Calabash wilt resistance mutation site, KASP labeled primer group, disease resistance detection method and application

Abstract

The invention provides a gourd fusarium wilt resistance mutation site, a KASP marker primer group, a disease resistance detection method and application, and belongs to the technical field of plant breeding. According to the invention, the wilt resistance is found to be recessive inheritance, then two parents are subjected to re-sequencing, differential sites are screened, and the like, so that the cucurbit wilt resistance related gene is found to be from C-G functional variation of the 25114519th site of the 4th exon of WAT1 homologous gene Lsi03G014160 specifically expressed at the root of a No.3 chromosome; the problem that the related gene for resisting wilt of the calabash is not found yet is solved. And according to the functional variation, a KASP labeled primer group SEQ ID NO.1-SEQ ID NO.3 capable of detecting the disease resistance of the gourd wilt is designed. The KASP primer group can be used for screening cucurbit fusarium wilt resistant materials and breeding varieties, has the characteristics of high efficiency, high accuracy and no pollution, and overcomes the problems of low breeding efficiency and high cost of cucurbit fusarium wilt resistant varieties in existing breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of plant breeding, and particularly relates to a Fusarium wilt resistance mutation site, a KASP marker primer set, a disease resistance detection method and an application thereof for gourds. Background Art

[0002] Gourds belong to the genus Lagenaria in the Cucurbitaceae family and are annual trailing herbs, widely cultivated in tropical and temperate regions. They have characteristics such as ornamental value, edibility, medicinal use and rootstock use. Since some gourds have strong disease resistance and stress tolerance, strong growth and relatively developed roots, they can be used as rootstocks, carrying scions, providing nutrients and support for scions, and are suitable for grafting cultivation of melons.

[0003] Currently, there are a large number of rootstock varieties used for grafting melons such as watermelons, for example: Jingxin Rootstock No. 1, Wan Rootstock No. 1, Qianggen and Lvzhuangshi, etc., and they have been widely applied in agricultural production. As edible gourds, a series of high-yield and high-quality varieties such as Zhepu 9 have been selected and widely applied.

[0004] Gourd Fusarium wilt is a soil-borne disease caused by fungi, mainly infecting the roots and vascular systems of Cucurbitaceae plants. When a scion is grafted onto a rootstock carrying Fusarium wilt bacteria, the pathogen may infect the scion through the vascular system, resulting in growth inhibition. The scion may show symptoms such as leaf wilting, yellowing, and slow growth. In severe cases, the whole plant may even die, reducing the yield and quality of the scion and causing serious economic losses. In recent years, gourd Fusarium wilt has become increasingly severe, seriously affecting the continuous production of gourd crops. However, only a very small number of currently applied gourd varieties are resistant to gourd Fusarium wilt, far from meeting the production needs.

[0005] In the prior art, the breeding of gourd Fusarium wilt resistant varieties mainly relies on conventional breeding techniques, depending on inoculating Fusarium wilt bacteria in the field and laboratory, identifying their agronomic traits, physiological development changes and disease levels, and then screening disease-resistant materials for related variety breeding. However, this method has a long cycle, high cost and low accuracy.

[0006] Molecular marker-assisted breeding is one of the most widely used technologies in the field of agricultural science and technology breeding. It can significantly improve the breeding efficiency and controllability by accurately identifying genetic markers of target traits, providing unprecedented technical support for crop improvement. This technology does not require a complex field screening process, significantly shortens the breeding cycle, reduces the cost of field screening, breaks through the bottleneck of traditional breeding methods, and can significantly improve breeding efficiency and accuracy, providing technical support for variety improvement. Therefore, developing molecular markers related to gourd Fusarium wilt resistance is of great significance for the breeding of gourd Fusarium wilt resistant varieties. Summary of the Invention

[0007] The object of the present invention is to provide a mutant locus resistant to Fusarium wilt of bottle gourd, a KASP marker primer set, a disease resistance detection method and an application thereof. By means of molecular markers, the breeding of bottle gourd varieties resistant to Fusarium wilt is carried out, which has the characteristics of high efficiency, high accuracy and no pollution, and overcomes the problems of low breeding efficiency, high cost and undiscovered related genes in the existing breeding of bottle gourd varieties resistant to Fusarium wilt.

[0008] In order to achieve the above-mentioned invention object, the present invention provides the following technical solutions:

[0009] The present invention provides a mutant locus resistant to Fusarium wilt of bottle gourd, and the Fusarium wilt resistance locus is located on chromosome 3 of bottle gourd.

[0010] Preferably, the Fusarium wilt resistance locus is at the 25114519th position of the 4th exon of the Lsi03G014160 gene homologous to WAT1 specifically expressed in the root of chromosome 3 of bottle gourd, and the mutation type is C→G variation.

[0011] The present invention also provides a KASP marker primer set for detecting the disease resistance of bottle gourd to Fusarium wilt, including primers with the following sequences:

[0012] Disease resistance locus binding primer - F1 - SEQ ID NO.1:

[0013] GAAGGTCGGAGTCAACGGATITTCTTTATCAAAATCCCCCTTTGG;

[0014] Susceptible locus binding primer - F2 - SEQ ID NO.2:

[0015] GAAGGTGACCAAGTTCATGCTTTCTTTATCAAAATCCCCCTTTGC;

[0016] Downstream primer - R1 - SEQ ID NO.3:

[0017] ATTGAAAAACAAAGCAAAGGCCAC.

[0018] Preferably, the 5' ends of the disease resistance locus binding primer and the susceptible locus binding primer are respectively labeled with different fluorescent groups.

[0019] The present invention also provides an application of the KASP marker primer set for detecting the disease resistance of bottle gourd to Fusarium wilt in bottle gourd breeding.

[0020] The present invention also provides a method for detecting the disease resistance of bottle gourd to Fusarium wilt, including the following steps:

[0021] (1) Extract the DNA of the sample to be tested;

[0022] (2) Use SEQ ID NO.1 and SEQ ID NO.2 with different fluorescent groups, and the primers shown in SEQ ID NO.3 to perform PCR amplification on the DNA of the sample to be tested.

[0023] (3) Analyze the results of the PCR amplification.

[0024] Preferably, in step (2), the reaction system for the PCR amplification is as follows:

[0025] 2 - 4 μL of 2x Taq DNA Polymerase Mix, 1 - 2 μL of SNP Primer Mix (4x), and 2 - 4 μL of the DNA sample.

[0026] Preferably, the PRIMER mix comprises raw materials in the following volume ratios:

[0027] F1:F2:R1:pure water = 0.5 - 2:0.5 - 2:1 - 4:2 - 8; the concentrations of F1, F2, and R1 are all 90 - 110 μm / mL.

[0028] Preferably, in step (2), the reaction program for the PCR amplification is as follows:

[0029] Table 2 PCR Amplification Program

[0030]

[0031] The present invention also provides an application of the method for detecting the resistance to fusarium wilt of gourds in gourd breeding.

[0032] The beneficial effects of the present invention compared with the prior art are as follows:

[0033] (1) By inoculating and identifying the fusarium wilt pathogen at the seedling stage for the disease-resistant and disease-susceptible parents and their reciprocal cross F1, it is found that the resistance to fusarium wilt is recessive inheritance. Then, the two parents are re-sequenced, the differential sites are screened, the genotype analysis of the differential sites is performed on the two extreme segregation pools of the F2 generation, and combined with bioinformatics analysis, the functional mutation sites are screened. Finally, through natural population verification, it is found that the gene related to the resistance to fusarium wilt of gourds is a functional variation of C→G at the 25114519th position of the 4th exon of the Lsi03G014160 gene homologous to WAT1 on chromosome 3, solving the problem that the genes related to the resistance to fusarium wilt of gourds have not been discovered.

[0034] (2) The present invention designs a KASP marker primer set SEQ ID NO.1 - SEQ ID NO.3 for detecting the resistance to Fusarium wilt of gourds based on the functional variation of C→G at position 25114519 in exon 4 of the WAT1 gene on chromosome 3. This KASP primer set can be used for screening materials resistant to Fusarium wilt of gourds and variety breeding, and has the characteristics of high efficiency, high accuracy and no pollution, overcoming the problems of low efficiency and high cost in the breeding of resistant varieties to Fusarium wilt of gourds in existing breeding. Detailed implementation manners

[0035] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics and implementation manners of the present invention.

[0036] It should be understood that the terms used in the present invention are only for describing specific implementation manners and are not used to limit the present invention. In addition, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the range.

[0037] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0038] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and embodiments of the present invention are only exemplary.

[0039] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0040] The present invention provides a method for detecting the resistance to Fusarium wilt of gourds, comprising the following steps:

[0041] (1) Extract the DNA of the sample to be tested;

[0042] (2) Use SEQ ID NO.1 and SEQ ID NO.2 with different fluorescent groups, and the primer shown in SEQ ID NO.3 to perform PCR amplification on the DNA of the sample to be tested.

[0043] (3) Analyze the results of PCR amplification. Among them, if the genotype test result is G, it is a homozygous disease-resistant material of bottle gourd; if the genotype test result is C, it is a homozygous disease-susceptible material of bottle gourd; if the genotype test result is C / G, it is a heterozygous disease-susceptible material of bottle gourd.

[0044] Mutated sequence SEQ ID NO.4:

[0045] Note: S in the sequence is the mutation site, representing C or G

[0046] >chr03 chr03: 25111457..25117014(+strand) class=mRNA length=5558

[0047]

[0048]

[0049]

[0050]

[0051]

[0052] Example 1

[0053] In Example 1 of the present invention, a KASP marker primer set for detecting the disease resistance of Fusarium wilt of bottle gourd was designed. The specific steps are as follows:

[0054] (1) Using the bottle gourd material 5210 resistant to Fusarium wilt of bottle gourd and the susceptible material P12 as parents, perform reciprocal crosses to obtain the offspring F1, and the F2 population obtained by self-crossing the offspring F1 (the public can obtain the two bottle gourd parent materials 5210 and P12 from the applicant within twenty years from the application date, only for repeating the relevant experiments of the present invention).

[0055] (2) Soak and germinate the seeds of 5210, P12, F1, and F2. After germination, mix with the substrate and add water evenly. Take the Fusarium oxysporum f. sp. niveum cultured on wheat grainsand inoculate it at a ratio of 2%. After stirring evenly, fill it into a 50-hole seedling-raising tray.

[0056] After punching holes in the plug tray substrate, the germinated gourd seeds were sown, and finally the sowing holes were filled with the same substrate. After sowing, they were placed in an artificial climate chamber for cultivation, with a light / dark cycle of 12 / 12 h, a temperature of 26 / 20 °C, and a humidity of 95% / 85%. The incidence of fusarium wilt was investigated 30 days after emergence, and it was determined that the resistance to fusarium wilt in gourds was recessive inheritance.

[0057] (3) Samples were taken from the leaves of individual plants of 5210, P12, F1, and F2. DNA was extracted using a conventional genomic DNA extraction kit (containing RNase A) from TransGen Biotech Co., Ltd., Beijing. 5210 and P12 were re-sequenced to detect the differential sites between the two parents. Based on the resistance to white fusarium wilt, an extreme bulked segregant analysis (BSA) pool was constructed for the F2 population. Using BSA sequencing, a functional variation of C→G at position 25114519 in the 4th exon of a WAT1 homologous gene located on chromosome 3 was detected by the Gprime method. This gene was initially identified as a candidate gene related to the resistance to fusarium wilt in gourds (the sequence is shown in SEQ ID NO.4). According to the sequence of this mutation site, a set of KASP molecular marker primers was designed, and its sequence is as follows:

[0058] Primer for resistant locus - F1 - SEQ ID NO.1:

[0059] GAAGGTCGGAGTCAACGGATTTTCTTTATCAAAATCCCCCTITGG;

[0060] Primer for susceptible locus - F2 - SEQ ID NO.2:

[0061] GAAGGTGACCAAGTTCATGCTITCTTTATCAAAATCCCCCTTTGC;

[0062] Downstream primer - R1 - SEQ ID NO.3:

[0063] ATTGAAAAACAAAGCAAAGGCCAC.

[0064] Example 2

[0065] Example 2 of the present invention detected the detection effect of the KASP molecular marker primer set shown in SEQ ID NO.1 - SEQ ID NO.3 in Example 1. The specific steps are as follows:

[0066] Table 1 Sample sources

[0067] Sample Number Source Sample Number Source Sample Number Source Z063 Shandong HN1 Hainan Z0618 Shandong JL082 Jilin J03 Japan Z078 Shandong Z077 Shandong JTT Japan Z0620 Shandong SD0810 Shandong JZS Japan YH2 Ningbo J081 Japan KZ Shandong JTK01 Japan C2002 Japan T2002 Japan JX0812 Beijing DP-1 Taizhou Y4 Japan JX0815 Beijing FH1 Japan Y1 Japan TB10 Japan HGZ Japan Z062 Shandong Shengtongli Japan 4100 Japan 5210 Japan 13A-36 Japan

[0068] Note: The above germplasm resource materials can be obtained from the applicant by the public within twenty years from the application date, and are only used for repeating the relevant experiments of the present invention.

[0069] (1) Soak the above materials for seed soaking and germination acceleration. After mixing the substrate with water evenly, inoculate the Fusarium oxysporum f. sp. cucumerinum cultured with wheat grains sand at a ratio of 2%. After sowing, place it in an artificial climate chamber for cultivation, with a light / dark cycle of 12 / 12 h, a temperature of 26 / 20 °C, and a humidity of 95% / 85%. Investigate the disease incidence 30 days after emergence. Take the leaves to extract genomic DNA, measure the concentration using NanoDrop 2000, and dilute each DNA stock solution to 20 ng / μL. Use the molecular markers described in Example 1 to amplify and detect the extracted genomic DNA.

[0070] (2) Prepare the PCR reaction system as follows: 2 μL of 2x Taq DNA Polymerase Mix, 1 μL of SNP PrimerMix(4x), and 2 μL of DNA sample.

[0071] (3) Perform PCR amplification according to the procedure shown in Table 1:

[0072] Table 2 PCR Amplification Procedure

[0073]

[0074] (2) Take the mixture after the amplification is completed and perform SNP site detection. Use the fluorophores FAM and VIC to distinguish two isogenic loci, and FAM and VIC are respectively labeled on primers F1 and F2. The passive reference dye ROX (passive reference dye ROX) is used to correct the signal differences caused by the reaction volume error between wells. The relevant excitation and emission wavelengths are shown in Table 3. The reading software is the oemga device of LGC.

[0075] Table 3 Relevant Excitation and Emission Wavelengths

[0076]

[0077] (3) Use the genotype reading software (Kluster Caller) of LGC_OMEGA to analyze the result data of the PCR amplification. Obtain the relative fluorescence values corresponding to VIC and FAM for each PCR reaction well. According to the relative fluorescence values, cluster and cluster the samples, and further determine the genotype based on the sample clusters and fluorescence types. The genotype and phenotype results of the measured samples are shown in Table 4.

[0078] Table 4 Sample Resistance

[0079] Sample Number Genotype Resistance Sample Number Genotype Resistance Sample Number Genotype Resistance Z063 C / C Susceptible HN1 C / C Susceptible Z0618 C / C Susceptible JL082 C / C Susceptible J03 C / C Susceptible Z078 C / C Susceptible Z077 C / C Susceptible JTT C / C Susceptible Z0620 C / C Susceptible SD0810 C / C Susceptible JZS C / C Susceptible YH2 C / C Susceptible J081 C / C Susceptible KZ C / C Susceptible JTK01 C / C Susceptible C2002 C / C Susceptible T2002 C / C Susceptible JX0812 C / C Susceptible DP-1 C / C Susceptible Y4 C / C Susceptible JX0815 C / C Susceptible FH1 C / C Susceptible Y1 C / C Susceptible TB10 G / G Resistant HGZ C / C Susceptible Z062 C / C Susceptible Shengtongli C / C Susceptible 4100 G / G Resistant 5210 G / G Resistant 13A-36 C / C Resistant

[0080] As can be seen from Table 4, the genotypes are generally consistent with the phenotypic results. Among the 4 materials resistant to Fusarium wilt of gourd, the genotypes of 3 materials are all G / G and that of 1 material is C / C; the genotypes of the 23 susceptible materials are all C / C. This indicates that although there are other genes related to resistance to Fusarium wilt of gourd in gourd besides the genes related to this marker, this marker can be used to significantly distinguish extremely resistant and susceptible materials and can be applied to the creation of germplasm resources resistant to Fusarium wilt of gourd and variety breeding.

[0081] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A resistance mutation locus for Fusarium wilt of gourd, characterized in that, The fusarium wilt resistance locus is located on chromosome 3 of the gourd.

2. The mutant locus resistant to gourd fusarium wilt according to claim 1, characterized in that, The fusarium wilt resistance locus is at position 25114519 of the 4th exon of the Lsi03G014160 gene homologous to WAT1 on chromosome 3 of the gourd, and the mutation type is a C→G variation.

3. A KASP marker primer set for detecting the disease resistance of bottle gourd fusarium wilt, characterized in that Primers including the sequences shown below: Disease-resistant locus binding primer - F1 - SEQ ID NO.1: GAAGGTCGGAGTCAACGGATITTCTTTATCAAAATCCCCCTTTGG; Disease-susceptible locus binding primer - F2 - SEQ ID NO.2: GAAGGTGACCAAGTTCATGCTTTCTTTATCAAAATCCCCCTTTGC; Downstream primer - R1 - SEQ ID NO.3: ATTGAAAAACAAAGCAAAGGCCAC.

4. The KASP marker primer set for detecting the disease resistance of bottle gourd fusarium wilt according to claim 3, characterized in that The 5' ends of the disease-resistant locus binding primer and the disease-susceptible locus binding primer are respectively labeled with different fluorescent groups.

5. Use of the KASP marker primer set for detecting the fusarium wilt resistance of gourds according to any one of claims 3 to 4 in gourd breeding.

6. A method for detecting the disease resistance of bottle gourd fusarium wilt, characterized in that, Including the following steps: (1) Extract the DNA of the sample to be tested; (2) Use the primers shown in SEQ ID NO.1 and SEQ ID NO.2 with different fluorescent groups, and SEQ ID NO.3 to perform PCR amplification on the DNA of the sample to be tested; (3) Analyze the results of the PCR amplification.

7. The detection method for the disease resistance of bottle gourd fusarium wilt according to claim 6, wherein, In step (2), the reaction system for the PCR amplification is: 2x Taq DNA Polymerase Mix 2 - 4 μL, SNP Primer Mix(4x) 1 - 2 μL, DNA sample 2 - 4 μL.

8. The gourd fusarium wilt disease resistance detection method according to claim 7, wherein, The PRIMER mix includes raw materials in the following volume ratios: F1:F2:R1:pure water = 0.5 - 2:0.5 - 2:1 - 4:2 - 8; the concentrations of F1, F2, and R1 are all 90 - 110 μm / mL.

9. The gourd fusarium wilt disease resistance detection method according to claim 6, characterized in that, In step (2), the reaction program for the PCR amplification is:

10. Use of the method for detecting the fusarium wilt resistance of gourds according to any one of claims 6 to 9 in gourd breeding.

Images