a third aspect, the present invention provides an expression vector comprising the above-mentioned encoding gene.

[0012] Preferably, the expression vector is a plasmid, phage or viral vector.

[0013] In a fourth aspect, the present invention provides a cloning vector of the above-mentioned encoding gene.

[0014] In a fifth aspect, the present invention provides the above-mentioned carbonyl reductase mutant or the host cell encoding the above-mentioned gene.

[0015] Preferably, the cell is Escherichia coli.

[0016] In a sixth aspect, the present invention provides use of the above carbonyl reductase mutant in the synthesis of chiral alcohols.

[0017] The corresponding chiral alcohol can be prepared by biocatalysis using a potential chiral ketone as a substrate and wet cells obtained by fermentation culture of a genetically engineered bacterium containing the above-mentioned recombinant carbonyl reductase mutant encoding gene, or a crude enzyme or pure enzyme after ultrasonic disruption of the wet cells as a catalyst.

[0018] Preferably, the chiral alcohol is a duloxetine intermediate, a florfenicol intermediate, a rosuvastatin intermediate, an atorvastatin intermediate, or a vibelong intermediate. The corresponding prochiral ketones may include: methyl (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropionate, methyl 2-acetylamino-3-(4-(methylsulfonyl)phenyl)-3-oxopropionate, ethyl 3-oxo-3-(2-thienyl)propionate, tert-butyl (S)-6-chloro-5-hydroxy-3-carbonylhexanoate ((S)-CHOH), and tert-butyl 6-cyano-5(R)-hydroxy-3-oxohexanoate.

[0019] More specifically: The application includes: using wet bacteria obtained by fermentation and culture of genetically engineered bacteria containing a gene encoding a novel carbonyl reductase mutant, or a crude enzyme liquid after crushing the wet bacteria, or a pure enzyme extracted after crushing the wet bacteria as a catalyst, and 2-acetylamino-3-(4-(methylsulfonyl)phenyl)-3-oxopropionic acid methyl ester to biocatalytically prepare (2S,3R)-2-acetylamino-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propionic acid methyl ester, which is a key chiral intermediate in the synthesis of the drug florfenicol.

[0020] The application includes using wet cells obtained by fermentation and culture of genetically engineered bacteria containing a gene encoding a novel carbonyl reductase mutant, crude enzyme liquid obtained after crushing the wet cells, or pure enzyme extracted after crushing the wet cells as a catalyst, and ethyl 3-oxo-2-(3-thienyl)propionate (KEES) as a substrate to biocatalytically prepare (S)-ethyl 3-hydroxy-3-(2-thienyl)propionate ((S)-HEES). (S)-HEES is a key chiral intermediate in the synthesis of the drug (S)-duloxetine.

[0021] The application includes using wet cells obtained by fermentation and culture of genetically engineered bacteria containing a gene encoding a novel carbonyl reductase mutant, crude enzyme liquid obtained after crushing the wet cells, or pure enzyme extracted after crushing the wet cells as a catalyst, and (S)-6-chloro-5-hydroxy-3-hydroxyhexanoic acid tert-butyl ester ((S)-CHOH) as a substrate to biocatalytically prepare (3R,5S)-6-chloro-3,5-dihydroxyhexanoic acid tert-butyl ester ((3R,5S)-CDHH). (3R,5S)-CDHH is a key chiral intermediate in the synthesis of the drug rosuvastatin.

[0022] The application includes: using wet cells obtained by fermentation and culture of genetically engineered bacteria containing a gene encoding a novel carbonyl reductase mutant, or a crude enzyme solution obtained after crushing the wet cells, or a pure enzyme extracted after crushing the wet cells as a catalyst, and tert-butyl 6-cyano-5(R)-hydroxy-3-oxohexanoate as a substrate, to biocatalytically prepare tert-butyl (3R,5R)-6-cyano-3,5-dihydroxyhexanoate, a key chiral intermediate in the synthesis of the drug atorvastatin.

[0023] The application includes: using wet bacteria obtained by fermentation and culture of genetically engineered bacteria containing a gene encoding a novel carbonyl reductase mutant, or a crude enzyme liquid after crushing the wet bacteria, or a pure enzyme extracted after crushing the wet bacteria as a catalyst, and using (S)-2-((tert-butoxycarbonyl)amino)-3-oxo-3-phenylpropionic acid methyl ester ((S)-amino ketoester) as a substrate, to biocatalytically prepare (2S,3R)-2-((tert-butoxycarbonyl)amino)-3-hydroxy-3-phenylpropionic acid methyl ester ((2S,3R)-aminohydroxy ester), where (2S,3R)-aminohydroxy ester is a key chiral intermediate in the synthesis of vibelone.

[0024] Compared with the prior art, the present invention has the following technical effects: The present invention obtains carbonyl reductase mutants having different degrees of improved activity compared to the wild type by mutating the amino acid sequence shown in SEQ ID NO. 2 by mutating the lysine at position 36 to any one of aspartic acid, threonine, and valine, and / or the histidine at position 125 to any one of lysine, serine, and leucine, or by mutating the histidine at position 170 to any one of lysine, cysteine, and leucine. The mutants, in particular the single-point mutants Mut-T75K, Mut-T75D, and Mut-E216M, and the combined mutant Mut-T75K-E216M, have excellent relative enzyme activity, thermal stability, and substrate tolerance, and have high activity and stability towards a variety of chiral alcohols. The mutants have the advantages of high catalytic activity, high thermal stability, strong substrate tolerance, and easy fermentation. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The figure is an SDS-PAGE diagram of carbonyl reductase and its mutants, wherein lane M is the protein molecular weight MaRkeR, lane 1 is the pure enzyme of the original strain WT of carbonyl reductase, lane 2 is the pure enzyme of Mut-T75K; lane 3 is the pure enzyme of Mut-E216M, and lane 4 is the pure enzyme of Mut-T75K-E216M. DETAILED DESCRIPTION

[0026] The present invention will be further described below with reference to the following embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only a portion of the embodiments of the present invention, rather than all of the embodiments. Therefore, all other embodiments derived by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0027] In the embodiment of the present invention, the amino acid sequence of the wild-type carbonyl reductase is shown in SEQ ID NO.2, and the encoding gene thereof is shown in SEQ ID NO.1.

[0028] Example 1 Construction of carbonyl reductase mutants (1) The wild-type carbonyl reductase encoding gene (nucleotide sequence as shown in SEQ ID NO.1) was connected to the expression vector pET28b to construct a heterologous expression recombinant plasmid pET28b(+)-WT containing the carbonyl reductase encoding gene, and the expression recombinant plasmid was transformed into the host bacteria E. coli BL21(DE3) competent cells to obtain the recombinant genetically engineered bacteria E. coli BL21(DE3) / pET28b(+)-WT containing the carbonyl reductase expression recombinant plasmid, i.e., the carbonyl reductase engineered bacteria.

[0029] After the carbonyl reductase engineered bacteria E. coli BL21 (DE3) / pET28b (+) -WT was thawed on ice, the bacterial solution was streaked onto a kanamycin-resistant LB plate and incubated at 37°C for 12 hours. A single colony was picked and inoculated into a 10 mL LB tube containing a final concentration of 50 mg / L kanamycin resistance. The culture was shaken at 37°C and 180 rpm for 7 hours before use. A 2 mL test tube of bacterial solution was inoculated into a 100 mL LB shake flask containing a final concentration of 50 mg / L kanamycin resistance. The culture was shaken at 37°C and 180 rpm for 2 hours. 100 μL of 0.1 M IPTG was added and the culture was shaken at 28°C and 180 rpm for 12 hours. The cells were collected by centrifugation at 4°C and 8000 rpm for 15 minutes and refrigerated at -20°C for later use.

[0030] (2) Using the prepared vector heterologous expression recombinant plasmid pET28b(+)-WT as a template, mutations were introduced by PCR using the site-directed mutagenesis primers shown in Table 1 below. In Table 1, the mutation sites are underlined in the primer sequences. Primers T75-R and T75K-F are used in PCR to mutate the threonine at position 75 of the wild-type enzyme to lysine, primers T75-R and T75L-F are used in PCR to mutate the threonine at position 75 of the wild-type enzyme to leucine, T75-R and T75D-F are used in PCR to mutate the threonine at position 75 of the wild-type enzyme to aspartic acid, E216-R and E216M-F are used in PCR to mutate the glutamate at position 216 of the wild-type enzyme to methionine, E216-R and E216S-F are used in PCR to mutate the glutamate at position 216 of the wild-type enzyme to serine, and E216-R and E216K-F are used in PCR to mutate the glutamate at position 216 of the wild-type enzyme to lysine.

[0031] Table 1 Primers Sequence 5′-3′ T75K-F <![CDATA[TGAAAGCCTG AAG AATCTGGATATTGAA]]> T75L-F <![CDATA[TGAAAGCCTG CTA AATCTGGATATTGAA]]> T75D-F <![CDATA[TGAAAGCCTG GAC AATCTGGATATTGAA]]> T75-R CAGGCTTTCATACAGTGCGTAAACATTT E216M-F <![CDATA[AAATGGCA ATG TTTCTGTATCAGCTGTT]]> E216S-F <![CDATA[AAATGGCA AGC TTTCTGTATCAGCTGTT]]> E216K-F <![CDATA[AAATGGCA AAA TTTCTGTATCAGCTGTT]]> E216-R TGCCATTTCACGCGCGGTGTGATATTTC The PCR reaction program for introducing mutations by PCR was as follows: 98°C for 10 min, 98°C for 30 s, 56°C for 30 s, 72°C for 3 min 40 s, repeated for 31 cycles; and further extension at 72°C for 5 min.

[0032] The PCR product was treated with DpnI at 37°C for 3 hours, inactivated, and then transformed into E. coli BL21 (DE3) recipient bacteria. It was spread on LB solid plates containing a final concentration of 50 mg / L kanamycin resistance. After incubation at 37°C for 12 hours, single colonies were randomly picked for sequencing analysis and confirmation to obtain each carbonyl reductase mutant and its wet cell.

[0033] Among them, the mutant enzyme in which the threonine at position 75 of the wild-type enzyme was mutated to lysine was recorded as Mut-T75K, the mutant enzyme in which the threonine at position 75 of the wild-type enzyme was mutated to leucine was recorded as Mut-T75L, the mutant enzyme in which the threonine at position 75 of the wild-type enzyme was mutated to aspartic acid was recorded as Mut-T75D, the mutant enzyme in which the glutamate at position 216 of the wild-type enzyme was mutated to methionine was recorded as Mut-E216M, the mutant enzyme in which the glutamate at position 216 of the wild-type enzyme was mutated to serine was recorded as Mut-E216S, and the mutant enzyme in which the glutamate at position 216 of the wild-type enzyme was mutated to lysine was recorded as Mut-E216K.

[0034] (3) Using plasmid DNA containing the Mut-T75K gene as a template, mutations were introduced by PCR. The combination of mutation primers is as follows (the underlined position is the mutation site):

[0035] The PCR reaction procedure for introducing mutations by PCR was the same as in step (2), resulting in the recombinant carbonyl reductase combination mutant Mut-T75K-E216M and its wet cell. The nucleotide sequence of the mutant Mut-T75K-E216M is shown in SEQ ID NO. 3, and the amino acid sequence is shown in SEQ ID NO. 4.

[0036] (4) Using plasmid DNA containing the Mut-T75K gene as a template, mutations were introduced by PCR. The combination of mutation primers is as follows (the underlined position is the mutation site):

[0037] The PCR reaction procedure for introducing mutations by PCR was the same as step (2), and the recombinant carbonyl reductase combination mutant Mut-T75K-E216K and its wet bacteria were obtained.

[0038] like Figure 1 Shown is the SDS-PAGE image of the above-mentioned wild-type carbonyl reductase and its mutants. Figure 1In the figure, lane M is the protein molecular weight MaRkeR, lane 1 is the pure enzyme of the original strain WT of carbonyl reductase, lane 2 is the pure enzyme of Mut-T75K; lane 3 is the pure enzyme of Mut-E216M, and lane 4 is the pure enzyme of Mut-T75K-E216M.

[0039] Example 2 Screening of highly thermostable carbonyl reductase mutants The carbonyl reductase mutant obtained in Example 1 was subjected to residual enzyme activity assay analysis. After incubation at 35°C for 24 hours and at 50°C for 1 hour, the residual enzyme activity was measured to determine the optimal mutant. The steps are as follows: (1) Preparation of crude enzyme solution: The strain containing the carbonyl reductase mutant encoding gene obtained in Example 1 was inoculated into LB liquid medium containing a final concentration of 50 mg / L kanamycin resistance, cultured at 37°C and 180 rpm for 7 h, and then inoculated into fresh LB liquid medium containing a final concentration of 50 mg / L kanamycin resistance at a volume concentration of 2% inoculum, cultured at 37°C and 180 rpm for 2 h, induced by adding 100 μL of 0.1 M IPTG, and cultured at 28°C and 180 rpm for 12 h. The culture was centrifuged at 4°C and 8000 rpm for 15 min, the supernatant was discarded, and the wet cells were collected. 125 mg of the wet cells of the mutant were weighed, resuspended in 10 mL of sodium phosphate buffer, and ultrasonically disrupted in an ice bath at 4°C until the cell solution was clear (220W, continuous 1 s, stop 2s), and each crude enzyme solution after disruption was incubated at 35°C for 24 h and at 50°C for 1 h.

[0040] (2) 500 μL reaction system: 150 μL NADP + , 50 μL glucose, 50 μL crude enzyme solution incubated at 35°C for 24 hours, 100 μL substrate (S)-aminoketoester mother liquor, add sodium phosphate buffer to 500 μL, shake at 1100 Rpm, react in a shaking reactor at 35°C, and take samples immediately after 10 minutes of reaction. The concentration of the mother liquor substrate (S)-aminoketoester is 50 g / L (solvent is dimethyl sulfoxide), the concentration of the mother liquor cosubstrate glucose is 180 g / L (solvent is sodium phosphate buffer), and the mother liquor coenzyme NADP is 100 g / L. + The concentration was 1 g / L (solvent: sodium phosphate buffer). The yield of (2S,3R)-aminohydroxy ester was determined by HPLC analysis, and the relative enzyme activity was calculated. The initial enzyme activity of each mutant was set as 100%, and the residual enzyme activity after a certain period of incubation is shown in Table 2.

[0041] (3) 500 μL reaction system: 150 μL NADP +, 50 μL glucose, 50 μL crude enzyme solution incubated at 50°C for 1 hour, 100 μL substrate (S)-aminoketoester mother solution, add sodium phosphate buffer to 500 μL, shake at 1100 Rpm, react in a shaking reactor at 50°C, and take samples immediately after 10 minutes of reaction. The concentration of the mother solution substrate (S)-aminoketoester is 50 g / L (solvent is dimethyl sulfoxide), the concentration of the mother solution cosubstrate glucose is 180 g / L (solvent is sodium phosphate buffer), and the mother solution coenzyme NADP is 180 g / L. + The concentration was 1 g / L (solvent: sodium phosphate buffer). The yield of (2S,3R)-aminohydroxy ester was determined by HPLC analysis, and the relative enzyme activity was calculated. The initial enzyme activity of each mutant was set as 100%, and the residual enzyme activity after a certain period of incubation is shown in Table 2.

[0042] Table 2 Comparison of residual enzyme activity enzymes Remaining enzyme activity after incubation at 35℃ for 24h (%) Remaining enzyme activity (%) after incubation at 50℃ for 1h wild type 36.89 1.75 Mut-T75K 89.21 68.95 Mut-T75L 75.86 57.56 Mut-T75D 77.32 58.79 Mut-E216M 55.65 19.81 Mut-E216S 43.62 12.50 Mut-E216K 48.57 11.65 Mut-T75K-E216K 53.23 12.36 Mut-T75K-E216M 91.61 78.67 As shown in the residual enzyme activity determination results in Table 2, Example 1 improved the stability of carbonyl reductase through site-directed mutagenesis. The optimal single mutant was Mut-T75K, and the optimal mutant obtained after combined mutations at different mutation sites was Mut-T75K-E216M. In addition, the single mutants Mut-T75D and Mut-E216M also had good thermal stability.

[0043] From the determination results of the residual enzyme activity in Table 2, it can be seen that the carbonyl reductase mutants Mut-T75K, Mut-T75D, and Mut-T75K-E216M not only have improved catalytic activities, but also have greatly improved thermal stability.

[0044] Example 3 Determination of relative enzyme activity of carbonyl reductase mutants The relative enzyme activity of the carbonyl reductase mutant obtained in Example 1 was determined as follows: (1) Preparation of crude enzyme solution: The method is the same as that in Example 2.

[0045] (2) 500 μL reaction system: 150 μL NADP + , 50 μL glucose, 50 μL crude enzyme solution incubated at 35°C for 24 hours, 100 μL substrate (S)-aminoketoester mother liquor, add sodium phosphate buffer to 500 μL, shake at 1100 Rpm, react in a shaking reactor at 35°C, and take samples immediately after 10 minutes of reaction. The concentration of the mother liquor substrate (S)-aminoketoester is 50 g / L (solvent is dimethyl sulfoxide), the concentration of the mother liquor cosubstrate glucose is 180 g / L (solvent is sodium phosphate buffer), and the mother liquor coenzyme NADP is 100 g / L. +The concentration was 1 g / L (the solvent was sodium phosphate buffer). The yield of (2S,3R)-aminohydroxy ester was determined by HPLC analysis and the relative enzyme activity was calculated. The results are shown in Table 3.

[0046] Table 3 Comparison of relative enzyme activities enzymes Relative enzyme activity (100%) wild type 100.00 Mut-T75K 111.55 Mut-T75L 102.31 Mut-T75D 101.79 Mut-E216M 105.65 Mut-E216S 98.51 Mut-E216K 95.59 Mut-T75K-E216M 99.56 Mut-T75K-E216M 116.55 From the relative enzyme activity determination results in Table 3, it can be seen that Example 1 improved the stability of carbonyl reductase by site-directed mutagenesis technology, and the relative enzyme activities of the mutants Mut-T75K, Mut-E216M, and Mut-T75K-E216M were better.

[0047] Example 4 Application of carbonyl reductase mutants in the preparation of florfenicol intermediates Single-point mutants Mut-T75K, Mut-E216M, and the combined mutant Mut-T75K-E216M with superior thermal stability were selected for use in the preparation of florfenicol intermediates. The specific steps are as follows: The composition and catalytic conditions of the catalytic system are as follows: 100 mM potassium phosphate buffer solution, pH 7.0, DMSO (20%) as a cosolvent, crude carbonyl reductase solution (20 g / L, prepared in the same manner as in Example 2) and glucose dehydrogenase (10 g / L), 200 mM glucose, NADP-HCl, 1% HCl, 1% HCl, 2 ... + 2 g / L, substrate 2-acetylamino-3-(4-(methylsulfonyl)phenyl)-3-oxopropanoic acid methyl ester 100 g / L, and sodium phosphate buffer was used to make up to 20 mL.

[0048] The reaction system was placed in a 35°C water bath with a magnetic stirrer at 600 rpm for 24 hours. Samples of 200 μL were taken periodically during the reaction, separated and purified, and diluted 100-fold with pure acetonitrile. The conversion rate was determined by HPLC.

[0049] The results showed that after 24 hours of catalysis, the yield of WT catalyzed the production of methyl (2S,3R)-2-acetylamino-3-hydroxy-3-(4-(methylsulfonyl)phenyl)propionate reached 76.9%, ee>99%; Mut-T75K reached 92.1%, ee>99%; Mut-E216M reached 87.2%, ee>99%; Mut-T75K-E216M reached 99.2%, ee>99%.

[0050] Example 5 Application of carbonyl reductase mutants in the preparation of duloxetine intermediates Single-point mutants Mut-T75K and Mut-E216M, as well as the combined mutant Mut-T75K-E216M, with superior thermal stability, were selected for use in the preparation of duloxetine intermediates. The specific steps are as follows: The composition and catalytic conditions of the catalytic system are as follows: 20 mL reaction system: crude enzyme solution (prepared in the same manner as in Example 2) weighed 20 g / L, substrate KEES 150 g / L, cosubstrate glucose 100 mM (solvent: sodium phosphate buffer), glucose dehydrogenase (dosage: 10 g / L), coenzyme NADP + The concentration is 3 g / L (the solvent is sodium phosphate buffer). Use sodium phosphate buffer to make up to 20 mL.

[0051] The reaction system was placed in a 35°C water bath with a magnetic stirrer at 600 Rpm. Samples were taken at regular intervals for 24 hours, with a sample volume of 200 μL. After separation and purification, the sample was diluted 100 times with pure acetonitrile and the conversion rate was determined by HPLC analysis.

[0052] The results showed that after 24 hours of catalysis, the yield of (S)-HEES produced by WT reached 84.9%, ee>99%; Mut-T75K reached 90.1%, ee>99%; Mut-E216M reached 89.8%, ee>99%; Mut-T75K-E216M reached 98.8%, ee>99%.

[0053] Example 6 Application of Carbonyl Reductase Mutants in the Preparation of Rosuvastatin Intermediates Single-point mutants Mut-T75K, Mut-E216M, and the combined mutant Mut-T75K-E216M with superior thermal stability were selected for use in the preparation of rosuvastatin intermediates. The specific steps are as follows: The composition and catalytic conditions of the catalytic system are as follows: 20 mL reaction system: crude enzyme solution (prepared in the same manner as in Example 2) weighed 20 g / L, substrate (S)-CHOH 150 g / L, cosubstrate glucose 100 mM (solvent: sodium phosphate buffer), glucose dehydrogenase (dosage: 10 g / L), coenzyme NADP + The concentration is 3 g / L (the solvent is sodium phosphate buffer). Use sodium phosphate buffer to make up to 20 mL.

[0054] The reaction system was placed in a 35°C water bath with a magnetic stirrer at 600 Rpm. Samples were taken regularly after 24 hours of reaction, with a sample volume of 200 μL. After separation and purification, the product was diluted 40 times with 30% acetonitrile and the conversion rate was determined by HPLC analysis.

[0055] The results showed that after 24 hours of catalysis, the yield of (3R,5S)-CDHH produced by WT reached 86.9%, ee>99%; Mut-T75K reached 95.8%, ee>99%; Mut-E216M reached 94.9%, ee>99%; Mut-T75K-E216M reached 99.8%, ee>99%.

[0056] Example 7 Application of Carbonyl Reductase Mutants in the Preparation of Atorvastatin Intermediates Single-point mutants Mut-T75K, Mut-E216M, and the combined mutant Mut-T75K-E216M with superior thermal stability were selected for use in the preparation of atorvastatin intermediates. The specific steps are as follows: The composition and catalytic conditions of the catalytic system are as follows: 20 mL reaction system: 20 g / L of crude enzyme solution (prepared by the same method as in Example 2), 150 g / L of substrate 6-cyano-5(R)-hydroxy-3-oxohexanoic acid tert-butyl ester, 100 mM of cosubstrate glucose (solvent: sodium phosphate buffer), 10 g / L of glucose dehydrogenase, and 100 mM of coenzyme NADP. + The concentration is 3 g / L (the solvent is sodium phosphate buffer). Use sodium phosphate buffer to make up to 20 mL.

[0057] The reaction system was placed in a 35°C water bath with a magnetic stirrer at 600 rpm. After 24 hours of reaction, samples were taken periodically. The samples were separated and purified, diluted 100-fold with acetonitrile, and the conversion was determined by HPLC. The results showed that after 24 hours of catalysis, the yield of tert-butyl (3R,5R)-6-cyano-3,5-dihydroxyhexanoate reached 80.2% with an ee >99% for WT; 90.8% with an ee >99% for Mut-T75K; 88.5% with an ee >99% for Mut-E216M; and 99.8% with an ee >99% for Mut-T75K-E216M.

[0058] Example 8 Application of carbonyl reductase mutants in the preparation of Vibelone intermediates Single-point mutants Mut-T75K and Mut-E216M, as well as the combined mutant Mut-T75K-E216M, with superior thermal stability, were selected for use in the preparation of Vibelon intermediates. The specific steps are as follows: The catalytic system composition and catalytic conditions are as follows: 20 mL reaction system: Dissolve the substrate (S)-aminoketoester in 10 mL of n-butyl acetate (final concentration of 100 g / L), add 1 mL of 0.1 mM, pH 6.5 NaH2PO4-Na2HPO4 buffer solution, add crude enzyme solution (final concentration of 20 g / L, prepared the same way as in Example 2), add 2 mL of crude glucose dehydrogenase solution (final concentration of 10 g / L), add 100 mg of coenzyme NADPH, and 2.63 g of cosubstrate glucose. Make up to 20 mL with sodium phosphate buffer.

[0059] The reaction system was placed in a 35°C water bath with a magnetic stirrer at 600 Rpm. Samples were taken at regular intervals during the reaction, with a sample volume of 200 μL. After separation and purification, the sample was diluted 100 times with pure acetonitrile and the conversion rate was determined by HPLC analysis.

[0060] The results showed that after 24 hours of catalysis, the yield of (2S,3R)-aminohydroxy ester produced by WT reached 89.2%, ee>99%; Mut-T75K reached 94.2%, ee>99%; Mut-E216M reached 91.1%, ee>99%; Mut-T75K-E216M reached 99.7%, ee>99%.

[0061] Example 9 Effect of the fed-batch process on the preparation of Viberon intermediates using carbonyl reductase mutants Single-point mutants Mut-T75K and Mut-E216M, as well as the combined mutant Mut-T75K-E216M, with superior thermal stability, were selected and applied to the fed-batch process to prepare Viberon intermediates. The specific steps are as follows: (1) 20 mL reaction system: Dissolve the substrate (S)-aminoketoester in 10 mL of n-butyl acetate (final concentration 80 g / L), add 1 mL of 0.1 mM NaH2PO4-Na2HPO4 buffer solution, pH 6.5, add crude enzyme solution (final concentration 20 g / L), glucose dehydrogenase (final concentration 10 g / L), 100 mg of coenzyme NADPH, and 2.63 g of cosubstrate glucose. Make up to 20 mL with sodium phosphate buffer.

[0062] The reaction system was placed in a 35°C water bath with a magnetic stirrer at 600 Rpm. After 8 h, 1.4 g of substrate was added as feed (the total substrate input concentration after feeding was 150 g / L). Samples were taken at regular intervals during the reaction with a sample volume of 200 μL. After separation and purification, the sample was diluted 150 times with pure acetonitrile and the conversion rate was determined by HPLC analysis.

[0063] The results showed that after 24 hours of catalysis, the yield of (2S,3R)-aminohydroxy ester catalytically produced by WT reached 89.5%, ee>99%; Mut-T75K reached 96.2%, ee>99%; Mut-E216M reached 92.1%, ee>99%; Mut-T75K-E216M reached 99.8%, ee>99%.

[0064] (2) 500 mL reaction system: Dissolve the substrate (S)-aminoketoester in 10 mL of n-butyl acetate (final concentration of (S)-aminoketoester is 80 g / L), add crude enzyme solution (final concentration is 20 g / L), glucose dehydrogenase (final concentration is 10 g / L), 3.0 g of coenzyme NADPH, and 35.5 g of cosubstrate glucose. Make up to 500 mL with sodium phosphate buffer.

[0065] The reaction system was placed in a 35°C water bath with a stirring device set to 600 Rpm. After 8 h, 35 g of substrate was added as feed (the total substrate input concentration after feeding was 150 g / L). Samples were taken at regular intervals during the reaction with a sample volume of 200 μL. After separation and purification, the sample was diluted 150 times with pure acetonitrile and the conversion rate was determined by HPLC analysis.

[0066] The results showed that after 24 hours of catalysis, the yield of (2S,3R)-aminohydroxy ester produced by WT reached 91.7%, ee>99%; Mut-T75K reached 97.5%, ee>99%; Mut-E216M reached 95.8%, ee>99%; Mut-T75K-E216M reached 99.9%, ee>99%. Compared with the non-fed-batch process, the fed-batch process further improves production efficiency.

[0067] Unless otherwise specified, the raw materials and equipment used in the present invention are commonly used in the art; the methods used in the present invention are conventional methods in the art unless otherwise specified.

[0068] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A carbonyl reductase mutant, characterized in that: It is obtained by performing single-site mutation or multi-site combined mutation at the following sites with the amino acid sequence shown in SEQ ID NO.2: The threonine at position 75 is mutated to any one of lysine, leucine, and aspartic acid; The glutamic acid at position 216 is mutated to any one of methionine, serine, and lysine.

2. The coding gene of the carbonyl reductase mutant according to claim 1.

3. An expression vector comprising the coding gene according to claim 2.

4. The expression vector according to claim 3, characterized in that: The expression vector is a plasmid, phage or viral vector.

5. A cloning vector comprising the coding gene according to claim 2.

6. A host cell comprising the carbonyl reductase mutant according to claim 1 or the coding gene according to claim 2.

7. The host cell according to claim 6, wherein: The cell is Escherichia coli.

8. The application of the carbonyl reductase mutant according to claim 1 in the synthesis of chiral alcohols.

9. The application according to claim 8, wherein: The chiral alcohol is duloxetine intermediate, florfenicol intermediate, rosuvastatin intermediate, atorvastatin intermediate, vibelon intermediate.

Images