Photosensitive cell specific bidirectional promoter and application thereof

Abstract

The invention relates to a photoreceptor cell specific bidirectional promoter and application thereof. Specifically, the invention relates to a novel photoreceptor cell specific bidirectional promoter, an expression cassette containing the bidirectional promoter, a vector, a viral particle, a cell and a pharmaceutical composition, and application of the bidirectional promoter to treatment of eye diseases, such as retinal diseases.

Description

Technical Field

[0001] The present invention relates to the fields of bioengineering and medicine. Specifically, the present invention relates to a novel photosensitive cell-specific bidirectional promoter, an expression cassette, a vector, a viral particle, a cell, and a pharmaceutical composition comprising the bidirectional promoter, and the use thereof for treating eye diseases, such as retinal diseases. Background Art

[0002] Inherited retinal diseases (IRDs) are one of the most common genetic diseases in humans and are a group of heterogeneous genetic diseases that affect the retina. These diseases cause visual impairment due to, for example, dysfunction and degeneration of photoreceptors, retinal pigment epithelium, or choroid, or vision loss due to improper development, dysfunction, or premature death of retinal photoreceptor cells. Common forms of IRD include retinitis pigmentosa (RP), cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), macular dystrophy (MD), and achromatopsia (rod monochromacy), etc. IRD is also one of the diseases with the strongest genetic heterogeneity in humans, and more than 270 related genes have been identified so far. It can be inherited in an autosomal recessive (AR), autosomal dominant (AD), or X-linked (XL) manner. In addition, mitochondrial and digenic inheritance patterns have also been reported. The pathogenesis of IRD often involves apoptotic responses due to gene mutations in photoreceptor cells themselves or an imbalanced retinal microenvironment (such as neovascularization, death of retinal pigment epithelial cells, etc.) that exacerbates photoreceptor apoptosis.

[0003] The retina includes various cells, among which the outer nuclear layer is mainly composed of photoreceptor cells. Photoreceptor cells, also known as photoreceptor cells, are a special type of neuroepithelial cells located in the retina that have the function of converting light signals and can sense light or color. In mammals, photoreceptor cells include rod cells, cone cells, and intrinsically photosensitive retinal ganglion cells.

[0004] Rod cells and cone cells have different functions. Rod cells are responsible for perceiving the intensity of light and mainly dominate vision in dark environments or at night. Rod cells are extremely sensitive and can be triggered by a single photon. If rod cells are damaged, it will cause a decrease in dark adaptation ability and it is difficult to see clearly in low light. Cone cells have a high resolution ability for strong light and color. If cone cells are damaged, it will cause color weakness, and in severe cases, it will affect the photopic response, and may even be accompanied by varying degrees of damage to rod cells, further affecting the scotopic response.

[0005] According to the pathogenesis of inherited retinal diseases, current treatment strategies mainly focus on (1) overexpressing or gene editing to repair related mutant genes to delay photoreceptor degeneration; (2) inhibiting neovascularization to reduce damage to photoreceptor cells; and (3) expressing photosensitive proteins in retinal cells to perform photosensitive functions.

[0006] The strategy of using retinal cells to express photosensitive proteins to restore vision is currently the most popular. Photosensitive proteins include endogenous photosensitive proteins (such as opsin, rhodopsin, melanopsin, etc.) and exogenous photosensitive proteins. It has been found that expressing endogenous photosensitive proteins or their respective fusions with metabotropic glutamate receptor mGLUR can restore partial vision in blind mice. Using exogenous photosensitive proteins, such as light-sensitive ion channel proteins (such as chr2, chrimsonR, MCO, etc.), has also achieved vision restoration in mice, and relevant products have entered clinical trials.

[0007] On the one hand, gene expression in retinal cells involves the use of promoters. A promoter is a cis-element that regulates gene expression, responsible for initiating the process of gene transcription and being able to effectively regulate the initiation, shutdown, and abundance of downstream gene expression, thereby enabling gene expression to produce the desired level of protein. There have been reports of using constitutive promoters to express target genes in retinal cells. Constitutive promoters can provide a strong but non-tissue-specific gene expression pattern in tissues. Constitutive eukaryotic promoters include promoters derived from the chicken β-actin (CBA) gene, phosphoglycerate kinase (PGK), or elongation factor 1α (EF1α). Other constitutive promoters of viral origin include the promoter derived from the cytomegalovirus (CMV) or synthetic promoter sequences such as CAG. However, it has been confirmed that the regulation of the CMV promoter depends on many cell signaling pathways that can alter the expression of the transgene. In addition, since these promoters are not limited to a given cell type and cause expression in all cells they are delivered to, such as cells in the retinal pigment epithelium (RPE), retina, and other eye tissues outside the retina such as the ciliary body, iris, cornea, etc., this can reduce the infection efficiency of target retinal cells and pose potential interference and risks.

[0008] To achieve specific expression of photosensitive proteins in retinal cells, especially photoreceptor cells, a specific promoter that can drive the efficient expression of the target gene is required, namely a cell-specific promoter. A cell-specific promoter is an important element in gene regulation, capable of initiating gene expression in a specific type of cell, thereby enabling the precise regulation of the function of the gene in a specific cell type. Therefore, it plays a key role in maintaining cell specificity and tissue specificity in an organism.

[0009] Cell-specific promoters can be an important resource for gene therapy applications. Using cell-specific promoters to design gene expression vectors can achieve gene therapy and gene regulation for specific cell types. In addition, the specificity of the promoter can also be used in gene editing technologies to achieve precise editing and regulation of specific cell populations.

[0010] There have been reports of tissue - specific promoters that cause expression in RPE or photoreceptor cells resulting in gene expression restricted to retinal cells. Promoters such as those based on RPE65, VMD2, and OA1 cause gene expression in RPE cells, while the promoters of human (RK) or bovine (RHO) rhodopsin kinases or the promoter of mouse opsin (mOP) cause expression restricted to photoreceptor cells.

[0011] On the other hand, delivery of an expression system to photoreceptor cells usually relies on viral infection, and among them, adeno - associated virus (AAV) is the most widely used. AAV has attracted much attention due to its safety, but because its vector capacity is very small, when carrying relatively large functional proteins (such as Cas9 protein, etc.) or expressing two or more target genes or proteins simultaneously, it is prone to problems such as a significant drop in virus titer due to the length exceeding the capacity. Obtaining a promoter with a small length but still retaining the ability to express downstream genes in specific tissues or cell types can solve this problem to a certain extent. Such a promoter can not only ensure the specific expression of the target gene but also reduce the capacity occupation of the AAV genome, thus facilitating the loading of larger or more target genes.

[0012] Promoters include two categories: unidirectional promoters and bidirectional promoters. Bidirectional promoters can drive the expression of downstream structural genes on both the sense and antisense strands respectively. Compared with traditional unidirectional promoters, bidirectional promoters can not only achieve the expression of a single foreign gene but also the simultaneous expression of two foreign genes, and have a more extensive application in fields such as synthetic biology and genetic engineering. The latest research shows that bidirectional promoters are widely present in both eukaryotes and prokaryotes. Since bidirectional promoters can drive the expression of downstream genes in both directions simultaneously, they are very suitable for use in virus vectors with a small loading capacity such as AAV. In addition, the number of promoters available for bioengineering is limited. When transferring multiple genes into an organism simultaneously using the same type of promoter or promoters with similar sequences, it may cause the "co - suppression" phenomenon of gene expression, resulting in gene silencing. However, because a bidirectional promoter can simultaneously achieve the expression of two foreign genes, it can avoid the occurrence of this undesirable transgenic silencing.

[0013] Nevertheless, there has been no report on the application of bidirectional promoters, especially photoreceptor - cell - specific bidirectional promoters, to the expression delivery system for photoreceptor cells.

[0014] Therefore, there is a strong demand for photoreceptor - cell - specific bidirectional promoters in the field of retinal disease treatment. Such bidirectional promoters contribute to the construction of a highly efficient expression system for delivery to photoreceptor cells. Screening and identifying highly efficient photoreceptor - cell - specific bidirectional promoters is of great significance for understanding the mechanism of retinal cell fate determination, the occurrence and progression of related diseases, and especially the development of new treatment methods for retinal diseases. Summary of the Invention

[0015] In response to the need in the art for a photoreceptor cell-specific bidirectional promoter, the inventors of the present invention obtained a novel photoreceptor cell-specific bidirectional promoter through recombinant methods and identified the specificity and transcriptional activity of this promoter, thus completing the present invention. This novel photoreceptor cell-specific bidirectional promoter has important application value in the fields of bioengineering and medicine, especially in the treatment of retinal diseases.

[0016] In one aspect of the present invention, a bidirectional promoter is provided that has photoreceptor cell-specific promoter activity. In one embodiment, the bidirectional promoter is capable of bidirectionally driving the expression of downstream genes on the sense and antisense strands at a high level in photoreceptor cells.

[0017] In one embodiment, the bidirectional promoter comprises a nucleotide sequence having at least 70% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0018] In one embodiment, the bidirectional promoter comprises a nucleotide sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0019] In one embodiment, the bidirectional promoter comprises the nucleotide sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0020] In one embodiment, the bidirectional promoter consists of a nucleotide sequence having at least 70% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0021] In one embodiment, the bidirectional promoter consists of a nucleotide sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0022] In one embodiment, the bidirectional promoter consists of a nucleotide sequence as shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0023] In yet another aspect of the present invention, there is provided an expression cassette comprising the bidirectional promoter according to the present invention.

[0024] In one embodiment, the expression cassette further comprises a target nucleic acid operably linked to the bidirectional promoter as described in the present invention.

[0025] In one embodiment, the target nucleic acid encodes a therapeutic protein, a optogenetic driver protein or a reporter protein.

[0026] In one embodiment, the therapeutic protein may be selected from MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPA1, OPA3, OPA7 and ACO2, or may be a neurotrophic factor selected from GDNF, VEGF, CNTF, FGF2, BDNF and EPO, an anti-apoptotic protein selected from BCL2 and BCL2L1, an anti-angiogenic factor selected from endostatin, angiostatin and sFlt, an anti-inflammatory factor selected from IL10, IL1R1, TGFBI and IL4, or a rod cell-derived cone cell activity factor (RdCVF).

[0027] In one embodiment, the optogenetic driver protein may be an optogenetic activator, which is preferably selected from rhodopsin, photopsin, melanopsin, pinopsin, parapinopsin, VA-opsin, peropsin, neuropsin, encephalopsin, retinoschisin, RGR-opsin, microbial rhodopsins with redshifted spectral properties (such as ReaChR, Chrimson or ChrimsonR), vertebrate rhodopsins that recruit Gi / o signaling (such as short-wavelength vertebrate rhodopsin or long-wavelength vertebrate rhodopsin), channelrhodopsins from Chlamydomonas microalgae (such as channelrhodopsin-1 and channelrhodopsin-2) and variants of the above proteins; or an optogenetic inhibitor, which is preferably selected from halorhodopsin (such as NpHR, eNpHR2.0, eNpHR3.0 and Halo57), archaeal rhodopsin (such as Arch and AR-3), bacteriorhodopsin (such as eBR, proteorhodopsin and xanthorhodopsin), Mycosphaerella punctiformis fungal opsin (Mac), great white shark halorhodopsin and variants of the above proteins.

[0028] In one embodiment, the reporter protein may be selected from fluorescent proteins, calcium indicators, alkaline phosphatase, β-galactosidase, β-lactamase, horseradish peroxidase, and variants of the above proteins.

[0029] In one embodiment, the target nucleic acid encodes a Cas9 protein.

[0030] In one embodiment, the target nucleic acid encodes a nucleic acid selected from siRNA, shRNA, RNAi, miRNA, antisense RNA, ribozyme, and deoxyribozyme.

[0031] In yet another aspect of the present invention, there is provided a vector comprising the bidirectional promoter according to the present invention or the expression cassette according to the present invention.

[0032] In one embodiment, the vector is a viral vector.

[0033] In one embodiment, the viral vector is an adeno-associated virus (AAV) vector, a retroviral vector, or a parvovirus vector.

[0034] In one embodiment, the viral vector is a Moloney murine leukemia virus (MoMLV), MSCV, SFFV, MPSV, or SNV vector, a lentiviral vector (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), or equine infectious anemia virus (EIAV)), an adenovirus (Ad) vector, an adeno-associated virus (AAV) vector, a simian virus 40 (SV-40) vector, a bovine papillomavirus vector, an Epstein-Barr virus vector, a herpesvirus vector, a vaccinia virus vector, a Harvey murine sarcoma virus vector, a murine mammary tumor virus vector, a circovirus vector, or a Rous sarcoma virus vector.

[0035] In yet another aspect of the present invention, there is provided a viral particle comprising the vector according to the present invention.

[0036] In one embodiment, the vector is an AAV vector.

[0037] In one embodiment, the AAV serotype is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, and AAVdj. In a preferred embodiment, the AAV serotype is selected from AAV-2, AAV-5, AAV2-7m8, AAV-9, and AAV-8. In a more preferred embodiment, the AAV serotype is selected from AAV-2, AAV2-7m8, or AAV-8.

[0038] In yet another aspect of the present invention, there is provided a cell comprising the bidirectional promoter according to the present invention, the expression cassette according to the present invention, the vector according to the present invention, or the viral particle according to the present invention.

[0039] In one embodiment, the cell is a photoreceptor cell.

[0040] In one embodiment, the cell is a cone cell.

[0041] In one embodiment, the cell is a rod cell.

[0042] In one embodiment, the cell is a retinal pigment epithelial cell (RPE).

[0043] In one embodiment, the cell is a HEK293, HEK293T, BHK or CHO cell.

[0044] In yet another aspect of the present invention, there is provided a pharmaceutical composition comprising the bidirectional promoter according to the present invention, the expression cassette according to the present invention, the vector according to the present invention, the viral particle according to the present invention, or the cell according to the present invention, and a pharmaceutically acceptable excipient or carrier. The pharmaceutical composition is for treating or preventing eye diseases, preferably for treating or preventing retinal diseases, more preferably for treating or preventing inherited retinal diseases.

[0045] In one embodiment, the eye diseases are selected from retinitis pigmentosa (RP), age-related macular degeneration, Stargardt's disease, Leber's hereditary optic neuropathy, cone-rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroideremia, tapetoretinal degeneration, achromatopsia (rod monochromacy), retinal pigmentopathy, night blindness, X-linked retinoschisis, and Usher syndrome.

[0046] In yet another aspect of the present invention, there is provided a method for treating or preventing an eye disease, the method comprising administering to a subject in need thereof the bidirectional promoter according to the present invention, the expression cassette according to the present invention, the vector according to the present invention, the viral particle according to the present invention, the cell according to the present invention, or the pharmaceutical composition according to the present invention.

[0047] In one embodiment, the eye disease is selected from retinitis pigmentosa (RP), age-related macular degeneration, Stargardt's disease, Leber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroideremia, tapetoretinal degeneration, achromatopsia (rod monochromacy), retinitis pigmentosa, night blindness, X-linked retinoschisis, and Usher syndrome.

[0048] In one embodiment, the method further comprises administering to the subject one or more other therapies, such as administering one or more other therapeutic agents, gene therapy, immunotherapy, surgery, and the like.

[0049] In yet another aspect of the present invention, there is provided the use of the bidirectional promoter according to the present invention, the expression cassette according to the present invention, the vector according to the present invention, the viral particle according to the present invention, the cell according to the present invention, or the pharmaceutical composition according to the present invention in the preparation of a medicament for treating or preventing an eye disease.

[0050] In one embodiment, the eye disease is a hereditary retinal disease.

[0051] In one embodiment, the eye disease is selected from retinitis pigmentosa (RP), age-related macular degeneration, Stargardt's disease, Leber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroideremia, tapetoretinal degeneration, achromatopsia (rod monochromacy), retinitis pigmentosa, night blindness, X-linked retinoschisis, and Usher syndrome.

[0052] In yet another aspect of the present invention, there is provided a method for expressing a target polypeptide or nucleic acid in a cell, which comprises introducing the bidirectional promoter according to the present invention, the expression cassette according to the present invention, the vector according to the present invention, or the viral particle according to the present invention into the cell.

[0053] In one embodiment, the cell is a photoreceptor cell.

[0054] In one embodiment, the cell is a cone cell.

[0055] In one embodiment, the cell is a rod cell.

[0056] In one embodiment, the cell is a retinal pigment epithelial cell (RPE). BRIEF DESCRIPTION OF THE DRAWINGS

[0057] This application has generally described the subject matter of the present disclosure. The following drawings form a part of this specification and are included to further illustrate certain aspects of the invention. The invention can be better understood by referring to one or more of these drawings and combining with the detailed description of the specific embodiments presented herein.

[0058] Figure 1 The plasmid map of vector VB211226-1096bhj is shown, and this vector is used to verify the activity of the CA10 promoter in bidirectionally driving the expression of downstream genes.

[0059] Figure 2 The results of immunofluorescence staining experiments are shown after injecting vector pAAV[Exp]-{CA10}>NLS-EGFP:WPRE (containing the CA10 promoter) and vector pAAV[Exp]-{re_CA10}>NLS-EGFP:WPRE (containing the re_CA10 promoter) into the subretinal space of mice. The sections were photographed under three magnifications (40x / 100x / 200x) of a fluorescence microscope and corresponding exposure times (2000ms / 1000ms / 500ms). A total of three photos are shown from left to right at each magnification. The first photo from the left shows the expression of green fluorescent protein driven by the promoter observed alone; the second photo from the left is a merged image of the fluorescence (green) expressed by the cells and the immunofluorescence staining (red, indicating the cone cell surface protein in the photoreceptor cell layer) (the exposure times for each channel were adjusted); the third photo from the left is a merged image of the fluorescence (green) expressed by the cells, the immunofluorescence staining (red, indicating the cone cell surface protein in the photoreceptor cell layer), and the DAPI staining (blue, indicating the cell nucleus) (the exposure times for each channel were adjusted). CA and re_CA represent the CA10 promoter and the re_CA10 promoter, respectively.

[0060] Figure 3 The vector pAAV-SV40 late pA-NLS_mCherry is shown <ca10>Plasmid map of NLS_EGFP-BGH pA, in which the protein expression cassette of NLS_mCherry is inserted reversely upstream of the CA10 promoter.

[0061] Figure 4 The plasmid map of the vector pAAV-SV40 late pA-NLS_mCherry<re_CA10>NLS_EGFP-BGH pA is shown, in which the protein expression cassette of NLS_mCherry is inserted reversely upstream of the re_CA10 promoter.

[0062] Figure 5 Shows pAAV-SV40 late pA-NLS_mCherry <ca10>Results of immunofluorescence staining experiments performed after subretinal injection of the NLS_EGFP-BGH pA and pAAV-SV40 late pA-NLS_mCherry<re_CA10> NLS_EGFP-BGH pA vector in mice. Sections were photographed under two magnifications (100x / 200x) of a fluorescence microscope and corresponding exposure times (1000 ms / 500 ms), and a total of three photos were shown from left to right at each magnification. The first photo from the left shows the expression of the promoter-driven nuclear green fluorescent protein (NLS-EGFP) observed alone; the second photo from the left shows the expression of the promoter-driven nuclear red fluorescent protein (NLS_mCherry) observed alone; the third photo from the left is a merged image of the green fluorescence, red fluorescence, and DAPI staining (blue, indicating the cell nucleus) expressed by the cells (the exposure times for each channel were adjusted). CA and re_CA represent the CA10 promoter and the re_CA10 promoter, respectively.

[0063] Figure 6 The plasmid map of the vector VB231203-1125phu is shown. The vector contains the lacZ gene, and the vector is used to verify the activity of the CA10 promoter in driving the expression of large genes downstream.

[0064] Figure 7 Results of immunofluorescence staining experiments performed after subretinal injection of the pAAV[Exp]-CA10>LacZ_HA vector in mice. Sections were photographed under two magnifications (100x / 200x) of a fluorescence microscope and corresponding exposure times (500 ms / 200 ms), and a total of two photos were shown from left to right at each magnification. The first photo from the left shows the expression of the promoter-driven lacZ and HA proteins (red fluorescence) observed alone; the second photo from the left is a merged image of the red fluorescence expressed by the cells and DAPI staining (blue, indicating the cell nucleus) (the exposure times for each channel were adjusted). CA represents the CA10 promoter.

[0065] Figure 8 Shows the results of immunofluorescence staining experiments verifying the promoter activities of the variant promoters CA10V1, CA10V2, CA10V3, and CA10V4. The sections were photographed under two magnifications (100x / 200x) of a fluorescence microscope and corresponding exposure times (1000 ms / 500 ms), and a total of three photos were shown from left to right at each magnification. The first photo from the left shows the expression of the promoter-driven nuclear-localized green fluorescent protein (NLS-EGFP) observed alone; the second photo from the left shows the expression of the promoter-driven nuclear-localized red fluorescent protein (NLS_mCherry) observed alone; the third photo from the left is a merged image of the green fluorescence, red fluorescence, and DAPI staining (blue, indicating the cell nucleus) expressed by the cells (the exposure times for each channel were adjusted). CA10V1, CA10V2, CA10V3, and CA10V4 represent the respective variant promoters. Detailed implementation mode

[0066] The inventors obtained a novel photoreceptor cell-specific bidirectional promoter through an artificial recombination method. This promoter has photoreceptor cell-specific promoter activity. For example, the promoter can specifically bidirectionally drive the expression of downstream genes in photoreceptor cells. This novel photoreceptor cell-specific bidirectional promoter can be applied to the field of treating retinal diseases. For example, by simultaneously regulating the expression of two different therapeutic proteins and / or therapeutic nucleic acids in photoreceptor cells, retinal diseases can be treated.

[0067] Definitions

[0068] To make the present invention more easily understood, certain terms are first defined. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the embodiments of the present invention belong. When describing and claiming the embodiments of the present invention, the following terms are preferably used in accordance with the definitions set forth below.

[0069] In the present invention, unless otherwise specifically stated, the use of the singular includes the plural, the term "a / an" means "at least one / a kind of", and the term "or" means "and / or".

[0070] The terms "comprising" and "including" are generally interpreted as open-ended terms, intended to mean that all elements conceivable for the present invention, and all elements in any possible combination, covered or included by the text, paragraph, claim, etc. in which the term is used, even if such elements or combinations are not explicitly recited; and not to exclude any such one or more elements or combinations. "Consisting of" and "consisting essentially of" are generally interpreted as closed-ended terms, indicating that only the elements specifically listed in conjunction with such terms, such as components, structures, steps, etc., are included. The text, paragraph, claim, etc. of the present application specification may thus also relate to one or more embodiments in which the terms "comprising" and "including" are replaced by the terms "consisting of" and "consisting essentially of".

[0071] As used herein, the term "about" refers to variations in numerical amounts of any quantifiable variable, including but not limited to mass, volume, time, distance, and quantity, such as may occur through typical measurement techniques and equipment. The term "about" also encompasses these variations, which may be up to ±10%, but may also be ±9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, etc. For example, "about 100" includes all values within the range of 100 plus or minus 10%. Whether or not modified by the term "about", a claim includes equivalents of the quantity.

[0072] As used herein, the term "promoter" is a nucleotide sequence that permits the binding of RNA polymerase and directs the transcription of a gene. A promoter can regulate both the rate and efficiency of transcription of a nucleic acid operably linked thereto. A promoter can also be operably linked to other regulatory elements that enhance ("enhancer") or repress ("repressor") promoter-dependent transcription of a nucleic acid.

[0073] As used herein, the term "bidirectional promoter" refers to a segment of DNA sequence located between two adjacent genes that are transcribed in opposite directions, which can simultaneously drive the transcription and expression of downstream structural genes on both the positive and negative strands (bidirectional transcription gene pairs, also referred to as "head-to-head" gene pairs), and the distance between the transcription start sites of these two adjacent genes transcribed in opposite directions generally does not exceed 1 kb.

[0074] As used herein, the term "promoter activity" refers to the ability of a promoter to initiate the transcription of a nucleic acid operably linked thereto. Promoter activity can be measured using procedures known in the art. For example, promoter activity can be measured by measuring the amount of mRNA transcribed using, for example, Northern blotting or polymerase chain reaction (PCR). Alternatively, promoter activity can be measured as the amount of translated protein product, for example, by Western blotting, ELISA, colorimetric assays, and various different activity assays, including reporter gene assays.

[0075] As used herein, the term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid molecule such that the function of one is affected by the other, and the association between the elements allows them to perform their respective functions in their intended manner. For example, a promoter is operably linked to a coding sequence when the promoter is capable of affecting the expression of the coding sequence, i.e., the coding sequence is under the transcriptional control of the promoter.

[0076] As used herein, the term "nucleic acid" or "polynucleotide" refers to polymeric forms of nucleotides of any length, which nucleotides can be ribonucleotides or deoxyribonucleotides. Thus, the term includes, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified non-natural or derivatized nucleobases. The backbone of the polynucleotide can contain sugar and phosphate ester groups (as normally can be present in RNA or DNA) or modified or substituted sugars or phosphate ester groups. Alternatively, the backbone of the polynucleotide can contain polymers of synthetic subunits such as phosphoramidates and can thus be an oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed phosphoramidate-phosphodiester oligomer. The nucleic acids of the invention can be prepared by any technique known to those skilled in the art, including chemical synthesis, recombination and mutagenesis. In a preferred embodiment, the nucleic acids of the invention are DNA molecules, which are preferably synthesized by recombinant methods well known to those skilled in the art.

[0077] As used herein, the terms "polypeptide" and "protein" are used interchangeably and refer to polymers of amino acid residues and are not limited to a minimum length. These polymers of amino acid residues can contain natural or non-natural amino acid residues and include, but are not limited to, peptides, oligopeptides, dimers, trimers and multimers of amino acid residues. Both full-length proteins and fragments thereof are encompassed by this definition. The term also includes post-translational modifications of polypeptides, such as glycosylation, sialylation, acetylation, phosphorylation, etc. In addition, for the purposes of the present invention, a "polypeptide" can refer to a protein that includes modifications to the parental sequence such as deletions, additions and substitutions, provided that the protein maintains the required activity. These modifications can be deliberately engineered by site-directed mutagenesis or can be accidental, e.g., by mutations in the host producing the protein or by errors caused by PCR amplification.

[0078] The terms "variant" or "functional variant" as used herein are used interchangeably and refer to a nucleotide or amino acid sequence that differs from the original sequence but retains its essential properties and / or functions. Generally, a variant is overall closely similar to the original nucleotide or amino acid sequence and is identical in many regions. The sequence differences in a variant may consist of substitutions, deletions or insertions of one or more nucleotides or amino acids in the sequence, which do not impair the activity of the said sequence. A variant may have the same length as the original sequence, or may be shorter or longer.

[0079] The term "sequence identity" or "identity" as used herein refers to the number (%) of position matches (identical nucleic acid residues) obtained from the alignment of two polynucleotide sequences. Sequence identity is determined by comparing the sequences while aligning them so as to maximize overlap and identity and at the same time minimize sequence gaps. In particular, depending on the lengths of the two sequences, sequence identity can be determined using any of a variety of mathematical global or local alignment algorithms. Sequences of similar length are preferably aligned using a global alignment algorithm (such as the Needleman and Wunsch algorithm; Needleman and Wunsch, 1970) that optimally aligns the sequences over their entire length, while sequences of significantly different lengths are preferably aligned using a local alignment algorithm (such as the Smith and Waterman algorithm (Smith and Waterman, 1981) or the Altschul algorithm (Altschul et al., 1997; Altschul et al., 2005)). Alignments for the purpose of determining the percentage of nucleic acid sequence identity can be achieved in a variety of different ways within the skill in the art, such as using publicly available computer software that can be obtained at websites such as http: / / blast.ncbi.nlm.nih.gov / or http: / / www.ebi.ac.uk / Tools / emboss / . Those skilled in the art can determine suitable parameters for measuring the alignment, including any algorithm required to obtain the best alignment over the full length of the sequences being compared. For the purposes of the present invention, the nucleic acid sequence identity percentage value refers to the value generated using the pairwise sequence alignment program EMBOSS Needle, which uses the Needleman-Wunsch algorithm to generate the best global alignment of two sequences, where all search parameters are set to default values, i.e., scoring matrix = BLOSUM62, gap open penalty = 10, gap extension penalty = 0.5, end gap penalty = false, end gap open penalty = 10, end gap extension penalty = 0.5.

[0080] For the purpose of comparing sequence identity, the two polynucleotide sequences being aligned can contain any proportion of reverse complementary sequence segments without affecting the calculation of the percentage of sequence identity. For example, the two polynucleotide sequences can contain less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% reverse complementary sequence segments. The two polynucleotide sequences can contain 10%-90% reverse complementary sequence segments. The two polynucleotide sequences can contain 30%-70% reverse complementary sequence segments. The two polynucleotide sequences can contain 50%-60% reverse complementary sequence segments. The two polynucleotide sequences can contain 100% reverse complementary sequence segments, i.e., the two polynucleotide sequences are completely reverse complementary throughout the entire sequence. The reverse complementary sequence segments can be present at any position in the two polynucleotide sequences being aligned, for example starting from the 1st, 2nd, 3rd, 4th... or nth nucleotide and ending at the... m-4th, m-3rd, m-2nd, m-1st or mth nucleotide, where m is the length of the nucleotide sequence of the two polynucleotide sequences being aligned and n < m. One or more reverse complementary sequence segments can be present in the two polynucleotide sequences being aligned, for example 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 reverse complementary sequence segments. In one embodiment, 1-100 reverse complementary sequence segments are present in the two polynucleotide sequences being aligned. In a sequence identity alignment, the number of reverse complementary sequence segments is not restricted, and this application is intended to cover two aligned polynucleotide sequences containing any number of reverse complementary sequence segments. The reverse complementary sequence segments can be obtained by a dot plot-based sequence alignment algorithm, such as the publicly available computer software obtained from https: / / www.ebi.ac.uk / jdispatcher / emboss. Those skilled in the art will understand that the presence of reverse complementary sequence segments in the two polynucleotide sequences being aligned does not affect the calculation of the percentage of sequence identity, which means that the sequence identity is 100% when the two polynucleotide sequences are completely reverse complementary throughout the entire length, or when part of the sequences are reverse complementary and the other parts are identical.

[0081] As used herein, the terms "subject" and "patient" are used interchangeably and refer to an animal having a retina, preferably a mammal, such as including humans, monkeys, cows, horses, camels, pigs, goats, sheep, dogs, cats, rabbits, rats, mice, etc., more preferably humans, including adults, children and humans in the prenatal stage, and most preferably humans suffering from a retinal disease, such as a hereditary retinal disease.

[0082] As used herein, the term "treatment" refers to any action intended to improve the health of a patient, such as the alleviation, arrest, limitation, prevention, or retardation of a disease and its symptoms, which includes prophylactic and / or therapeutic treatment. If administered before the clinical manifestation of a condition (such as a disease or other unwanted symptoms in a subject), the treatment is prophylactic (i.e., it protects the subject from developing an unwanted disease); if administered after the manifestation of the condition, the treatment is therapeutic (i.e., it is intended to reduce, improve, or stabilize an existing unwanted disease or its symptoms).

[0083] For example, in certain embodiments, the term refers to the improvement or eradication of a disease or disease-related symptoms. In other embodiments, the term refers to minimizing the spread or worsening of a disease caused by administering one or more therapeutic agents to a subject suffering from the disease. In particular, the term "treatment of an eye disease" may refer to a treatment that provides improved vision, prevents the disease from progressing to total blindness, prevents the spread of damage to uninjured eye cells, improves damage in injured eye cells, prevents the occurrence of retinal damage, or saves an eye with mild or advanced disease. In certain embodiments, the term refers to a treatment that prevents, alleviates, or halts a retinal disease by providing a therapeutic protein that corrects a genetic defect in a patient. In certain other embodiments, the term refers to a treatment that uses optogenetics to restore the retina or restore vision.

[0084] As used herein, the term "prevention" refers to preventing the occurrence of a disease, disorder, or condition. When used in connection with a medical condition such as an eye disease, e.g., a retinal disease, it refers to reducing the frequency of occurrence of symptoms of a medical condition (e.g., an eye disease or a retinal disease, particularly a hereditary retinal disease), delaying the onset of its symptoms, or eliminating them completely in a subject in need, relative to a subject who has not received such administration, when a promoter, expression cassette, vector, viral particle, cell, and / or composition of the present invention is administered to the subject.

[0085] Photoreceptor cell-specific bidirectional promoter

[0086] In one aspect of the present invention, the present invention provides a photoreceptor cell-specific bidirectional promoter having photoreceptor cell-specific promoter activity. For example, the photoreceptor cell-specific bidirectional promoter is capable of bidirectionally driving the expression of downstream genes in photoreceptor cells at a high level. Optionally, the photoreceptor cell-specific bidirectional promoter can also be used to unidirectionally drive the expression of downstream genes in photoreceptor cells at a high level. As used herein, the term "photoreceptor cell" refers to a special type of neuroepithelial cell located in the retina that has the function of converting light signals, and generally includes rod cells, cone cells, and intrinsically photosensitive retinal ganglion cells. The term also refers to photoreceptor cell precursors or progenitor cells that can differentiate into photoreceptor cells after transplantation into the subretinal space.

[0087] The photoreceptor cell-specific bidirectional promoter of the present invention can drive the expression of a target gene mainly in photoreceptor cells (e.g., cone cells and rod cells). Preferably, the photoreceptor cell-specific bidirectional promoter can drive the expression of the target gene only in photoreceptor cells. The term "photoreceptor cell-specific" used herein when referring to a promoter should be interpreted as being mainly active in photoreceptor cells. It should be understood that a generally low residual expression activity in other tissues or cells other than photoreceptor cells cannot be completely excluded. Preferably, the activity of the photoreceptor cell-specific bidirectional promoter in non-photoreceptor cells is less than 90% of its activity in photoreceptor cells, such as less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. In one embodiment, the activity of the photoreceptor cell-specific bidirectional promoter in non-photoreceptor cells is 1%-90%, 1%-80%, 1%-70%, 1%-60%, 1%-50%, 1%-40%, 1%-30%, 1%-20%, 1%-10%, 1%-9%, 1%-8%, 1%-7%, 1%-6%, 1%-5%, 1%-4%, 1%-3%, or 1%-2% of its activity in photoreceptor cells. In a preferred embodiment, the photoreceptor cell-specific bidirectional promoter is substantially inactive in non-photoreceptor cells. In a more preferred embodiment, the photoreceptor cell-specific bidirectional promoter is inactive in non-photoreceptor cells. In a preferred embodiment, the photoreceptor cell-specific promoter of the present invention is inactive in ganglion, bipolar, amacrine, horizontal, Müller, and / or glial cells.

[0088] In one embodiment, the photoreceptor cell-specific bidirectional promoter of the present invention comprises a nucleotide sequence having at least 70% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0089] In one embodiment, the photoreceptor cell-specific bidirectional promoter of the present invention comprises a nucleotide sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0090] In one embodiment, the photoreceptor cell-specific bidirectional promoter of the present invention comprises a functional variant of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In one embodiment, the functional variant has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 or more nucleotide substitutions, deletions, and / or insertions compared to the nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0091] In one embodiment, the functional variant is capable of hybridizing to the nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or its complementary strand under low, medium, or high stringency conditions.

[0092] As used herein, the term "low stringency conditions" means that a probe of at least 100 nucleotides in length is prehybridized and hybridized at 42 °C in 5X SSPE, 0.3% SDS, 200 μg / mL sheared and denatured salmon sperm DNA, and 25% formamide, followed by a standard DNA blotting procedure for 12 to 24 hours. Finally, the carrier material is washed three times with 2X SSC, 0.2% SDS at 50 °C for 15 minutes each.

[0093] As used herein, the term "medium stringency conditions" means that a probe of at least 100 nucleotides in length is prehybridized and hybridized at 42 °C in 5X SSPE, 0.3% SDS, 200 μg / mL sheared and denatured salmon sperm DNA, and 35% formamide, followed by a standard DNA blotting procedure for 12 to 24 hours. Finally, the carrier material is washed three times with 2X SSC, 0.2% SDS at 55 °C for 15 minutes each.

[0094] As used herein, the term "high stringency conditions" means that a probe of at least 100 nucleotides in length is prehybridized and hybridized at 42 °C in 5X SSPE, 0.3% SDS, 200 μg / mL sheared and denatured salmon sperm DNA, and 50% formamide, followed by a standard DNA blotting procedure for 12 to 24 hours. Finally, the carrier material is washed three times with 2X SSC, 0.2% SDS at 65 °C for 15 minutes each.

[0095] In one embodiment, the photoreceptor cell-specific bidirectional promoter of the present invention comprises the nucleotide sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0096] In one embodiment, the photoreceptor cell-specific bidirectional promoter of the present invention consists of a nucleotide sequence having at least 70% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0097] In one embodiment, the photoreceptor cell-specific bidirectional promoter of the present invention consists of a nucleotide sequence having at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0098] In one embodiment, the photoreceptor cell-specific bidirectional promoter of the present invention consists of a functional variant of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In one embodiment, the functional variant has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 or more nucleotide substitutions, deletions and / or insertions compared to the nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In one embodiment, the functional variant is capable of hybridizing to the nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or its complementary strand under low, medium or high stringency conditions.

[0099] In one embodiment, the photoreceptor cell-specific bidirectional promoter of the present invention consists of the nucleotide sequence as shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0100] Expression cassette

[0101] In yet another aspect of the present invention, there is provided an expression cassette comprising the photoreceptor cell-specific bidirectional promoter of the present invention. As used herein, the term "expression cassette" refers to a nucleic acid construct comprising a coding sequence and one or more control sequences required for the expression of said coding sequence. In particular, one of these control sequences is the promoter of the present invention. Generally, the expression cassette comprises a coding sequence required for expressing a selected gene product and regulatory sequences before (5' non-coding sequence) and after (3' non-coding sequence) said coding sequence. Thus, an expression cassette typically comprises a promoter sequence, a coding sequence, and a 3′ untranslated region that usually contains a polyadenylation site and / or a transcription terminator. The expression cassette may further comprise other regulatory elements, such as enhancer sequences, a multiple cloning site sequence facilitating the insertion of a DNA fragment into a vector, and / or a splicing signal sequence. The expression cassette is usually contained within a vector to facilitate cloning and transformation.

[0102] In one embodiment, the expression cassette further comprises a target nucleic acid operably linked to the photoreceptor cell-specific bidirectional promoter of the present invention. In one embodiment, the target nucleic acid is a nucleic acid encoding a target polypeptide. The target polypeptide can be any polypeptide that needs to be expressed in photoreceptor cells. For example, the target polypeptide can be a therapeutic protein, a optogenetic driving protein, or a reporter protein. Preferably, the photoreceptor cell-specific bidirectional promoter of the present invention is operably linked to two different target nucleic acids, thereby driving the specific expression of the two different target nucleic acids simultaneously in photoreceptor cells.

[0103] In one embodiment, the target nucleic acid is a therapeutic gene, i.e., a gene encoding a therapeutic protein. As used herein, the term "therapeutic gene" refers to a gene encoding a therapeutic protein that is useful in the treatment of a pathological condition. When expressed, the therapeutic gene provides a beneficial effect to the cell or tissue in which it is present or to the patient in whom the gene is expressed in vivo. Examples of beneficial effects include the improvement or alleviation of signs or symptoms of a disease, disorder, or condition, the prevention or inhibition of a disease, disorder, or condition, or the provision of a desired characteristic. Therapeutic genes include genes that partially or completely correct genetic defects in a patient. In particular, the therapeutic gene can be, but is not limited to, a nucleic acid sequence encoding a protein useful in gene therapy to alleviate a defect caused by the absence, deficiency, or non-optimal level of said protein in the cells or tissues of a subject. The therapeutic polypeptide can, for example, provide a polypeptide and / or enzyme activity that is absent, defective, or present at a non-optimal level in photoreceptor cells, provide a polypeptide and / or enzyme activity that indirectly counteracts an imbalance in photoreceptor cells. The therapeutic polypeptide can also be used to reduce the activity of a polypeptide, for example, by acting as a dominant-negative polypeptide. Preferably, the therapeutic polypeptide provides a polypeptide and / or enzyme activity that is absent, defective, or present at a non-optimal level in photoreceptor cells, more preferably a polypeptide and / or enzyme activity that is absent or defective in photoreceptor cells.

[0104] Examples of therapeutic genes include, but are not limited to, nucleic acids for replacing missing or mutant genes known to cause retinal diseases, such as MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPA1, OPA3, OPA7, and ACO2. The therapeutic genes can also encode neurotrophic factors, such as GDNF, CNTF, FGF2, BDNF, and EPO, anti-apoptotic genes such as BCL2 and BCL2L1, anti-angiogenic factors such as endostatin, angiostatin, and sFlt, anti-inflammatory factors such as IL10, IL1R1, TGFBI, and IL4, or rod-derived cone viability factor (RdCVF). Preferably, the photoreceptor cell-specific bidirectional promoter of the present invention simultaneously drives the expression of one, two, or more of the above therapeutic genes in photoreceptor cells.

[0105] Additional signal peptides can be added to the therapeutic proteins, particularly in order to import them into certain organelles (such as mitochondria), secrete them from the cell, or insert them into the cell membrane.

[0106] In one embodiment, the target polypeptide is a tool enzyme used in a gene editing method. In one embodiment, the target polypeptide is a tool enzyme in the CRISPR / Cas system, for example, the Cas9 protein.

[0107] In one embodiment, the target polypeptide is a optogenetic driving protein. As used herein, the term "optogenetic driving protein" refers to a photoreactive polypeptide that uses vitamin A or its isotype as a chromophore. The optogenetic driving protein is a light-gated ion pump or channel that absorbs light and is activated by light. The optogenetic driving protein can be from a prokaryote or a eukaryote. In particular, it can be a microbial rhodopsin or a vertebrate rhodopsin. The optogenetic driving protein can be an optogenetic activator or an optogenetic inhibitor.

[0108] Optogenetic activators cause cells to depolarize upon exposure to light. When a cell depolarizes, the internal negative charge of the cell briefly becomes positive. The change in the intracellular environment from negative to positive allows for the transmission of electrical impulses both within the cell and optionally between cells. Examples of optogenetic activators include, but are not limited to, rhodopsin, photopsin, melanopsin, pinopsin, parapinopsin, VA opsin, peropsin, neuropsin, encephalopsin, retinopigment, RGR opsin, microbial opsins with redshifted spectral properties (e.g., ReaChR, Chrimson, or ChrimsonR), vertebrate opsins that recruit Gi / o signaling (e.g., short-wavelength vertebrate opsins or long-wavelength vertebrate opsins), channelrhodopsins from the microalga Chlamydomonas (e.g., channelrhodopsin-1 and channelrhodopsin-2, from Chlamydomonas reinhardtii), and variants of the above proteins. A large number of variants of channelrhodopsin (e.g., codon-optimized variants, mutants, chimeras) are constantly being generated to improve certain characteristics of these proteins. Examples of these variants include, but are not limited to, hChR2(L132C), ChR2(H134R), ChETA(E123T), C1V1(E122T), C1V1(E162T), C1V1(E122 / 162T), hChR2(C128A), hChR2(C128S), hChR2(C128T), hChR2(C128A / H134R), hCatch(T159S), hChief, hChR2(C128S / D156A), hChR2(T159C), hChR2(E123T / T159C), hChR2c(C128T), ChR2c(C128T), ChR2e(Q117C), and SwitChR (for a review, see Prakash et al., Nat Methods. 2012 Dec;9(12):1171-9).

[0109] Optogenetic inhibitors cause cell hyperpolarization upon exposure to light. When a cell hyperpolarizes, the internal negative charge of the cell becomes more negative in the short term. The shift towards more negative inhibits action potentials by increasing the stimulus required to move the membrane potential towards the action potential threshold. In certain embodiments, the optogenetic inhibitor is a light-gated ion pump that transports chloride ions inward and / or cations outward upon absorption of a photon. Any suitable light-gated, retinylidene-dependent ion pump that transports chloride ions inward or cations outward upon absorption of a photon can be used as an optogenetic inhibitor. Examples of optogenetic inhibitors include but are not limited to halorhodopsin such as Natronomonas pharaonis halorhodopsin (NpHR), enhanced halorhodopsin (eNpHR2.0 and eNpHR3.0), and red-shifted halorhodopsin Halo57, archaeorhodopsin-3 (AR-3), archaerhodopsin (Arch), bacteriorhodopsin such as enhanced bacteriorhodopsin (eBR), proteorhodopsin, xanthorhodopsin, Mycosphaerella punctiformis fungal opsin (Mac), great white shark chimeric halorhodopsin, and variants of the above proteins.

[0110] In a particularly preferred embodiment, the optogenetic driver protein is an optogenetic activator, preferably selected from channelrhodopsin, ChrimsonR, and variants thereof.

[0111] Preferably, the photoreceptor cell-specific bidirectional promoter of the present invention simultaneously drives the expression of one, two, or more of the above optogenetic driver proteins in photoreceptor cells.

[0112] In one embodiment, the target polypeptide is a reporter protein. Preferably, the reporter protein is detectable in live photoreceptor cells. Expression of the reporter protein under the control of the promoter of the present invention allows for the specific detection or identification of photoreceptor cells. The reporter protein can be a fluorescent protein (such as green fluorescent protein GFP including EGFP, red fluorescent protein RFP, yellow fluorescent protein YFP, blue fluorescent protein BFP, cyan fluorescent protein CFP, etc.), a calcium indicator (such as GCaMP), luciferase, alkaline phosphatase, β-galactosidase, β-lactamase, horseradish peroxidase, and variants thereof. In certain embodiments, the reporter protein is selected from fluorescent proteins, calcium indicators, alkaline phosphatase, β-galactosidase, β-lactamase, horseradish peroxidase, and variants thereof. Preferably, the photoreceptor cell-specific bidirectional promoter of the present invention simultaneously drives the expression of one, two, or more of the above reporter proteins in photoreceptor cells.

[0113] In one embodiment, the target nucleic acid encodes any nucleic acid that needs to be expressed, such as any target nucleic acid that needs to be expressed in photoreceptor cells. In particular, the nucleic acid that needs to be expressed can be a therapeutic nucleic acid. In one embodiment, the therapeutic nucleic acid is selected from siRNA, shRNA, RNAi, miRNA, antisense RNA, sgRNA, ribozymes, and deoxyribozymes (DNAzyme). In a specific embodiment, when transcribed by the promoter of the present invention, the target nucleic acid can treat or prevent the disease by interfering with the translation or transcription of abnormal or excessive proteins associated with eye diseases. For example, the RNA encoded by the target nucleic acid can highly specifically eliminate the mRNA encoding abnormal and / or excessive proteins or reduce its expression level, thereby achieving the purpose of treating eye diseases. Preferably, the photoreceptor cell-specific bidirectional promoter of the present invention simultaneously drives the expression of one, two, or more of the above-mentioned therapeutic nucleic acids in photoreceptor cells.

[0114] vector

[0115] In another aspect of the present invention, a vector is provided that comprises the photoreceptor cell-specific bidirectional promoter of the present invention or the expression cassette of the present invention. The term "vector" as used herein refers to a nucleic acid molecule that serves as a vehicle for transferring genetic material, particularly for delivering nucleic acids into host cells, either in vitro or in vivo. Vectors include, but are not limited to, plasmids, phagemids, cosmids, transposable elements, viruses, and artificial chromosomes (such as YAC). Preferably, the vector of the present invention is a vector suitable for gene or cell therapy, particularly suitable for targeting the eye, such as photoreceptor cells.

[0116] In one embodiment, the vector is a viral vector. The term "viral vector" as used herein refers to a virus-based composition that can act as a vector for delivering target nucleic acid molecules, such as heterologous nucleic acids, into cells. With the aid of a viral vector, heterologous nucleic acids can be delivered into the recipient's body and inserted or not inserted into the recipient's genomic nucleic acid. In one embodiment, a viral vector is a virus in which the viral genome has been engineered to accommodate nucleic acid sequences that are non-native relative to the viral genome. A viral vector can be generated by introducing one or more mutations into the viral genome of the virus, thereby accommodating the insertion of non-native nucleic acid sequences into the virus. Generally, the genome of the virus can be modified by deleting non-essential sequences therein and making it contain only the minimum components required for assembling a functional recombinant virus or viral particle, thereby providing a payload for the target nucleic acid molecule to be delivered. Viral vectors include any elements required for establishing the expression of the target polypeptide in a host cell, such as promoters, ITRs, ribosome binding elements, terminators, enhancers, selection markers, introns, polyA signals, and / or origins of replication.

[0117] In one embodiment, the viral vector is, for example, a vector derived from Moloney murine leukemia virus (MoMLV), MSCV, SFFV, MPSV or SNV, a lentiviral vector (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) or equine infectious anemia virus (EIAV)), an adenovirus (Ad) vector, an adeno-associated virus (AAV) vector, a simian virus 40 (SV-40) vector, a bovine papillomavirus vector, an Epstein-Barr virus vector, a herpesvirus vector, a vaccinia virus vector, a Harvey murine sarcoma virus vector, a murine mammary tumor virus vector, a circovirus vector or a Rous sarcoma virus vector. In a particular embodiment, the vector is a retroviral vector, preferably a lentiviral vector, or a non-pathogenic parvovirus vector. As is known in the art, depending on the particular viral vector contemplated for use, appropriate sequences should be introduced into the vectors of the present invention to obtain a functional viral vector, such as AAV inverted terminal repeats (ITRs) for AAV vectors or long terminal repeats (LTRs) for lentiviral vectors.

[0118] In a preferred embodiment, the vector is an adeno-associated virus (AAV) vector. The human parvovirus adeno-associated virus (AAV) is a dependent virus that is naturally defective for replication and is capable of integrating into the genome of the infected cell to establish a latent infection. This last property appears to be unique among mammalian viruses, as the integration occurs at a specific locus on chromosome 19 in the human genome called AAV S1 (19q13.3-qter). Thus, AAV has evoked considerable interest as a potential vector for human gene therapy. The advantageous properties of the virus include its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and its broad range of cell lines that can be infected from different tissues.

[0119] As used herein, the term "AAV vector" refers to a polynucleotide vector that contains one or more heterologous sequences (i.e., nucleic acid sequences not of AAV origin), the heterologous sequences flanked by at least one AAV inverted terminal repeat (ITR), preferably two ITRs. Such an AAV vector can be replicated and packaged into infectious virus particles when present in a host cell that has been infected with a suitable helper virus (or a virus expressing suitable helper virus functions) and expresses the AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). The "inverted terminal repeat" or "ITR" sequence is a term well known in the art and refers to relatively short sequences that are present at the ends of a viral genome and are in opposite orientations. The "AAV inverted terminal repeat (ITR)" sequence is a sequence of approximately 145 nucleotides present at both ends of the native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, giving rise to heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contain several shorter self-complementary regions (referred to as regions A, A', B, B', C, C, and D), allowing for intrastrand base pairing within this portion of the ITR. The AAV ITRs used in the vectors of the present invention can have a wild-type nucleotide sequence or can be altered by insertion, deletion, or substitution. The serotype of the inverted terminal repeat (ITR) of the AAV vector can be selected from any known human or non-human AAV serotype. The promoter or expression cassette of the present invention can be introduced into the vector by any method known to those skilled in the art.

[0120] The vector can also contain one or more of the following nucleic acid sequences, which encode selectable markers such as auxotrophic markers (e.g., LEU2, URA3, TRP1, or HIS3), detectable tags such as fluorescent or luminescent proteins (e.g., GFP, eGFP, DsRed, CFP), or proteins that confer resistance to chemical / toxic compounds (e.g., the MGMT gene that confers resistance to temozolomide). These markers can be used to select or detect host cells containing the vector and can be readily selected by those skilled in the art depending on the host cell.

[0121] Virus particle

[0122] In yet another aspect of the present invention, there is provided a virus particle that contains the vector of the present invention.

[0123] In one embodiment, the vector is an AAV vector and is packaged in a capsid of AAV origin to produce adeno-associated virus particles or AAV particles. Thus, the term "adeno-associated virus particle / AAV particle" as used herein refers to a virus particle composed of at least one AAV capsid protein and an encapsulated AAV vector genome. AAV viruses are generally classified and referred to according to their serotypes. "Serotype" corresponds to variant subspecies of AAV that have unique reactivity by virtue of the characteristic spectrum of expression of their capsid surface antigens and can be used to distinguish them from other variant subspecies. AAV serotypes include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, and AAVdj, etc. In addition, non-natural engineered variants and chimeric AAVs can also be useful. In particular, the capsid protein can be a variant containing one or more amino acid substitutions that enhance transduction efficiency. In one embodiment, the capsid is preferably selected from capsids of AAV-2, AAV-5, AAV2-7m8, AAV-9, and AAV-8 serotypes, more preferably a capsid of AAV-2 origin such as an AAV-2 or AAV2-7m8 capsid.

[0124] Different AAV serotypes are used to optimize the transduction of specific target cells or to target specific cell types (such as photoreceptor cells) within a specific target tissue. The AAV particles can contain viral proteins and viral nucleic acids of the same serotype or any natural or artificial sequence variant of AAV. For example, the AAV particles can contain AAV2 capsid proteins and at least one, preferably two, AAV2 ITRs. Any combination of AAV serotypes for producing AAV particles is provided herein. AAV viruses can be engineered using conventional molecular biology techniques such that these particles can be optimized for cell-specific delivery of nucleic acid sequences, for minimizing immunogenicity, for regulating stability and particle lifespan, for efficient degradation, for accurate delivery to the cell nucleus.

[0125] In the art, numerous methods are known for the production of viral particles, in particular AAV particles, including transfection, production in stable cell lines and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al., (1997) Virology 71(11):8780-8789) and baculovirus-AAV hybrids. AAV production cultures for the production of AAV viral particles require: 1) a suitable host cell, including for example cell lines of human origin such as HeLa, A549 or 293T cells, or in the case of a baculovirus production system an insect-derived cell line such as SF-9; 2) suitable helper virus functions, which are provided by wild-type or mutant adenoviruses (e.g. temperature-sensitive adenoviruses), herpesviruses, baculoviruses or plasmid constructs providing helper virus functions; 3) AAV rep and cap genes and gene products; 4) a target nucleic acid flanked by at least one AAV ITR sequence, such as the vector of the present invention; and 5) suitable media and media components known in the art to support AAV production.

[0126] In the present invention, host cells for the production of AAV particles include mammalian cells, insect cells, plant cells, microorganisms and yeast. The host cell can be a packaging cell in which the AAV rep and cap genes are stably maintained or a production cell in which the AAV vector genome is stably maintained. Exemplary packaging and production cells are derived from 293T, A549 or HeLa cells. The AAV particles are then purified and formulated using standard techniques known in the art.

[0127] Cell

[0128] In a further aspect of the present invention, there is provided a cell comprising the photoreceptor cell-specific bidirectional promoter, expression cassette, vector or viral particle of the present invention, or which has been transformed with the photoreceptor cell-specific bidirectional promoter, expression cassette, vector or viral particle of the present invention. The cell can be any cell, including animal cells, plant cells, bacterial cells or yeast cells. Preferably, the cell is a mammalian cell or an insect cell. More preferably, the cell is a mammalian cell, such as a cell of a human, monkey, cow, horse, camel, pig, goat, sheep, dog, cat, rabbit, rat or mouse. Most preferably, the cell is a human cell.

[0129] In one embodiment, the cell is a photoreceptor cell. In one embodiment, the cell is a cone cell. In one embodiment, the cell is a rod cell. In one embodiment, the cell is a retinal pigment epithelial cell (RPE). In one embodiment, the cell is a HEK293, HEK293T, BHK or CHO cell.

[0130] Any technique known in the art can be used to transfer the promoter, expression cassette, vector or viral particle of the present invention into cells. For example, such techniques include but are not limited to calcium phosphate-DNA precipitation, DEAE-Dextran transfection, electroporation, microinjection, gene gun, lipofection or viral infection, and the promoter, expression cassette, vector or viral particle of the present invention can be maintained in the host cell in an ectopic form or can be integrated into the genome. In a preferred embodiment, the promoter, expression cassette, vector or viral particle of the present invention is delivered into the host cell by viral infection, preferably using the viral particle of the present invention, more preferably using the AAV particle of the present invention.

[0131] Pharmaceutical composition

[0132] In yet another aspect of the present invention, there is provided a pharmaceutical composition comprising the photoreceptor cell-specific bidirectional promoter, expression cassette, vector, viral particle, or cell of the present invention, and a pharmaceutically acceptable excipient or carrier. The pharmaceutical composition is used for treating or preventing eye diseases, preferably for treating or preventing retinal diseases, more preferably for treating or preventing hereditary retinal diseases.

[0133] As used herein, the term "pharmaceutical composition" refers to a preparation comprising an active compound or ingredient, i.e., the promoter, expression cassette, vector, viral particle, or cell of the present invention, which is used for preventing, maintaining or treating a tissue condition or disease in a subject.

[0134] As used herein, the term "pharmaceutically acceptable" means that the drug or reagent is approved by a national regulatory agency (such as the National Medical Products Administration NMPA or the US Food and Drug Administration FDA) or listed in an accepted pharmacopoeia (such as the Pharmacopoeia of the People's Republic of China or the US Pharmacopoeia) for use in animals, such as mammals, especially humans. The term "excipient" refers to a natural or synthetic substance that attaches to the pharmaceutically active ingredient in a drug and enhances the action of the pharmaceutically active ingredient. The excipient is harmless to the subject at a concentration consistent with the effective activity of the pharmaceutically active ingredient, and it includes, for example, buffers, disintegrants, binders, lubricants, fillers, plasticizers, surfactants, wetting agents, film-forming agents and coating materials, as well as coloring agents and the like. The term "carrier" herein refers to a substance that can deliver the pharmaceutically active ingredient to a desired compartment in a subject, such as a specific cell type (such as retinal cells, preferably photoreceptor cells), and can be used to provide and control the release of the drug after administration by a selected route of administration and regimen. "Pharmaceutically acceptable excipient" and "pharmaceutically acceptable carrier" in this application can also be used interchangeably.

[0135] Typically, a pharmaceutically acceptable excipient / carrier is a relatively inert substance that facilitates the administration of the drug active substance and can be provided as a liquid solution or suspension, an emulsion, or a solid form suitable for dissolving or suspending in a liquid prior to use. For example, the excipient / carrier can provide form or consistency, or act as a diluent. Suitable excipients / carriers include, but are not limited to, stabilizers, wetting and emulsifying agents, salts for altering osmotic pressure, encapsulating agents, pH buffering substances, and buffers. Suitable excipients / carriers include any pharmaceutically acceptable agent suitable for direct delivery to the eye that can be administered without undue toxicity. Pharmaceutically acceptable excipients / carriers include, but are not limited to, water, petroleum, animal or vegetable oils, mineral oil, synthetic oil, sorbitol, Tween compounds, glycerol, physiological saline solution, magnesium chloride solution, dextrose or other sugar solutions, various alcohols such as diols like ethylene glycol, propylene glycol or polyethylene glycol, ethanol. Pharmaceutically acceptable excipients / carriers can also include pharmaceutically acceptable salts, such as inorganic acid salts like hydrochloride, hydrobromide, phosphate, sulfate, etc., and salts of organic acids such as acetate, propionate, malonate, benzoate, etc. A full discussion of pharmaceutically acceptable excipients / carriers can be obtained, for example, in Remington's Pharmaceutical Sciences, 15th Edition. The choice and exact nature of the pharmaceutically acceptable excipient / carrier can be determined by those skilled in the art according to the specific route of administration.

[0136] Preferably, the pharmaceutical composition of the present invention is formulated for administration to the eye, such as intravitreally, intracamerally, intravitreally or subretinally, particularly by direct retinal, subretinal space and / or intravitreal injection. For ocular delivery, the pharmaceutical composition is preferably in the form of an aqueous solution that is pyrogen-free and has a suitable pH, isotonicity and stability. A person skilled in the relevant art can prepare a suitable aqueous solution using, for example, isotonic carriers such as sodium chloride solution, Ringer's solution, lactated Ringer's solution, Hartmann's solution, etc. If desired, the pharmaceutical composition of the present invention can also contain preservatives, stabilizers, buffers, antioxidants and / or other additives. The drug active ingredient can also be formulated in a slow-release preparation to achieve delayed release, or incorporated in microcapsules formed from biocompatible polymers or in a liposome carrier system.

[0137] The pharmaceutical composition of the present invention can be packaged in unit dose or multi-dose form, or in the form of a kit. The specific dose and dosage regimen to be administered of the pharmaceutical composition of the present invention can be adjusted and determined by a physician according to the purpose of use, the type and severity of the disease to be treated, the age, sex, weight, health status, tolerance, and mode of administration of the subject, etc.

[0138] In one embodiment, the pharmaceutical composition of the present invention comprises the cells of the present invention, preferably human cells, i.e., cells transformed or transfected with the expression cassette, vector or viral particle of the present invention, preferably with AAV particles. Optionally, the composition comprising the cells can be cryopreserved at any temperature suitable for storing cells. For example, the cells can be frozen at about -20°C, -80°C or any other suitable temperature. The cryopreserved cells can be stored in a suitable container and prepared for storage to reduce the risk of cell damage and maximize the likelihood of cell survival upon thawing. Alternatively, the cells can also be maintained at refrigerated room temperature, e.g., about 4°C.

[0139] In one embodiment, the pharmaceutical composition of the present invention comprises the viral particles of the present invention, and each unit dose contains 10 8 to 10 13 viral particles, preferably 10 9 to 10 12 viral particles, more preferably 10 10 to 10 11 viral particles.

[0140] In one embodiment, the pharmaceutical composition of the present invention may further comprise one or several other active compounds such as corticosteroids, antibiotics, analgesics, immunosuppressants, trophic factors or any combination thereof.

[0141] The pharmaceutical composition of the present invention can also be used in combination with one or more other therapies for the treatment or prevention of eye diseases, preferably retinal diseases, more preferably inherited retinal diseases. In one embodiment, the eye diseases are selected from retinitis pigmentosa (RP), age-related macular degeneration, Stargardt's disease, Leber's hereditary optic neuropathy, cone-rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroideremia, retinitis pigmentosa, night blindness, X-linked retinoschisis and Usher syndrome.

[0142] Method of treatment

[0143] In yet another aspect of the present invention, there is provided a method for treating or preventing an eye disease, the method comprising administering the photoreceptor cell-specific bidirectional promoter, expression cassette, vector, viral particle, cell or pharmaceutical composition of the present invention to a subject in need thereof, preferably to the eye of the subject. In one embodiment, the photoreceptor cell-specific bidirectional promoter, expression cassette, vector, viral particle, cell or pharmaceutical composition of the present invention is administered to a subject in need thereof in a therapeutically or prophylactically effective amount, e.g., into the eye.

[0144] As used herein, "therapeutically or prophylactically effective amount" means that the promoter, expression cassette, vector, viral particle, cell or pharmaceutical composition of the present invention, when administered to a subject, can achieve the desired therapeutic or prophylactic effect, such as an amount that reduces, prevents, arrests, slows or eliminates the progression of physical changes associated with an eye disease (such as a retinal disease), or symptoms caused thereby. The "therapeutically or prophylactically effective amount" generally varies depending on the sex, age and general condition of the subject, mode of administration, etc., and can be determined by those skilled in the art using routine experiments. In one embodiment, the subject is a mammal, preferably a human.

[0145] In one embodiment, the eye disease is a retinal disease. In one embodiment, the eye disease is an inherited retinal disease (IRD). In one embodiment, the eye disease is selected from retinitis pigmentosa (RP), age-related macular degeneration, Stargardt's disease, Leber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroideremia, tapetoretinal degeneration, achromatopsia (rod monochromacy), retinitis punctata albescens, night blindness, X-linked retinoschisis and Usher syndrome.

[0146] In one embodiment, the method of treatment of the present invention comprises administering the promoter, expression cassette, vector, viral particle, cell or pharmaceutical composition of the present invention to the eye of a subject, such as intravitreally, intraocularly, intravitreally or subretinally.

[0147] In one embodiment, the method of treatment of the present invention further comprises administering to the subject one or more other therapies, including administering one or more other therapeutic agents, gene therapy, immunotherapy, surgery, etc. For example, the therapeutic agent can be selected from corticosteroids, antibiotics, analgesics, immunosuppressants or trophic factors or any combination thereof.

[0148] In one embodiment, the promoter, expression cassette, vector, viral particle, cell or pharmaceutical composition of the present invention can be administered before or after the onset of symptoms of the eye disease, such as before or after partial or complete photoreceptor degeneration, and / or before or after partial or complete loss of vision.

[0149] Pharmaceutical use

[0150] In a further aspect of the present invention, there is provided the use of the photoreceptor cell-specific bidirectional promoter, expression cassette, vector, viral particle, cell or pharmaceutical composition of the present invention in the preparation of a medicament for the treatment or prophylaxis of an eye disease.

[0151] In one embodiment, the eye disease is a retinal disease. In one embodiment, the eye disease is an inherited retinal disease (IRD). In one embodiment, the eye disease is selected from retinitis pigmentosa (RP), age-related macular degeneration, Stargardt disease, Leber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best disease, choroideremia, tapetoretinal degeneration, achromatopsia (rod monochromacy), retinal pigmentopathy, night blindness, X-linked retinoschisis, and Usher syndrome.

[0152] Expression method

[0153] In yet another aspect of the present invention, a method for expressing a target polypeptide or nucleic acid in a cell is provided, which comprises introducing the photoreceptor cell-specific bidirectional promoter, expression cassette, vector, or viral particle of the present invention into the target cell. In one embodiment, the cell is a photoreceptor cell. In one embodiment, the cell is a cone cell. In one embodiment, the cell is a rod cell. In one embodiment, the cell is a retinal pigment epithelial cell (RPE).

[0154] Using the specific description and sequences of the present application, combined with techniques known to those skilled in the art, the technical solutions claimed in the present invention can be achieved. Such techniques include, for example, conventional cloning techniques in molecular biology and various experimental techniques commonly used in biochemistry (such as those described in textbooks) and any suitable methods.

[0155] The following non-limiting examples further describe the present invention.

[0156] Examples

[0157] Example 1: Construction of expression vector and verification of promoter activity (mouse)

[0158] A photoreceptor cell-specific bidirectional promoter sequence was obtained by artificial recombination, and this promoter was named the CA10 promoter (SEQ ID NO: 1). To verify that the CA10 promoter is a promoter capable of bidirectionally driving the expression of downstream genes, based on the VB211226-1096bhj vector (internally constructed, see https: / / en.vectorbuilder.com / vector / VB211226-1096bhj.html, plasmid map as Figure 1 As shown in the figure, two expression vectors were constructed. By the conventional restriction enzyme digestion and ligation method, the CAG promoter in the VB211226-1096bhj vector was replaced with the CA10 promoter to construct an expression vector pAAV[Exp]-{CA10}>NLS-EGFP:WPRE with the CA10 promoter upstream and the nuclear localization signal-enhanced green fluorescent protein (NLS-EGFP) gene downstream. And the CAG promoter in the VB211226-1096bhj vector was replaced with the reverse complementary sequence of the CA10 promoter (re_CA10, SEQ ID NO: 6) to construct an expression vector pAAV[Exp]-{re_CA10}>NLS-EGFP:WPRE with the re_CA10 promoter upstream and the nuclear localization signal-enhanced green fluorescent protein (NLS-EGFP) gene downstream.

[0159] According to the conventional virus packaging method, the above-mentioned expression vectors containing the CA10 and re_CA10 promoters were respectively mixed with the other two auxiliary vector plasmids for AAV packaging (carrying the Rep\Capsid gene and the E2\E4\VA gene respectively), transfected into 293T cells for virus packaging, and the virus was harvested and purified by cesium chloride to finally obtain virus particles (type AAV8) for in vivo verification experiments in animals.

[0160] Subretinal injection was performed on mice (C57BL / 6J, 6-8 weeks old, purchased from Guangdong Provincial Medical Experimental Animal Center) at a virus injection dose of 1E+10 GC / eye. Two weeks after injection, samples were taken for sectioning and immunofluorescence staining: The primary antibody used in the immunofluorescence process was rabbit anti-mouse polyclonal anti-Arrestin C antibody (purchased from Sigma-Aldrich, catalog number AB15282), which can specifically bind to the surface protein of cone cells in the photoreceptor (PR) layer, and thus effectively distinguish cone cells and rod cells. The secondary antibody used was goat anti-rabbit IgG with red fluorescence (purchased from Thermofisher, catalog number A-11012). At the same time, DAPI was used to stain the cell nuclei of each layer, and the DAPI imaging was blue.

[0161] The sections were photographed, and finally, the expression section diagrams of the CA10 and re_CA10 promoters were obtained, as Figure 2 shown.

[0162] It can be seen from Figure 2 the figure that green fluorescence only appears in the cells of the photoreceptor layer, proving that placing the CA10 promoter either forward or backward upstream of the open reading frame of the fluorescent protein can drive the expression of the downstream protein, and the expression intensity is very strong. From the overall expression situation, the CA10 promoter is only expressed in photoreceptor cells, and no expression is observed in other cells, showing very high photoreceptor cell expression specificity.

[0163] Example 2: Verification of Bidirectional Promoter Expression Activity (Mouse)

[0164] Based on the expression vectors pAAV[Exp]-{CA10}>NLS-EGFP:WPRE and pAAV[Exp]-{re_CA10}>NLS-EGFP:WPRE described in Example 1, a protein expression cassette of NLS_mCherry was inserted reversely upstream of the CA10 and re_CA10 promoters in the two vectors respectively by conventional digestion and ligation methods to construct the corresponding expression vector pAAV-SV40late pA-NLS_mCherry <ca10>NLS_EGFP-BGH pA and expression vector pAAV-SV40 late pA-NLS_mCherry<re_CA10>NLS_EGFP-BGH pA, used to observe the expression of the fluorescence expression cassettes driven by the CA10 and re_CA10 promoters on both sides simultaneously. Vector pAAV-SV40 late pA-NLS_mCherry <ca10>The vector frameworks of NLS_EGFP-BGH pA and the vector pAAV-SV40 late pA-NLS_mCherry<re_CA10>NLS_EGFP-BGH pA are respectively as Figure 3 and Figure 4 shown.

[0165] Using the same method as in Example 1 for virus packaging, high-purity virus particles (type AAV8) were obtained.

[0166] Subretinal injection was performed on mice (C57BL / 6J, 6 - 8 weeks old, purchased from Guangdong Provincial Medical Laboratory Animal Center) at a virus injection dose of 1E+9 GC / eye. One month after injection, samples were taken for sectioning, and the expression of red fluorescent protein and green fluorescent protein was observed separately in different channels of a fluorescence microscope. At the same time, DAPI was used to stain the cell nuclei of each layer, and the DAPI imaging was blue.

[0167] The sections were photographed, and finally, bidirectional expression section images of the CA10 and re_CA10 promoters were obtained, as Figure 5 shown.

[0168] It can be seen from Figure 5 that the CA10 promoter can efficiently drive the expression of fluorescent proteins downstream of both the sense and antisense strands simultaneously, and the expression of the fluorescent proteins is confined to photoreceptor cells, showing a high degree of photoreceptor cell specificity. Under the same experimental comparison conditions, the intensity of the CA10 promoter driving the expression of downstream genes on both sides is basically the same.

[0169] Example 3: Verification of Promoter Activity (Large Gene)

[0170] Since the expression cassette of the fluorescent protein is relatively short, there may be certain differences in expressing large genes. Therefore, the lacZ gene was used as a substitute gene for large genes for experimental verification. Based on the VB231203-1125phu vector (constructed internally, see https: / / en.vectorbuilder.com / vector / VB231203-1125phu.html, as Figure 6 shown), the CBh promoter was replaced with the CA10 promoter by conventional digestion and ligation methods to construct an expression vector pAAV[Exp]-CA10>LacZ_HA with the CA10 promoter upstream and the lacZ gene with the tag protein HA downstream.

[0171] Using the same method as in Example 1 for virus packaging, high-purity virus particles (type AAV8) were obtained.

[0172] Mice (C57BL / 6J, 6 - 8 weeks old, purchased from Guangdong Provincial Medical Laboratory Animal Center) were injected subretinally with a viral dose of 8E+9 GC / eye. One month after injection, samples were taken for sectioning and immunofluorescence staining. The primary antibody used during immunofluorescence was an anti - HA tag antibody (purchased from thermofisher, catalog number 14 - 6756 - 81), which can specifically bind to the HA tag protein and can indirectly confirm whether the lacZ gene is transcribed and translated normally. The secondary antibody used was goat anti - rabbit IgG with red fluorescence (purchased from Thermofisher, catalog number A - 11012). At the same time, DAPI was used to stain the cell nuclei of each layer, and the DAPI imaging was blue.

[0173] The sections were photographed, and finally, a section image of the CA10 promoter expressing the large gene was obtained, as Figure 7 shown.

[0174] It can be seen from Figure 7 that the CA10 promoter can normally drive the expression of the lacZ gene and the HA tag protein in photoreceptor cells, demonstrating that the CA10 promoter has the ability to express large genes. Therefore, this promoter can be used to specifically express functional therapeutic proteins in photoreceptor cells.

[0175] Example 4: Construction and Activity Verification of Functional Variants of the CA10 Promoter

[0176] After confirming the bidirectional expression specificity of the CA10 promoter, random mutations, deletions, and substitutions were performed on the CA10 promoter to construct a series of CA10 variant promoters, including the CA10V1 (SEQ ID NO:2), CA10V2 (SEQ ID NO:3), CA10V3 (SEQ ID NO:4), and CA10V4 (SEQ ID NO:5) promoters. The sequence identity between the sequences of the variant promoters and the CA10 promoter is shown in the following table:

[0177] CA10 CA10V1 CA10V2 CA10V3 CA10V4 CA10 100％ - - - - CA10V1 82.57％ 100％ - - - CA10V2 96.54％ 79.14％ 100％ - - CA10V3 91.07％ 74.06％ 87.93％ 100％ - CA10V4 90.37％ 75.60％ 87.01％ 84.75％ 100％

[0178] According to the method described in Example 2, a series of expression vectors with the variant promoters CA10V1, CA10V2, CA10V3, and CA10V4 in the middle, the nuclear - localization red fluorescent protein (NLS - mCherry) gene upstream, and the nuclear - localization green fluorescent protein (NLS - EGFP) gene downstream were constructed. They were packaged and purified into viruses, and the promoter activity was verified in mice. Finally, an expression section image of the promoter was obtained, as Figure 8 shown.

[0179] It can be seen from Figure 8 It can be seen that all variant promoters CA10V1, CA10V2, CA10V3, and CA10V4 can bidirectionally drive the expression of downstream genes on the positive and negative strands at a high level in photoreceptor cells, with slightly different expression intensities, while maintaining the characteristics of photoreceptor cell-specific expression. Therefore, a series of photoreceptor cell-specific bidirectional promoters with different expression intensities were obtained. The reverse complementary sequences of the variant promoters CA10V1, CA10V2, CA10V3, and CA10V4 are shown as SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10, respectively.

[0180] Although the above embodiments illustrate multiple aspects of the present invention, the embodiments are given by way of illustration rather than limitation. Based on the above discussion and the content of the embodiments, those skilled in the art can determine the basic features of multiple aspects of the present disclosure, and without departing from the spirit and scope of the present disclosure, they can make various changes and modifications to adapt them to various uses and conditions. Therefore, from the content of the above specification, various modifications will be clear to those skilled in the art in addition to the specific solutions shown and described herein. Such modifications should also be considered as falling within the scope of the appended claims.

[0181] The sequence information related to the present invention is as follows:

[0182] CA10 promoter sequence (347bp): SEQ ID NO:1

[0183] TCGATCGAGGGCCCTTGGCCTGAGTCAAGATGACAGCAGCCCCCATACCCTGGGAGACCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGAATGATCTAATCGGATTCCAAGCATCCCCAGGAACCCTCGACAGGGCCCGGTCTCTCTCGTCCAGCAAGGGCAGGGACGGGCCACAGGCCAAGGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGCATGAAGCACTGCTATAATTAGCTC

[0184] CA10V1 promoter sequence (347bp): SEQ ID NO:2

[0185] GAGCTAATTATAGCAGTGCTTCATGCCCCTGGGAGACCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGAATGATCTAATCGGATTCCAAGCATCCCCAGGAACCCTCGACAGGGCCCGGTCTCTCTCGTCCAGCAAGGGCAGGGACGGGCCACAGGCCAAGGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCTATGGGGGCTGCTGTCATCTTGACTCAGGCCAAGGGCCCTCGATCGA

[0186] CA10V2 promoter sequence (347bp): SEQ ID NO:3

[0187] TCGATCGAGGGCCCTTGGCCTGAGTCAAGATGACAGCAGCCCCCATACCCTGGGAGACCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGAATGATCTAATCGGATTCCAAGCATCGCCAGGAACCCTCGAAAGGGCCCGGTCTTTCGCGTCCAGCAAGGGCAGGGACGGGCCACAGGCCAAGGGGGCTGACACATCACAATGCTCAGTCTCAGCCGTGGTCGCGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGCATGAAGCACTGCTATAATTAGCTC

[0188] CA10V3 promoter sequence (335bp): SEQ ID NO:4

[0189] TCGATCGAGGGCCCTTGGCCTGAGTCAAGATGACAGCAGCCCCCATACCCTGGGAGCCCGGGGCTGACTCAGCACCAAGCTAAATCCCAGCCGTGGACACGGAGACTGATCTAACCGGATTCCAAGCATCCCCAGAAACCCTCGACAGGTCCCGCTCTCTCTGGTCCAGCAAGGGCAGGGACGGGGGGGCAGACACAGCACCAGGCTTAATCCCAGCCGGGGTCACGGAGGACGCTTGGGAGTGGCAAGATTGTGCTAGATAAAGACAATACCCTGAGGTGCTTGGAATCCGATTAGATCATTCTGCCCGCATGAAGCACTGCTATAATTAGCTC

[0190] CA10V4 promoter sequence (333bp): SEQ ID NO:5

[0191] TCGATCGAGGGCCCTTGGCCTGAAAGATGACAGCAGCCCCCATACCCTGGGAGACCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGCATGATCTACTCAGATTCCAAGCATCCCCAGGAACCCTCGGGACGGGTCTCTCTCGTCCGCGAGCAAGGGCAGGGAGCGACGGGCCTAGGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCGAGTGGCAAGAAGGTGCTAAAAGACAATCCCCTGAGCTGCTTGGCATAATCCGATTAGATCATTCTGCCCGGAAGCACTGCTATAATTAGCTC

[0192] re_CA10 promoter sequence (347bp): SEQ ID NO:6

[0193] GAGCTAATTATAGCAGTGCTTCATGCGGGCAGAATGATCTAATCGGATTCCAAGCAGCTCAGGGGATTGTCTTTTTCTAGCACCTTCTTGCCACTCCTAAGCGTCCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCCTTGGCCTGTGGCCCGTCCCTGCCCTTGCTGGACGAGAGAGACCGGGCCCTGTCGAGGGTTCCTGGGGATGCTTGGAATCCGATTAGATCATTCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCGGTCTCCCAGGGTATGGGGGCTGCTGTCATCTTGACTCAGGCCAAGGGCCCTCGATCGA

[0194] re_CA10V1 promoter sequence (347bp): SEQ ID NO:7

[0195] TCGATCGAGGGCCCTTGGCCTGAGTCAAGATGACAGCAGCCCCCATAGGGCAGAATGATCTAATCGGATTCCAAGCAGCTCAGGGGATTGTCTTTTTCTAGCACCTTCTTGCCACTCCTAAGCGTCCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCCTTGGCCTGTGGCCCGTCCCTGCCCTTGCTGGACGAGAGAGACCGGGCCCTGTCGAGGGTTCCTGGGGATGCTTGGAATCCGATTAGATCATTCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCGGTCTCCCAGGGGCATGAAGCACTGCTATAATTAGCTC

[0196] re_CA10V2 promoter sequence (347bp): SEQ ID NO:8

[0197] GAGCTAATTATAGCAGTGCTTCATGCGGGCAGAATGATCTAATCGGATTCCAAGCAGCTCAGGGGATTGTCTTTTTCTAGCACCTTCTTGCCACTCCTAAGCGTCCTCCGCGACCACGGCTGAGACTGAGCATTGTGATGTGTCAGCCCCCTTGGCCTGTGGCCCGTCCCTGCCCTTGCTGGACGCGAAAGACCGGGCCCTTTCGAGGGTTCCTGGCGATGCTTGGAATCCGATTAGATCATTCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCGGTCTCCCAGGGTATGGGGGCTGCTGTCATCTTGACTCAGGCCAAGGGCCCTCGATCGA

[0198] re_CA10V3 promoter sequence (335bp): SEQ ID NO:9

[0199] GAGCTAATTATAGCAGTGCTTCATGCGGGCAGAATGATCTAATCGGATTCCAAGCACCTCAGGGTATTGTCTTTATCTAGCACAATCTTGCCACTCCCAAGCGTCCTCCGTGACCCCGGCTGGGATTAAGCCTGGTGCTGTGTCTGCCCCCCCGTCCCTGCCCTTGCTGGACCAGAGAGAGCGGGACCTGTCGAGGGTTTCTGGGGATGCTTGGAATCCGGTTAGATCAGTCTCCGTGTCCACGGCTGGGATTTAGCTTGGTGCTGAGTCAGCCCCGGGCTCCCAGGGTATGGGGGCTGCTGTCATCTTGACTCAGGCCAAGGGCCCTCGATCGA

[0200] re_CA10V4 promoter sequence (333bp): SEQ ID NO:10

[0201] GAGCTAATTATAGCAGTGCTTCCGGGCAGAATGATCTAATCGGATTATGCCAAGCAGCTCAGGGGATTGTCTTTTAGCACCTTCTTGCCACTCGCGTCCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCCTAGGCCCGTCGCTCCCTGCCCTTGCTCGCGGACGAGAGAGACCCGTCCCGAGGGTTCCTGGGGATGCTTGGAATCTGAGTAGATCATGCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCGGTCTCCCAGGGTATGGGGGCTGCTGTCATCTTTCAGGCCAAGGGCCCTCGATCGA

Claims

1. A bidirectional promoter having photoreceptor cell-specific promoter activity.

2. The bidirectional promoter according to claim 1, wherein the bidirectional promoter comprises a nucleotide sequence having at least 70% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10; preferably, the bidirectional promoter comprises a nucleotide sequence having at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10; more preferably, the bidirectional promoter comprises the nucleotide sequence as shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

3. The bidirectional promoter according to claim 1, wherein the bidirectional promoter consists of a nucleotide sequence having at least 70% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10; preferably, the bidirectional promoter consists of a nucleotide sequence having at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10; more preferably, the bidirectional promoter consists of the nucleotide sequence as shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

4. An expression cassette, wherein the expression cassette comprises the bidirectional promoter according to any one of claims 1 to 3.

5. The expression cassette according to claim 4, wherein the expression cassette further comprises a target nucleic acid operably linked to the bidirectional promoter; wherein the target nucleic acid encodes a therapeutic protein, a optogenetic driving protein or a reporter protein, or the target nucleic acid encodes a nucleic acid selected from siRNA, shRNA, RNAi, miRNA, antisense RNA, ribozyme and deoxyribozyme.

6. A vector, wherein the vector comprises the bidirectional promoter according to any one of claims 1 to 3 or the expression cassette according to claim 4 or 5.

7. The vector according to claim 6, which is a viral vector.

8. The vector according to claim 7, wherein the viral vector is an adeno-associated virus (AAV) vector, a retroviral vector or a parvovirus vector; optionally, the viral vector is a MoMLV vector, an MSCV vector, an SFFV vector, an MPSV vector, an SNV vector, a lentiviral vector, an adenoviral vector, an adeno-associated virus vector, a simian virus 40 vector, a bovine papillomavirus vector, an Epstein-Barr virus vector, a herpesvirus vector, a vaccinia virus vector, a Harvey murine sarcoma virus vector, a murine mammary tumor virus vector, a circovirus vector or a Rous sarcoma virus vector.

9. A viral particle, wherein the viral particle comprises a vector according to any one of claims 6 to 8; optionally, the vector is an AAV vector, preferably, wherein the AAV serotype is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74 and AAVdj, more preferably selected from AAV-2, AAV-5, AAV2-7m8, AAV-9 and AAV-8, and even more preferably AAV-2, AAV2-7m8 or AAV-8.

10. A cell, wherein the cell comprises a bidirectional promoter according to any one of claims 1 to 3, an expression cassette according to claim 4 or 5, a vector according to any one of claims 6 to 8, or a viral particle according to claim 9.

11. The cell according to claim 10, wherein the cell is a photoreceptor cell, cone cell, rod cell, retinal pigment epithelial cell (RPE), HEK293, HEK293T, BHK or CHO cell.

12. A pharmaceutical composition, wherein the pharmaceutical composition comprises a bidirectional promoter according to any one of claims 1 to 3, an expression cassette according to claim 4 or 5, a vector according to any one of claims 6 to 8, a viral particle according to claim 9, or a cell according to claim 10 or 11, and a pharmaceutically acceptable excipient or carrier.

13. Use of a bidirectional promoter according to any one of claims 1 to 3, an expression cassette according to claim 4 or 5, a vector according to any one of claims 6 to 8, a viral particle according to claim 9, a cell according to claim 10 or 11, or a pharmaceutical composition according to claim 12 in the preparation of a drug for the treatment or prevention of eye diseases.

14. The use according to claim 13, wherein the eye disease is a hereditary retinal disease.

15. The use according to claim 13, wherein the eye disease is selected from retinitis pigmentosa (RP), age-related macular degeneration, Stargardt disease, Leber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best disease, choroideremia, tapetoretinal degeneration, achromatopsia (rod monochromacy), retinal pigmentopathy, night blindness, X-linked retinoschisis and Usher syndrome.

16. A method for expressing a target polypeptide or nucleic acid in a cell, wherein the method comprises introducing a bidirectional promoter according to any one of claims 1 to 3, an expression cassette according to claim 4 or 5, a vector according to any one of claims 6 to 8, or a viral particle according to claim 9 into the cell.

17. The method according to claim 16, wherein the cells are selected from photoreceptor cells, cone cells, rod cells or retinal pigment epithelial cells (RPE).

Images