Nanocomposite ha / pei / fes04@siRNA and preparation method and application thereof

By preparing the nanocomposite HA/PEI/Fe3O4@siRNA, and utilizing electrostatic interactions and pH changes in the acidic tumor microenvironment, highly efficient targeted delivery and anti-tumor effects on TNBC cells were achieved, solving the problems of chemotherapy resistance and toxicity to normal tissues.

CN120284918BActive Publication Date: 2026-03-20HUBEI RUIHAI LONGSHENG PHARMACEUTICAL TECHNOLOGY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510773210.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2026-03-20
Estimated Expiration
2045-06-11

AI Technical Summary

Technical Problem

Existing chemotherapy drugs for treating triple-negative breast cancer (TNBC) are prone to drug resistance, lack specific therapeutic targets, and have high toxicity to normal tissues. Therefore, finding more effective targeted therapies to overcome drug resistance and reduce systemic toxicity has become a research focus.

Method used

A nanocomposite HA/PEI/Fe3O4@siRNA was prepared. The siRNA was stabilized under physiological conditions through electrostatic interaction. After entering the acidic tumor microenvironment, it released siGPX4, triggering ferroptosis and inducing cell death through the Fenton reaction, specifically targeting TNBC cells.

Benefits of technology

It achieved highly efficient targeted delivery and anti-tumor effect to TNBC cells, reduced toxicity to normal tissues, and significantly improved the siGPX4 delivery efficiency and anti-tumor effect in triple-negative breast cancer cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120284918B_ABST
    Figure CN120284918B_ABST
Patent Text Reader

Abstract

The application discloses a kind of nanocomposite HA / PEI / Fe3O4@siRNA and its preparation method and application, belong to antitumor drug technical field.The application successfully prepared nanocomposite HA / PEI / Fe3O4@siGPX4, serum stability is high, blood compatibility is good, when reaching tumor acid microenvironment, siGPX4 can be efficiently released, and then play antitumor effect, can specifically target triple-negative breast cancer cell, greatly improve the internalization ability of MDA-MB-468 cell to it, significantly improve the delivery efficiency of siGPX4;Under the condition that there is H2O2, the nanocomposite can down-regulate the expression of GPX4, the released ferrous ion and H2O2 occur Fenton reaction, cause intracellular ROS significantly increase, cause mitochondrial membrane potential to drop, and then trigger ferroptosis, significantly inhibit MDA-MB-468 cell proliferation, to play antitumor effect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of antitumor drugs, in particular to a kind of nanocomposite HA / PEI / Fe3O4@siRNA and its preparation method and application. BACKGROUND

[0002] At present, breast cancer has become the second most common cancer in the world, and the incidence rate is only second to lung cancer. The molecular typing of breast cancer is an important basis for guiding clinical treatment. According to the expression differences of biological markers such as estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2) and Ki67, breast cancer is mainly divided into Luminal A type, Luminal B type, HER2 overexpression type and triple negative breast cancer (TNBC).

[0003] Among them, TNBC is a special subtype, and the tumor cells do not express ER, PR and HER2. The pathological characteristics show that the tumor volume of TNBC patients is larger, the pathological grade is higher and the cell proliferation is more active. Clinical studies have shown that TNBC patients face a very high risk of early recurrence, about 30% of early patients relapse within 3 years after diagnosis, and 6%~10% of patients have metastatic lesions at the time of initial diagnosis. Once in the advanced stage, the prognosis of patients is very poor.

[0004] The treatment dilemma of TNBC mainly comes from the lack of related specific treatment targets. At present, chemotherapy is still the main treatment for TNBC patients, but patients are prone to drug resistance to conventional chemotherapy drugs, which significantly restricts the curative effect. Therefore, finding more effective treatment methods to improve drug targeting, overcome drug resistance and reduce systemic toxicity has become the focus of TNBC research.

[0005] The targeted treatment strategy of ferroptosis provides a new idea for the precise treatment of TNBC. Ferroptosis triggers lipid reactive oxygen accumulation through iron-dependent Fenton reaction, and the core regulatory factor glutathione peroxidase 4 (GPX4) is highly expressed in TNBC cells and mediates chemotherapy resistance. SUMMARY

[0006] The purpose of the present application is to provide a kind of nanocomposite HA / PEI / Fe3O4@siRNA and its preparation method and application, to provide a new, effective, strong target drug candidate compound for the targeted treatment of TNBC.

[0007] To achieve the above purpose, the present application provides a kind of nanocomposite HA / PEI / Fe3O4@siRNA preparation method, comprising the following steps:

[0008] S1, hydrophobic Fe3O4 nanoparticles are prepared by adding ferric acetylacetonate, 1,2-dodecanediol, oleic acid, oleylamine and benzyl ether into a container in sequence for pyrolysis reaction, and then cooling to room temperature to obtain a black mixture, adding anhydrous ethanol for centrifugation, dispersing the precipitate in a mixed solvent for centrifugation, adding anhydrous ethanol to the supernatant for centrifugation, and drying the precipitate to obtain the hydrophobic Fe3O4 nanoparticles;

[0009] S2, phase transfer is performed on the obtained hydrophobic Fe3O4 nanoparticles, 3,4-dihydroxycinnamic acid is dissolved in tetrahydrofuran, and then the tetrahydrofuran dispersion of the hydrophobic Fe3O4 nanoparticles obtained in S1 is added dropwise into the solution under stirring in a protective atmosphere, the reaction is continued for 3 hours after the dropwise addition is completed, and then the reaction is cooled to room temperature, 0.5M NaOH solution is added, the precipitate is obtained by centrifugation, and freeze-drying is performed to obtain hydrophilic Fe3O4 nanoparticles;

[0010] S3, PEI / Fe3O4 composite is prepared by dissolving polyethyleneimine and the hydrophilic Fe3O4 nanoparticles obtained in S2 in ultrapure water in sequence, and then adding the aqueous solution of the Fe3O4 nanoparticles into the aqueous solution of the polyethyleneimine dropwise, and freeze-drying after the reaction is completed to obtain the PEI / Fe3O4 composite;

[0011] S4, PEI / Fe3O4@siRNA nanocomposite is prepared by mixing the DEPC aqueous solution of the PEI / Fe3O4 composite obtained in S3 with the aqueous solution of siRNA, and then incubating at room temperature to obtain the PEI / Fe3O4@siRNA nanocomposite;

[0012] S5, HA / PEI / Fe3O4@siRNA nanocomposite is prepared by stirring and mixing the aqueous solution of hyaluronic acid with the PEI / Fe3O4@siRNA nanocomposite obtained in S4, and then reacting to obtain the HA / PEI / Fe3O4@siRNA nanocomposite after the reaction is completed.

[0013] Preferably, the molar ratio of ferric acetylacetonate: 1,2-dodecanediol: oleic acid: oleylamine: benzyl ether in S1 is 1:5:3:3:53, the pyrolysis reaction is performed under stirring and in a protective atmosphere at 200°C for 2 hours and then at 300°C for 1 hour, and the volume ratio of the black mixture to anhydrous ethanol is 1:2-3.

[0014] Preferably, the mixed solvent in S1 is a mixture of oleic acid, oleylamine and n-hexane, the volume ratio of oleic acid: oleylamine: n-hexane is 1:1:200, the volume ratio of the supernatant to anhydrous ethanol is 1:2-3, and nitrogen blowing is used for drying the precipitate.

[0015] Preferably, the mass-volume ratio of hydrophobic Fe3O4 nanoparticles: tetrahydrofuran: 3,4-dihydroxycinnamic acid in S2 is 20 mg: 11 mL: 50 mg; the volume ratio of 0.5M NaOH solution: mixed liquid cooled to room temperature is 1:22; the precipitate needs to be dried with nitrogen before freeze-drying, and then dispersed in ultrapure water before freeze-drying.

[0016] Preferably, the mass-volume ratio of hydrophilic Fe3O4 nanoparticles: polyethyleneimine: ultrapure water in S3 is 5 mg: 25 mg: 22 mL; the aqueous solution of polyethyleneimine is stirred for 5 min, and then the aqueous solution of Fe3O4 nanoparticles is added dropwise, and after the addition is completed, stirring is continued for 30 min.

[0017] Preferably, the N / P ratio of PEI / Fe3O4 complex to siRNA in S4 is 10:1; the siRNA is a specific sequence targeting specific tumor CD44 or CD44 receptor.

[0018] Preferably, the mass ratio of hyaluronic acid: PEI / Fe3O4@siRNA nanocomposite in S5 is 0.5:1; the reaction condition is incubation at room temperature for 1 h.

[0019] The nanocomposite HA / PEI / Fe3O4@siRNA is prepared by the preparation method of the nanocomposite HA / PEI / Fe3O4@siRNA as described above.

[0020] The application of the nanocomposite HA / PEI / Fe3O4@siRNA as described above in the preparation of a triple-negative breast cancer treatment drug, the drug comprising the nanocomposite HA / PEI / Fe3O4@siRNA; the siRNA in the nanocomposite HA / PEI / Fe3O4@siRNA is siGPX4.

[0021] The application of the nanocomposite HA / PEI / Fe3O4@siRNA as described above in the preparation of a tumor treatment drug, the drug comprising the nanocomposite HA / PEI / Fe3O4@siRNA.

[0022] At physiological pH, the amino groups of the cationic polymer PEI are protonated, carrying a positive charge, so they can bind to negatively charged siRNA through electrostatic interaction. At this time, the complex structure is stable and can protect siRNA from degradation. When the carrier enters the tumor microenvironment, the pH is lower. At this time, the amino groups of PEI are further protonated, triggering the proton sponge effect, increasing the osmotic pressure inside the carrier, attracting a large number of water molecules to enter, causing the carrier to disintegrate, creating favorable conditions for the release of siRNA; at the same time, due to the swelling or dissociation of the polymer conformation, the effective positive charge density on the surface is reduced, weakening the electrostatic binding force, and siRNA is more easily released from the nanocomposite.

[0023] Ferroptosis is an iron-dependent cell programmed death mode, and the core mechanism is that ferrous ions in cells catalyze lipid peroxidation through Fenton reaction, and then cause cell death. Therefore, the increase of ferrous ion content in cells helps to promote the occurrence of ferroptosis. After the HA / PEI / Fe3O4@siGPX4 nanocomposite enters the tumor cells, it will be wrapped in organelles such as endosomes and lysosomes. The acidic environment and rich hydrolytic enzymes and other substances inside these organelles will further promote the dissociation of Fe3O4, and promote the release of Fe 2+ 、Fe 3+ .

[0024] Therefore, the present application provides a kind of nanocomposite HA / PEI / Fe3O4@siRNA and its preparation method and application, and its specific technical effects are as follows:

[0025] (1) the nanocomposite HA / PEI / Fe3O4@siRNA is successfully prepared by the method provided in the present application, and its hydrodynamic diameter is 77.28nm, PDI is 0.210, and the potential is 5.54mV;

[0026] (2) the nanocomposite HA / PEI / Fe3O4@siRNA provided in the present application has high serum stability, is stable under physiological conditions, has low toxicity to normal tissue cells, can efficiently release siGPX4 when reaching the acidic microenvironment of tumor, and then plays an anti-tumor effect, and has good blood compatibility;

[0027] (3) the nanocomposite HA / PEI / Fe3O4@siGPX4 provided in the present application can specifically target triple-negative breast cancer cells, greatly improves the internalization ability of triple-negative breast cancer MDA-MB-468 cells, improves the uptake rate of triple-negative breast cancer MDA-MB-468 cells, and then significantly improves the delivery efficiency of siGPX4;

[0028] (4) the nanocomposite HA / PEI / Fe3O4@siGPX4 provided in the present application can down-regulate the expression of GPX4 under the condition of the presence of H2O2, and the released ferrous ions can undergo Fenton reaction with H2O2, thereby causing the intracellular ROS to significantly increase, causing the mitochondrial membrane potential to decrease, and then triggering ferroptosis and significantly inhibiting the proliferation of MDA-MB-468 cells, thereby playing an anti-tumor effect.

[0029] The technical solutions of the present application are further described in detail below by means of drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0030] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the drawings needed to be used in the description of the embodiments of the present application. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative labor based on these drawings.

[0031] Figure 1 FIG. 1 is a TEM image of hydrophobic Fe3O4 nanoparticles, hydrophilic Fe3O4 nanoparticles and PEI / Fe3O4 complex in Example 1 of the present application; wherein (a) is the TEM image of the hydrophobic Fe3O4 nanoparticles; (b) is the TEM image of the hydrophilic Fe3O4 nanoparticles; and (c) is the TEM image of the PEI / Fe3O4 complex;

[0032] Figure 2 FIG. 2 is the detection result of the complexing ability of the PEI / Fe3O4 complex in Example 1 of the present application to siRNA under different N / P conditions;

[0033] Figure 3 FIG. 3 is the TEM and DLS detection result of the PEI / Fe3O4@siGPX4 nanocomposite in Example 1 of the present application; wherein (a) is the TEM image; and (b) is the DLS detection result; Figure 4 FIG. 4 is the effect of HA on the siRNA complexing ability of the PEI / Fe3O4 complex in Example 1 of the present application;

[0034] Figure 5 FIG. 5 is the characterization result of the HA / PEI / Fe3O4@siGPX4 nanocomposite in Effect Test 1 of the present application; wherein (a) is the TEM image; (b) is the particle size and PDI measured by DLS analysis; and (c) is the TEM element mapping image;

[0035] Figure 6 FIG. 6 is the detection result of the Zeta potential in Effect Test 1 of the present application;

[0036] Figure 7 FIG. 7 is the serum stability detection result in Effect Test 2 of the present application; wherein (a) is in the culture medium containing 10% FBS; and (b) is in the culture medium containing 50% FBS;

[0037] Figure 8 FIG. 8 is the cytotoxicity determination result in Effect Test 3 of the present application;

[0038] Figure 9 FIG. 9 is the red blood cell compatibility evaluation result in Effect Test 4 of the present application; wherein (a) is the photo of the centrifuge tube after centrifugation of each treatment group; and (b) is the quantitative analysis result of the hemolysis rate;

[0039] Figure 10is the in vitro release curve of siGPX4 in effect test 5 of the present application;

[0040] Figure 11 is the Western blot detection result in effect test 6 of the present application; wherein (a) is the Western blot detection result picture; (b) is the quantitative analysis result of the Western blot detection result picture by using Image J software;

[0041] Figure 12 is the cell internalization behavior detection result in effect test 6 of the present application; wherein (a) is the green fluorescence photo; (b) is the quantitative analysis result of the green fluorescence by using Image J software; I is the blank medium control; II is the double-antibody-free DMEM medium containing free siGPX4; III is the double-antibody-free DMEM medium containing PEI / Fe3O4@siGPX4 nanocomposite; IV is the double-antibody-free DMEM medium containing HA+HA / PEI / Fe3O4@siGPX4 nanocomposite; V is the double-antibody-free DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposite; the scale is 50 μm;

[0042] Figure 13 is the gene silencing efficiency investigation result of GPX4 in effect test 6 of the present application; wherein (a) is the silencing efficiency of GPX4 detected at the mRNA level by using the fluorescent quantitative PCR method; (b) is the silencing efficiency of GPX4 detected at the protein level by using the Western blot method; (c) is the protein quantitative analysis result of the band gray value in figure (b) by using Image J software;

[0043] Figure 14 is the cell proliferation result detected by MTT method in effect test 7 of the present application; wherein (a) is without adding H2O2; (b) is with adding H2O2;

[0044] Figure 15 is the cell proliferation result evaluated by EdU staining method in effect test 7 of the present application; wherein (a) is the representative image collected by laser scanning confocal microscope; (b) is the quantitative result without adding H2O2; (c) is the quantitative result with adding H2O2; I is the blank medium control; II is the double-antibody-free DMEM medium containing free siGPX4; III is the double-antibody-free DMEM medium containing PEI / Fe3O4@siGPX4 nanocomposite; IV is the double-antibody-free DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposite; the scale is 100 μm;

[0045] Figure 16is the determination result of ferrous ion content in effect test 7 of the present application; wherein I is blank medium control; II is double antibody-free DMEM medium containing free siGPX4; III is double antibody-free DMEM medium containing PEI / Fe3O4@siGPX4 nanocomposite; IV is double antibody-free DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposite;

[0046] Figure 17 is the determination result of hydroxyl radical generation ability in effect test 7 of the present application;

[0047] Figure 18 is the detection result of ROS content in effect test 7 of the present application; wherein (a) is the laser confocal microscope photo; (b) is the flow cytometry analysis result; (c) is the quantitative result of laser confocal microscope photo; (d) is the quantitative result of flow cytometry analysis result; I is blank medium control; II is double antibody-free DMEM medium containing free siGPX4; III is double antibody-free DMEM medium containing PEI / Fe3O4@siGPX4 nanocomposite; IV is double antibody-free DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposite; the scale is 100 μm;

[0048] Figure 19 is the detection result of mitochondrial membrane potential in effect test 7 of the present application; wherein (a) is the laser confocal microscope

[0049] photo; (b) is the quantitative result without adding H2O2; (c) is the quantitative result with adding H2O2; I is blank medium control; II is double antibody-free DMEM medium containing free siGPX4; III is double antibody-free DMEM medium containing PEI / Fe3O4@siGPX4 nanocomposite; IV is double antibody-free DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposite; the scale is 200 μm;

[0050] Figure 20 is the detection result of mitochondrial morphology in effect test 7 of the present application. DETAILED DESCRIPTION

[0051] The technical solutions of the present application are further described below by means of the accompanying drawings and examples.

[0052] In order to make the purpose, technical solutions and advantages of the present application more clear, thorough and complete, the technical solutions of the present application are described clearly and completely below by means of the accompanying drawings and examples. The following detailed description is the description of examples, which aims to provide further detailed description of the present application. Unless otherwise specified, all technical terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.

[0053] The instrument equipment and reagent materials used in the examples were obtained through commercial channels; the method steps not specifically described were the conventional technical means in the art.

[0054] Example 1

[0055] A nanocomposite HA / PEI / Fe3O4@siGPX4 was prepared, and the specific steps were as follows:

[0056] S1, preparation of hydrophobic Fe3O4 nanoparticles.

[0057] Accurately weigh iron acetylacetone (0.3532 g, 1 mmol) and 1,2-dodecanediol (1.0117 g, 5 mmol), respectively, and measure oleic acid (1.022 mL, 3 mmol), oleylamine (0.99 mL, 3 mmol) and benzyl ether (10 mL, 53 mmol), and add them into a three-necked flask in turn, and carry out pyrolysis reaction under the conditions of 10000 rpm magnetic stirring, high-purity nitrogen protection and programmed temperature rise (200°C / 2h→300°C / 1h).

[0058] After the reaction was completed, 20 mL of anhydrous ethanol was added, centrifuged at 14000 rpm for 20 min, and the supernatant was discarded. The precipitate was dispersed with a mixture of oleic acid (25 μL) + oleylamine (25 μL) + n-hexane (5 mL), and centrifuged at 6000 rpm for 10 min to retain the supernatant. 10 mL of anhydrous ethanol was added to the supernatant, and centrifuged at 10000 rpm for 20 min, and the precipitate was dried by nitrogen blowing to obtain hydrophobic Fe3O4 nanoparticles.

[0059] S2, phase transfer of the hydrophobic Fe3O4 nanoparticles obtained in step S1.

[0060] 20 mg of the hydrophobic Fe3O4 nanoparticles obtained in step S1 were mixed with 1 mL of tetrahydrofuran (THF) to form an organic phase dispersion liquid. 50 mg of 3,4-dihydroxycinnamic acid was dissolved in 6 mL of THF, and the prepared organic phase dispersion liquid was added dropwise under the conditions of high-purity nitrogen protection and 50°C stirring, and reacted at 50°C for 3 h.

[0061] After the reaction was completed, the reaction was cooled to room temperature, and then 0.5M NaOH (500 μL) was added, and centrifuged at 3000 rpm for 10 min to discard the supernatant. The precipitate was dried by nitrogen blowing, dispersed in ultrapure water and freeze-dried to obtain hydrophilic Fe3O4 nanoparticles.

[0062] S3, preparation of PEI / Fe3O4 composite.

[0063] The 25 mg of PEI and 5 mg of the hydrophilic Fe3O4 nanoparticles obtained in step S2 were dissolved in 3 mL of ultrapure water, respectively, to obtain a PEI aqueous solution and a Fe3O4 nanoparticle aqueous solution. The PEI aqueous solution was transferred to a round-bottom flask, and ultrapure water was added to a total volume of 22 mL. After magnetic stirring for 5 min, the Fe3O4 nanoparticle aqueous solution was added dropwise and stirred vigorously (200 rpm) for 30 min to complete the self-assembly. The reaction solution was concentrated by ultrafiltration centrifugation (MWCO 3 kDa) and then freeze-dried to obtain the PEI / Fe3O4 composite.

[0064] (1) The morphology of the hydrophobic Fe3O4 nanoparticles, the hydrophilic Fe3O4 nanoparticles, and the PEI / Fe3O4 composite prepared in Example 1 were characterized by transmission electron microscopy (TEM), and the surface charge characteristics were determined by a nanoparticle size potential analyzer (DLS). As shown in FIG. 1, the Fe3O4 nanoparticles were uniformly distributed, with a particle size of about 10 nm and a surface charge of 23.97 ± 0.33 mV. In addition, the PEI / Fe3O4 composite was also uniformly distributed and had good dispersibility. These results indicate that we successfully synthesized the PEI / Fe3O4 composite. Figure 1

[0065] (2) The complexing ability of the PEI / Fe3O4 composite prepared in Example 1 for siRNA was detected by gel retardation, as follows:

[0066] ① The PEI / Fe3O4 composite was diluted with DEPC water to 40 μg / mL and 4 μg / mL for standby.

[0067] ② The siRNA dry powder was diluted to 5 µM according to the instructions, and then the PEI / Fe3O4 composite and the siRNA were mixed in a centrifuge tube at 200 μL according to different N / P ratios (0.5:1, 1:1, 2:1, 3:1, 5:1, 7.5:1, 10:1, 12.5:1, 20:1). Then the centrifuge tube was incubated at room temperature for 30 min.

[0068] ③ The total volume was made up to 10 μL with DEPC water, and agarose gel electrophoresis was performed. As shown in FIG. 2, with the increase of the N / P ratio, the siRNA band gradually became dark. When the N / P was greater than or equal to 7.5:1, the electrophoresis band completely disappeared, confirming that the PEI / Fe3O4 composite completely complexed with the siRNA. Based on this, N / P = 10:1 was selected for subsequent experiments. Figure 2

[0069] S4, Preparation of PEI / Fe3O4@siGPX4 Nanocomposite

[0070] ​​The PEI / Fe3O4 complex obtained in step S3 was diluted with DEPC water to 40 μg / mL for standby. The siGPX4 dry powder was diluted to 5 µM according to the instructions, and then the PEI / Fe3O4 complex (2.36 μL) was mixed with siRNA (1 μL) (N / P ratio of 10:1) in a 200 μL centrifuge tube. After uniform mixing, the centrifuge tube was incubated at room temperature for 30 min to obtain the PEI / Fe3O4@siGPX4 nanocomposite.

[0071] (1) The morphology, particle size and PDI of the PEI / Fe3O4@siGPX4 nanocomposite were characterized by TEM and DLS techniques. As shown in Figure 3 , the hydrodynamic diameter was 63.01 nm, which was much larger than the particle size measured by TEM. This data showed that the particle size and potential of this nanocomposite met the requirements for entering cells, creating favorable conditions for efficient delivery of siRNA.

[0072] (2) Gel retardation method was used to detect the effect of HA on the siRNA complexing ability of PEI / Fe3O4 complex.

[0073] ① The PEI / Fe3O4 complex was diluted with DEPC water to 40 μg / mL and 4 μg / mL, and the HA was diluted to 400 μg / mL and 40 μg / mL. The siRNA dry powder was diluted to 5 µM according to the instructions for standby.

[0074] ② In a 200 μL centrifuge tube, the PEI / Fe3O4 complex was complexed with siRNA according to the N / P ratio of 10:1 for 30 min.

[0075] ③ Then the HA was complexed with PEI in the PEI / Fe3O4@siRNA complex according to different mass ratios (m HA / m PEI =0:1, 0.25:1, 0.5:1, 0.75:1, 1:1, 2:1, 3:1, 5:1, 7:1, 10:1) for 1 h.

[0076] ④ After the complexation was completed, the total volume was made up to 10 μL with DEPC water, and then 2 μL of DNA Loading buffer containing 1% SDS was added to the centrifuge tube containing the PEI / Fe3O4@siRNA nanocomposite without HA, and agarose gel electrophoresis was performed. As shown in Figure 4 , with the increase of m HA / m PEI , the siRNA band gradually became brighter, indicating that siRNA was shed from the nanocomposite under the action of HA. When m HA / m PEINo band of released siRNA was detected when the mass ratio was less than 0.5:1, indicating that the introduction of HA did not affect the complexation of siRNA at this mass ratio. Based on the above, we decided to use the condition of a mass ratio of 0.5:1 to complex siRNA for subsequent experiments. HA / m PEI The condition of a mass ratio of 0.5:1 was used to complex siRNA for subsequent experiments.

[0077] S5, Preparation of HA / PEI / Fe3O4@siGPX4 Nanocomposites

[0078] HA was diluted with water to 40 μg / mL, then 1.13 μL of HA solution was mixed with the PEI / Fe3O4@siGPX4 nanocomposites obtained in step S4 according to a mass ratio (m HA / m PEI ) of 0.5:1 at room temperature for 1 h of complexation, thereby obtaining HA / PEI / Fe3O4@siGPX4 nanocomposites.

[0079] Effect Test 1

[0080] The HA / PEI / Fe3O4@siGPX4 nanocomposites prepared in Example 1 were characterized as follows:

[0081] (1) The morphology, elemental composition, particle size, and PDI of the HA / PEI / Fe3O4@siGPX4 nanocomposites prepared in Example 1 were characterized by transmission electron microscopy element imaging technology and dynamic light scattering (DLS) technology. From Figure 5 , it can be observed from Figure 5 (a) that the specific morphology of the HA / PEI / Fe3O4@siGPX4 nanocomposites; Figure 5 (b) of the HA / PEI / Fe3O4@siGPX4 nanocomposites has a hydrodynamic diameter of 77.28 nm and a PDI of 0.210. Figure 5 (c) is the obtained element mapping image, which shows that the HA / PEI / Fe3O4@siRNA nanocomposites contain five elements: carbon (C), nitrogen (N), oxygen (O), iron (Fe), and phosphorus (P). The above results show that the HA / PEI / Fe3O4@siGPX4 nanocomposites were successfully prepared.

[0082] (2) The Zeta potential of the water-soluble Fe3O4 nanoparticles, PEI, PEI / Fe3O4 complex, PEI / Fe3O4@siRNA nanocomposites, HA, and HA / PEI / Fe3O4@siRNA nanocomposites prepared in Example 1 was detected. The results are shown in Figure 6As shown in Table 1, the zeta potential of Fe3O4 nanoparticles is -34.17 mV, the zeta potential of PEI is 15.00 mV, the zeta potential of the prepared PEI / Fe3O4 complex is 23.97 mV, the zeta potential of the PEI / Fe3O4@siRNA complex obtained after the complexation of the PEI / Fe3O4 complex with siRNA is 20.93 mV, and the zeta potential of the final product HA / PEI / Fe3O4@siRNA nanocomplex obtained after the complexation of the PEI / Fe3O4@siRNA complex with HA is 5.54 mV. It can be seen that the introduction of HA reduces the surface charge of the PEI / Fe3O4@siRNA nanocomplex. The results of zeta potential also show that the HA / PEI / Fe3O4@siRNA nanocomplex is successfully prepared.

[0083] Table 1: Results of zeta potential detection

[0084] ;

[0085] Effect test 2

[0086] The serum stability of the HA / PEI / Fe3O4@siGPX4 nanocomplex prepared in Example 1 was investigated, as follows.

[0087] Free siRNA has poor stability and is easily degraded in a serum environment. Therefore, the agarose gel electrophoresis method was used to investigate whether the HA / PEI / Fe3O4@siRNA nanocomplex can enhance the serum stability of siRNA. The experimental group (HA / PEI / Fe3O4@siRNA nanocomplex) and the control group (free siRNA) were diluted to 10 μL with DMEM medium containing 10% and 50% fetal bovine serum (FBS), respectively, and incubated at 37°C for different time periods. After termination of the incubation, 2 μL of DNA Loading Buffer (without / with 1% SDS) was added for agarose gel electrophoresis. As shown in Figure 7 , the band of free siRNA gradually weakened in the medium containing 10% and 50% serum with the extension of time, and completely disappeared at 96 h and 12 h, respectively, indicating that the free siRNA was completely degraded. However, the band of siRNA can still be observed after 96 h and 72 h of incubation of the HA / PEI / Fe3O4@siRNA nanocomplex in the medium containing 10% and 50% serum, respectively. The results show that the prepared HA / PEI / Fe3O4@siRNA nanocomplex can protect siRNA from being degraded in a serum environment, thereby significantly improving the serum stability of siRNA.

[0088] Effect test 3

[0089] To investigate the cytotoxicity of the HA / PEI / Fe3O4 complex prepared in Example 1, the following was done:

[0090] The toxicity of PEI, PEI / Fe3O4 complex and HA / PEI / Fe3O4 complex to triple-negative breast cancer cells MDA-MB-468 was detected by MTT experiment. The results are shown in Figure 8 As shown in the figure, after MDA-MB-468 cells were incubated with the three materials for 48 h, the cell viability showed a regular downward trend with the increase of the concentration gradient. It is worth noting that under the same experimental conditions, the cell viability of the PEI / Fe3O4 complex and the HA / PEI / Fe3O4 complex treatment groups was always better than that of the PEI material group alone, and this difference was verified at all concentrations. It is worth noting that when the PEI concentration was 10 μM, the survival rate of MDA-MB-468 cells treated with HA / PEI / Fe3O4 complex was still as high as 76.66%, while the cell viability of PEI / Fe3O4 and PEI treatment groups was 65.82% and 12.15%, respectively. The results show that compared with PEI, the cytotoxicity of PEI / Fe3O4 complex is significantly reduced, and due to the introduction of negatively charged and biocompatible HA, the cytotoxicity of HA / PEI / Fe3O4 complex is further reduced, which is more suitable for siRNA delivery.

[0091] Effect test 4

[0092] To investigate the hemolytic activity of the HA / PEI / Fe3O4 complex prepared in Example 1, the following was done:

[0093] Due to the high positive charge characteristics of the surface of the cationic polymer PEI, the lipid bilayer structure of the red blood cell membrane can be easily destroyed by electrostatic interaction, causing a dose-dependent hemolytic effect, which seriously restricts its applicability in systemic administration. Therefore, hemolysis experiment was used to systematically evaluate the red blood cell compatibility of PEI, PEI / Fe3O4 complex and HA / PEI / Fe3O4 complex. Equal amounts of red blood cell suspension were incubated with different concentrations (2.5 μM, 5 μM, 10 μM) of complex solution, and then the hemolysis of red blood cells was observed and the hemolysis rate was detected. The results are shown in Figure 9 Figure 9 Figure (a) is a photograph of the centrifuge tube after centrifugation of each treatment group. It can be seen that there is no sediment at the bottom of the tube in the 0.1% Triton treatment group, indicating that the red blood cells are broken and hemolysis occurs. Similarly, there is also very little red sediment at the bottom of the tube in the PEI treatment group. Red blood cell sediment can be observed at the bottom of the tube in the PBS group, and more red sediment can also be observed at the bottom of the tube in the HA / PEI / Fe3O4 complex treatment group. Figure 9 ​(b) is the hemolysis rate quantitative analysis result, under three concentration treatments, PEI / Fe3O4 complex and HA / PEI / Fe3O4 complex both reduce the hemolysis rate of PEI, and the effect of HA / PEI / Fe3O4 complex is more obvious. It is worth noting that when the concentration of PEI is 10 μM, the hemolysis rate after treatment with HA / PEI / Fe3O4 complex is 6.63%, while the hemolysis rates of PEI / Fe3O4 complex and PEI treatment group are 15.61% and 18.94% respectively. This result confirms that HA / PEI / Fe3O4 complex has good blood compatibility, effectively balancing the gene loading capacity and biological safety of cationic carrier PEI.

[0094] Effect test 5

[0095] The siGPX4 in vitro release rate of the HA / PEI / Fe3O4@siGPX4 nanocomposite prepared in Example 1 was investigated, and the specific steps were as follows:

[0096] The FAM-labeled HA / PEI / Fe3O4@siGPX4 nanocomposite was placed in an environment with a pH of 7.4 and 6.5 to simulate the physiological environment and the acidic microenvironment of the tumor, respectively, and then centrifuged to collect the supernatant after incubation in a 37°C cell incubator for different times. The siGPX4 fluorescence intensity in the supernatant collected at different time periods was detected by a fluorescence microplate reader, and the siGPX4 in vitro release rate was calculated accordingly. The results are shown in Figure 10 Under the condition of simulating the acidic microenvironment of the tumor (pH 6.5), the siGPX4 in the HA / PEI / Fe3O4@siGPX4 nanocomposite was completely released at 12 h. Under physiological conditions (pH 7.4), the cumulative release amount was only 9.05% at 48 h, indicating that the nanocomposite stably exists under physiological conditions, which can reduce the toxicity to normal tissues; and when reaching the acidic microenvironment of the tumor, siGPX4 can be efficiently released, thereby exerting an anti-tumor effect.

[0097] Effect test 6

[0098] The siGPX4 delivery performance and gene silencing efficiency of the HA / PEI / Fe3O4@siGPX4 nanocomposite prepared in Example 1 were investigated, and the specific steps were as follows:

[0099] (1) Western blot was used to detect the expression of GPX4 in log phase MCF-7 and MDA-MB-468 breast cancer cells at the protein level, and the results are shown in Figure 11As shown, the expression level of GPX4 in triple negative breast cancer MDA-MB-468 cells is obviously higher than that in MCF-7 cells. The quantitative analysis results show that the relative expression amount of GPX4 in MCF-7 cells is 0.34, and the relative expression amount of GPX4 in MDA-MB-468 cells is 0.97. These results fully demonstrate that GPX4 has a higher expression level in triple negative breast cancer MDA-MB-468 cells.

[0100] Therefore, MDA-MB-468 cells with high expression of GPX4 are selected for subsequent experiments.

[0101] (3) Intracellular internalization behavior of HA / PEI / Fe3O4@siGPX4 nanocomposites.

[0102] 1) The cover glass soaked in alcohol for slide preparation was placed in the ultraviolet for half an hour in advance in the clean bench, and then the cover glass was placed in a 12-well plate, and MDA-MB-468 cells were inoculated into the 12-well plate and adherent cultured at 37°C, 5% CO2 for 12 hours.

[0103] 2) FAM-labeled siGPX4 was used to prepare free siGPX4, PEI / Fe3O4@siGPX4 nanocomposite and HA / PEI / Fe3O4@siGPX4 nanocomposite containing DMEM medium without double antibody, and the final concentration of siGPX4 was 50nM. From this step, the subsequent steps were in the dark.

[0104] 3) Three holes in the 12-well plate were selected, the original culture medium was discarded, and the HA-containing DMEM medium without double antibody was used for pretreatment for 2h, and the final concentration of HA was 10mg / mL. After 2h, the above-mentioned DMEM medium containing HA / PEI / Fe3O4@siGPX4 nanocomposite was added. The original culture medium in the remaining holes of the 12-well plate was discarded, and the nanocomposite-containing medium prepared in step 2) was added and incubated in a cell incubator for 12h.

[0105] 4) After the incubation time was over, the nanocomposite-containing culture medium was discarded, and PBS was washed three times, paying attention to gentle action. Then 4% paraformaldehyde fixing solution (200μL / hole) was added and incubated in the dark for 30min, the purpose of which was to fix the cells.

[0106] 5) After 30min, the fixing solution was discarded, and PBS was washed three times, and DAPI (200μL / hole) was added and incubated in the dark for 10min to stain the cell nucleus.

[0107] 6) After the staining was completed, the DAPI was recovered, and PBS was washed three times.

[0108] 7) Finally, anti-fade mounting medium was added on the glass slide, and the coverslips were removed from the well plate with special tweezers, and the cell adhesion side was buckled on the position where the anti-fade mounting medium was dropped. After the mounting operation was completed, it was placed aside to dry naturally. After drying, the laser scanning confocal microscope was used to observe and record the uptake of cells treated by each treatment group.

[0109] 8) The FAM fluorescence intensity was quantitatively analyzed by Image J software. The calculation formula was: FAM relative fluorescence intensity (%) = (FAM labeled green fluorescence intensity / DAPI labeled blue fluorescence intensity) x 100%.

[0110] The results are shown in Figure 12 DAPI staining made the cell nucleus blue, and FAM labeled siGPX4 was green. The free siGPX4 group had weak green fluorescence, indicating that it was difficult to be effectively taken up by cells. The green fluorescence of the PEI / Fe3O4@siGPX4 nanocomposite treatment group was enhanced by 13.35 times that of the free siGPX4 group. The green fluorescence of the HA / PEI / Fe3O4@siGPX4 nanocomposite treatment group was the strongest, which was 22.64 times that of the free siGPX4 group. It can be observed that the green fluorescence of HA / PEI / Fe3O4@siGPX4 nanocomposite after HA pretreatment (HA+HA / PEI / Fe3O4@siGPX4) was significantly reduced, and its fluorescence intensity was close to that of the PEI / Fe3O4@siGPX4 nanocomposite treatment group, which was 15.38 times that of the free siGPX4 group. This is because MDA-MB-468 cells highly express CD44 receptors on the cell surface, and HA can specifically bind to CD44 receptors. When the cells are pretreated with HA, the binding of HA / PEI / Fe3O4@siGPX4 nanocomposites to CD44 receptors on the cell surface is competitively inhibited. Based on the above phenomenon, it can be known that HA / PEI / Fe3O4@siGPX4 nanocomposites can enhance the uptake of MDA-MB-468 cells to nanocomposites through CD44 receptor-mediated endocytosis, and thus significantly improve the delivery efficiency of siGPX4.

[0111] (4) The gene silencing efficiency of HA / PEI / Fe3O4@siGPX4 on GPX4 was analyzed at the mRNA and protein levels by qPCR and Western blot, respectively.

[0112] MDA-MB-468 cells were seeded into 6-well cell culture plates and adherent cultured at 37 °C, 5% CO2 for 12 h. After the old medium was discarded, the no secondary antibody DMEM medium containing free siGPX4, PEI / Fe3O4@siGPX4 nanocomposites and HA / PEI / Fe3O4@siGPX4 nanocomposites (wherein the siGPX4 concentration was set to 25 nM and 50 nM) were prepared and added to different wells, respectively, and then placed in the cell incubator for continued incubation for 48 h.

[0113] The RNA of each cell was extracted by a kit, and the high-quality RNA was reversely transcribed into cDNA by a kit. The RT-PCR was performed by using the following primers: the primers of GPX4 were shown in SEQ ID NO. 1 and SEQ ID NO. 2, and the primers of GAPDH were shown in SEQ ID NO. 3 and SEQ ID NO. 4. The program was set as follows: 94 °C for 2 min; 94 °C for 15 s, 60 °C for 15 s, 72 °C for 30 s, 40 cycles.

[0114] SEQ ID NO. 1: ACAAGAACGGCTGCGTGGTGAA

[0115] SEQ ID NO. 2: GCCACACACTTGTGGAGCTAGA

[0116] SEQ ID NO. 3: AAGGTCGGAGTCAACGGATTT

[0117] SEQ ID NO. 4: CCTGGAAGATGGTGATGGGATT

[0118] The cells were cultured by using the above method, the siGPX4 concentration was set to 50 nM, and the protein of each cell was extracted by a kit for Western blot after the incubation.

[0119] The results are shown in Figure 13 At the concentration of 25 nM and 50 nM, compared with other treatment groups, the HA / PEI / Fe3O4@siGPX4 nanocomposites showed the strongest gene knockout efficiency, and the mRNA relative levels were 0.64 and 0.38, respectively; and the mRNA relative levels of the PEI / Fe3O4@siGPX4 nanocomposites treatment group were 0.84 and 0.75, respectively. It showed that under the guidance of HA, the nanocomposites could effectively deliver siGPX4 to tumor cells, thereby significantly inhibiting the expression of GPX4 at the mRNA level.

[0120] The Western blot detection results further showed that the expression of GPX4 was significantly reduced after treatment with the HA / PEI / Fe3O4@siGPX4 nanocomposite.

[0121] The Western blot detection results were analyzed by gray scale analysis using Image J software Figure 13 The results showed that the relative expression of GPX4 in the HA / PEI / Fe3O4@siGPX4 nanocomposite treatment group was 0.41, which was significantly lower than that in the other treatment groups.

[0122] Effect test 7

[0123] The anti-tumor activity of the HA / PEI / Fe3O4@siGPX4 nanocomposite prepared in Example 1 was evaluated as follows:

[0124] (1) MTT method was used to evaluate cell proliferation. The original culture medium in the adherent MDA-MB-468 cells was removed, and free siGPX4, PEI / Fe3O4@siGPX4 and HA / PEI / Fe3O4@siGPX4 nanocomposites diluted with fresh DMEM medium without secondary antibody were added with or without the addition of H2O2 (H2O2 concentration: 100 μM). The final concentration of siGPX4 in each treatment group was set to 100 nM, 200 nM and 400 nM, respectively. After addition, they were placed in the incubator, and the cell viability was detected by MTT colorimetric method after 48 h of culture. As shown in Figure 14 , the survival rate of each group of cells decreased in a dose-dependent manner. When the concentration of siGPX4 was 400 nM, the survival rate of the HA / PEI / Fe3O4@siGPX4 nanocomposite group decreased to 58.51% without H2O2, and further decreased to 41.73% in the presence of H2O2 in the simulated tumor microenvironment; the survival rate of the PEI / Fe3O4@siGPX4 nanocomposite group was 77.80% (without H2O2) and 67.82% (with H2O2), respectively; and the survival rate of the free siGPX4 group was higher than 87% under both conditions and showed no significant difference. These results showed that the HA / PEI / Fe3O4@siGPX4 nanocomposite could significantly inhibit the proliferation of MDA-MB-468 cells in the presence of H2O2 in the simulated tumor microenvironment.

[0125] (4) EdU staining method was used to evaluate cell proliferation.

[0126] MDA-MB-468 cells were incubated with free siGPX4, PEI / Fe3O4@siGPX4 and HA / PEI / Fe3O4@siGPX4 nanocomplexes for 48 hours under the conditions of no addition of H2O2 and addition of H2O2. Subsequently, the effect of cell proliferation inhibition of different treatment groups was further detected by EdU cell proliferation kit. The results are shown in Figure 15 As shown, compared with the control group and other treatment groups, the red fluorescence intensity of the HA / PEI / Fe3O4@siGPX4 nanocomplex treatment group was significantly weakened under the conditions of containing H2O2 and not containing H2O2. Quantitative analysis results show that the EdU positive rate of the control group is 42.35% without H2O2 and 41.99% with H2O2; the EdU positive rate of the free siGPX4 group is reduced to 37.49% and 36.32% under the conditions of no H2O2 and containing H2O2, respectively; the EdU positive rate of the PEI / Fe3O4@siGPX4 nanocomplex group is reduced to 29.32% and 23.25% without H2O2 and with H2O2, respectively; the EdU positive rate of the HA / PEI / Fe3O4@siGPX4 nanocomplex group is 20.42% without H2O2 and is further reduced to 8.31% with H2O2. The EdU staining results are consistent with the experimental detection results of Calcein-AM / PI double staining method, which also shows that the HA / PEI / Fe3O4@siGPX4 nanocomplex can efficiently kill MDA-MB-468 cells, and the cell killing effect of the HA / PEI / Fe3O4@siGPX4 nanocomplex is more prominent in the presence of H2O2.

[0127] (5) Detection of the content of ferrous ions in MDA-MB-468 cells after treatment with HA / PEI / Fe3O4@siGPX4 nanocomplex.

[0128] After free siGPX4, PEI / Fe3O4@siGPX4 nanocomplex and HA / PEI / Fe3O4@siGPX4 nanocomplex were incubated with MDA-MB-468 cells for 48 h, the content of ferrous ions was detected by ferrous ion content detection kit. According to the concentration and absorbance ΔA of the standard tube of the kit, the standard curve y=0.0076x-0.0008 was established. Then the absorbance of the determination tube was substituted to calculate the content of ferrous ions. The results are shown in Figure 16 Compared with the control group, the content of ferrous ions in the free siGPX4 treatment group almost did not change, both of which were about 6 µmol / 10 6 cells, with no significant difference; the content of ferrous ions in the PEI / Fe3O4@siGPX4 nanocomplex treatment group increased to 9.97 µmol / 106 cell; while the content of ferrous ions in the HA / PEI / Fe3O4@siGPX4 nanocomposite treatment group increased significantly, reaching 13.38 µmol / 10 6 cell. This result is consistent with the results of the cell uptake experiment, indicating that the more the cell uptakes the nanocomposite, the more ferrous ions enter the cell to participate in the Fenton reaction, which is more conducive to the occurrence of ferroptosis in the cell.

[0129] (6) The hydroxyl radical generation capacity of HA / PEI / Fe3O4@siGPX4 nanocomposite was detected by spectrophotometer.

[0130] After the HA / PEI / Fe3O4@siGPX4 nanocomposite enters the tumor cells, it will be wrapped in organelles such as endosomes or lysosomes. The acidic environment and rich hydrolytic enzymes and other substances inside these organelles will further promote the decomposition of Fe3O4 to generate Fe 2+ and Fe 3+ , Fe 2+ and H2O2 accumulated in tumor cells will undergo Fenton reaction to produce highly toxic ·OH, as shown in the following reaction equation. High levels of reactive oxygen species in vivo will cause oxidative damage to cell components and metabolic dysfunction, thereby triggering cellular ferroptosis.

[0131] ;

[0132] ;

[0133] ;

[0134] To detect the hydroxyl radical generation capacity of the nanocomposite, different concentrations of each treatment group were incubated with H2O2 and MB in an acidic environment for 1 hour, and then the absorbance of MB at 664 nm was detected by spectrophotometer. The degree of absorbance reduction was used to indirectly infer the content or generation of ·OH in the system. As shown in Figure 17 , the absorbance was 1.877 when only MB was present; the absorbance of the free siGPX4 group did not change at two concentrations, maintaining around 1.87. When the siGPX4 concentration was 200 nM, the absorbance of the PEI / Fe3O4@siGPX4 and HA / PEI / Fe3O4@siGPX4 nanocomposite treatment groups was around 1.6; when the siGPX4 concentration was 400 nM, the absorbance of these two groups was around 1.4. The above results show that the nanocomposite can generate more hydroxyl radicals in the presence of H2O2 under weakly acidic conditions, which is more conducive to the occurrence of ferroptosis.

[0135] (7) ROS content detection.

[0136] Increased ROS levels are a hallmark event of ferroptosis. Downregulation of GPX4 expression and Fe... 2+ H2O2-mediated Fenton reaction can synergistically induce intracellular ROS accumulation. To systematically evaluate the ROS-regulating effect of HA / PEI / Fe3O4@siGPX4 nanocomposites, MDA-MB-468 cells were incubated with free siGPX4, PEI / Fe3O4@siGPX4, and HA / PEI / Fe3O4@siGPX4 nanocomposites (final siGPX4 concentration: 200 nM) for 48 h, respectively. ROS production was detected using the DCFH-DA fluorescent probe. The DCFH-DA probe itself is non-fluorescent; it is hydrolyzed to DCFH by intracellular esterases, and subsequently oxidized by ROS to generate the green fluorescent product DCF. The fluorescence intensity of DCF is positively correlated with ROS levels. Intracellular ROS levels were then detected using laser confocal microscopy and flow cytometry. The results are as follows: Figure 18 As shown, cells treated with the HA / PEI / Fe3O4@siGPX4 nanocomposite exhibited bright green fluorescence, especially in the presence of H2O2, where the fluorescence intensity was highest. Normalizing the fluorescence intensity of the H2O2-treated HA / PEI / Fe3O4@siGPX4 nanocomposite group to 100%, this group showed a significant difference in fluorescence intensity compared to the control group and other treatment groups, indicating that this treatment group had the most significant ROS accumulation. Flow cytometry analysis ( Figure 18 b and Figure 18 d) further confirms the above trend: the fluorescence intensity of the free siGPX4 group was not significantly different from the control group under both conditions; the fluorescence intensity of the PEI / Fe3O4@siGPX4 group increased by 155 times compared with the control group under the condition without H2O2; and further increased by 288 times under the condition containing H2O2. The fluorescence intensity of the HA / PEI / Fe3O4@siGPX4 group increased by 352 times (without H2O2) and 508 times (with H2O2) compared with the control group, respectively. In summary, the HA / PEI / Fe3O4@siGPX4 nanocomposite induces ferroptosis through a dual mechanism: ① siRNA silences GPX4 expression, weakening the cellular antioxidant defense system; ② Fe3O4 releases Fe... 2+ It undergoes a Fenton reaction with H₂O₂, continuously generating reactive oxygen species such as ·OH. Both of these factors contribute to the explosive accumulation of ROS, ultimately triggering ferroptosis in cells.

[0137] (8) Mitochondrial membrane potential was detected by JC-1 staining.

[0138] The decrease of mitochondrial membrane potential is also a significant feature of ferroptosis. When the mitochondrial membrane potential is high, JC-1 exists in the form of polymer, which can produce red fluorescence; when the mitochondrial membrane potential decreases, JC-1 changes into monomer form, which can produce green fluorescence. Therefore, after the MDA-MB-468 cells were incubated with free siGPX4, PEI / Fe3O4@siGPX4 and HA / PEI / Fe3O4@siGPX4 nanocomposites (the final concentration of siGPX4 was 200 nM) for 48 h, the changes of mitochondrial membrane potential were detected by JC-1 staining method. The results are shown in Figure 19 As shown in the figure, compared with the control group and other treatment groups, a large number of green fluorescence can be observed in the HA / PEI / Fe3O4@siGPX4 nanocomposite treatment group, especially under the condition of adding H2O2, the green fluorescence is the strongest. The quantitative analysis results show that: the JC-1 monomer fluorescence intensity of the free siGPX4 group has no obvious difference under the two conditions compared with the control group; the JC-1 monomer fluorescence intensity of the PEI / Fe3O4@siGPX4 group increases to 15.19% under the condition of no H2O2, and further increases to 21.09% under the condition of containing H2O2. The JC-1 monomer fluorescence intensity of the HA / PEI / Fe3O4@siGPX4 group increases to 68.12% (without H2O2) and 88.96% (with H2O2), respectively. This result shows that the HA / PEI / Fe3O4@siGPX4 nanocomposite can cause ferroptosis of tumor cells and lead to the decrease of mitochondrial membrane potential, and the effect is stronger in the presence of H2O2.

[0139] (9) Mitochondrial morphology was detected by TEM.

[0140] When ferroptosis occurs, the morphology of cell mitochondria will appear typical changes, such as disappearance of mitochondrial cristae, decrease in volume, and increase in membrane density. In order to explore the effect of each treatment group on the morphology of MDA-MB-468 cells, the transmission electron microscope was used to observe the changes of mitochondrial morphology, and the results are shown in Figure 20 Compared with the control group, after the free siGPX4, PEI / Fe3O4@siGPX4 and HA / PEI / Fe3O4@siGPX4 nanocomposites were incubated with cells for 48 hours, the morphology of cell mitochondria changed to different degrees, showing typical characteristics of ferroptosis such as disappearance of mitochondrial cristae, decrease in volume, and increase in membrane density. Among them, the changes of the above-mentioned cells treated with HA / PEI / Fe3O4@siGPX4 nanocomposites were the most significant. This indicates that the HA / PEI / Fe3O4@siGPX4 nanocomposite can cause cell death by inducing ferroptosis.

[0141] Therefore, the nanocomposite HA / PEI / Fe3O4@siRNA is successfully prepared, the hydrodynamic diameter is 77.28 nm, the PDI is 0.210, and the potential is 5.54 mV; the serum stability is high, the cytotoxicity to normal tissue cells is low, when reaching the acidic microenvironment of tumor, siGPX4 can be efficiently released to exert an anti-tumor effect, and the nanocomposite has good blood compatibility; the nanocomposite can specifically target triple-negative breast cancer cells, greatly improve the internalization ability of triple-negative breast cancer MDA-MB-468 cells, improve the uptake rate of triple-negative breast cancer MDA-MB-468 cells, and then significantly improve the delivery efficiency of siGPX4; in the presence of H2O2, the nanocomposite can down-regulate the expression of GPX4, the released ferrous ions can undergo Fenton reaction with H2O2, thereby causing a significant increase in intracellular ROS, causing a decrease in mitochondrial membrane potential, and then triggering ferroptosis and significantly inhibiting the proliferation of MDA-MB-468 cells, thereby exerting an anti-tumor effect.

[0142] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, but not to limit them, although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that: it can still modify or equivalently replace the technical solutions of the present application, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. A method for preparing a nanocomposite HA / PEI / Fe3O4@siRNA, characterized in that, Includes the following steps: S1. Preparation of hydrophobic Fe3O4 nanoparticles: Iron acetylacetonate, 1,2-dodecyl diol, oleic acid, oleylamine and benzyl ether were added to a container in sequence for pyrolysis reaction. After the reaction was completed, the mixture was cooled to room temperature to obtain a black mixture. Anhydrous ethanol was added and centrifuged. The precipitate was dispersed in a mixed solvent and centrifuged. The supernatant was added to anhydrous ethanol and centrifuged. After the precipitate was dried, it was obtained as hydrophobic Fe3O4 nanoparticles. S2. The obtained hydrophobic Fe3O4 nanoparticles were subjected to phase transfer. 3,4-Dihydroxycinnamic acid was dissolved in tetrahydrofuran and then added dropwise to the tetrahydrofuran dispersion of hydrophobic Fe3O4 nanoparticles obtained in S1 under a protective atmosphere and stirring. After the addition was completed, the reaction was continued for 3 hours. After the reaction was completed, the mixture was cooled to room temperature, and then 0.5M NaOH solution was added. The precipitate was collected by centrifugation and lyophilized to obtain hydrophilic Fe3O4 nanoparticles. S3. Preparation of PEI / Fe3O4 complex: Polyethyleneimine and hydrophilic Fe3O4 nanoparticles obtained in S2 are dissolved in ultrapure water respectively. Then, the aqueous solution of Fe3O4 nanoparticles is added dropwise to the aqueous solution of polyethyleneimine. After the reaction is completed, freeze-drying is performed to obtain PEI / Fe3O4 complex. S4. Prepare PEI / Fe3O4@siRNA nanocomposite. Mix the DEPC aqueous solution of the PEI / Fe3O4 composite obtained in S3 with the aqueous solution of siRNA, and incubate at room temperature to obtain the PEI / Fe3O4@siRNA nanocomposite. S5. Preparation of HA / PEI / Fe3O4@siRNA nanocomposite: The aqueous solution of hyaluronic acid was stirred and mixed with the PEI / Fe3O4@siRNA nanocomposite obtained in S4 and reacted. After the reaction was completed, the HA / PEI / Fe3O4@siRNA nanocomposite was obtained. The mass-to-volume ratio of hydrophobic Fe3O4 nanoparticles in S2: tetrahydrofuran: 3,4-dihydroxycinnamic acid is 20 mg: 11 mL: 50 mg; the volume ratio of 0.5 M NaOH solution to the mixed liquid cooled to room temperature is 1:22; before freeze-drying, the precipitate needs to be dried with nitrogen, dispersed in ultrapure water, and then freeze-dried. The siRNA is siGPX4; The N / P ratio of the PEI / Fe3O4 complex to siRNA in S4 is 10:1; The molar ratio of acetylacetone iron, 1,2-dodecyl diol, oleic acid, oleylamine, and benzyl ether in S1 is 1:5:3:3:53; the pyrolysis reaction conditions are stirring, reaction at 200℃ for 2 hours under a protective atmosphere, followed by reaction at 300℃ for 1 hour; the volume ratio of black mixture to anhydrous ethanol is 1:2-3. The mixed solvent in S1 is a mixture of oleic acid, oleylamine and n-hexane, with a volume ratio of oleic acid:oleylamine:n-hexane of 1:1:200; the volume ratio of supernatant to anhydrous ethanol is 1:2-3; the precipitate is dried by blowing with nitrogen.

2. The method for preparing the nanocomposite HA / PEI / Fe3O4@siRNA according to claim 1, characterized in that: The mass-to-volume ratio of hydrophilic Fe3O4 nanoparticles, polyethyleneimine, and ultrapure water in S3 is 5 mg: 25 mg: 22 mL. The aqueous solution of polyethyleneimine is stirred for 5 min, and then the aqueous solution of Fe3O4 nanoparticles is added dropwise. After the addition is complete, stirring is continued for 30 min.

3. The method for preparing the nanocomposite HA / PEI / Fe3O4@siRNA according to claim 1, characterized in that: In S5, the mass ratio of PEI in the hyaluronic acid:PEI / Fe3O4@siRNA nanocomposite is 0.5:1; the reaction condition is incubation at room temperature for 1 h.

4. The nanocomposite HA / PEI / Fe3O4@siRNA prepared by the method for preparing the nanocomposite HA / PEI / Fe3O4@siRNA as described in any one of claims 1 to 3.

5. The application of the nanocomposite HA / PEI / Fe3O4@siRNA as described in claim 4 in the preparation of a therapeutic drug for triple-negative breast cancer, characterized in that: The drug contains a nanocomplex HA / PEI / Fe3O4@siRNA; the siRNA in the nanocomplex HA / PEI / Fe3O4@siRNA is siGPX4.

Citation Information

Patent Citations

  • PEI and targeting peptide modified magnetic nano-carrier as well as preparation method and application thereof

    CN119745834A