Application of BtRPSA gene in control of Bemisia tabaci, agents for control of Bemisia tabaci and control methods

Abstract

The present invention discloses the use of a BtRPSA gene in the control of whiteflies, as well as reagents and methods for controlling whiteflies, belonging to the technical field of insect pest control. The nucleic acid sequence of the whitefly BtRPSA gene is shown in SEQ ID NO. 1. A highly efficient silencing agent, dsBtRPSA, is prepared based on the BtRPSA gene. The dsBtRPSA is introduced into the whitefly through feeding, significantly reducing the heat tolerance of the whitefly, thereby achieving the purpose of control. This method is easy to operate, highly effective and specific, and has significant effects. It is also environmentally friendly and has many advantages, and has great application prospects in the control of whiteflies.

Description

Technical Field

[0001] The present invention belongs to the technical field of insect pest control, and particularly relates to an application of a BtRPSA gene in the control of Bemisia tabaci, a reagent for controlling Bemisia tabaci, and a control method. Background Art

[0002] Bemisia tabaci (Gennadius) belongs to the family Aleyrodidae, order Hemiptera, class Insecta. It was first reported in 1889 on tobacco plants in Greece. Over the past 40 years, it has become a significant agricultural pest worldwide, causing severe economic losses to vegetables, cotton, and other crops.

[0003] Currently, the primary method for controlling whiteflies is chemical control. Spraying synthetic insecticides, such as organophosphates and carbamates, can quickly and effectively kill whiteflies. While simple to use and highly effective, these methods can harm non-target organisms. Long-term use can also lead to insecticide resistance, environmental pollution, and safety risks. Biological control methods are eco-friendly and leave no chemical residue, making them a research hotspot in recent years.

[0004] RNA interference (RNAi) is a mechanism of action triggered by short RNA fragments (siRNAs) that promotes the degradation of homologous mRNA or inhibits its translation. RNAi was first discovered in nematodes and is effective in most organisms. The use of RNAi technology for gene function research, transgenic insect-resistant plants, and new nucleic acid pesticides has gradually become an important green biocontrol method in the plant protection industry. RNAi technology can specifically inhibit gene expression and efficiently target and silence pest genes, thereby achieving the purpose of pest control. It shows great potential in the development of new pest management strategies. Developing exogenous dsRNA products suitable for the control of whiteflies at the genetic level is easy to use and low-cost. Moreover, due to the gene specificity, it can achieve precise control effects and is environmentally friendly. It has great application prospects in the control of whiteflies. Summary of the Invention

[0005] In view of the problems existing in the prior art, the object of the present invention is to provide an application of the BtRPSA gene in the control of Bemisia tabaci, an agent for controlling Bemisia tabaci, and a control method.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The invention relates to the use of the Bemisia tabaci BtRPSA gene in controlling Bemisia tabaci or preparing an agent for controlling Bemisia tabaci. The nucleic acid sequence of the Bemisia tabaci BtRPSA gene is shown in SEQ ID NO.1.

[0008] On the basis of the above scheme, gene silencing is used to inhibit the expression of the BtRPSA gene in whiteflies and reduce the heat resistance of whiteflies.

[0009] Based on the above scheme, the gene silencing method is RNA interference.

[0010] A dsRNA for biological control of Bemisia tabaci comprises primers designed for the BtRPSA gene of Bemisia tabaci, and dsRNA targeting the BtRPSA gene of Bemisia tabaci is synthesized; the nucleic acid sequence of the BtRPSA gene of Bemisia tabaci is shown in SEQ ID NO.1.

[0011] Based on the above scheme, the primers are shown as SEQ ID NO.2 and SEQ ID NO.3.

[0012] Based on the above scheme, the nucleic acid sequence corresponding to the sense strand of the dsRNA is shown as SEQ ID NO.4; the nucleotide sequence corresponding to the antisense strand is the reverse complementary sequence of SEQ ID NO.4.

[0013] An agent for controlling Bemisia tabaci, comprising the above-mentioned dsRNA.

[0014] Based on the above scheme, the concentration of dsRNA in the agent for controlling Bemisia tabaci is ≥750 ng / μL.

[0015] A method for controlling Bemisia tabaci comprises inhibiting the expression of a BtRPSA gene in Bemisia tabaci by gene silencing, thereby reducing the heat resistance of the Bemisia tabaci. The nucleic acid sequence of the BtRPSA gene in Bemisia tabaci is shown in SEQ ID NO.1.

[0016] Based on the above scheme, the gene silencing method is RNA interference.

[0017] Based on the above scheme, the RNA interference is achieved by feeding whiteflies so that they ingest the dsRNA of the BtRPSA gene.

[0018] Based on the above scheme, the dsRNA of the BtRPSA gene was prepared by the following method:

[0019] The cDNA reverse transcribed from total RNA of Bemisia tabaci was used as a template and PCR amplification was performed using primers for synthesizing dsRNA. The PCR amplification product was recovered and purified and used as a template for in vitro transcription of dsRNA. dsRNA was synthesized by in vitro transcription.

[0020] Based on the above scheme, the primers for synthesizing dsRNA are shown as SEQ ID NO.2 and SEQ ID NO.3.

[0021] Based on the above scheme, the nucleic acid sequence corresponding to the sense strand of the dsRNA is shown as SEQ ID NO.4; the nucleotide sequence corresponding to the antisense strand is the reverse complementary sequence of SEQ ID NO.4.

[0022] On the basis of the above scheme, the whitefly is a MED cryptic species (Mediterranean, i.e. Q-type whitefly).

[0023] The present invention has the following beneficial effects:

[0024] The present invention provides the BtRPSA gene of Bemisia tabaci and its use in whitefly control. The invention also develops a highly effective silencing dsRNA for the gene, and a technology for highly effective whitefly control. Specifically, the dsBtRPSA gene is introduced into the whiteflies through feeding, significantly reducing their heat tolerance, thereby achieving control. This method is easy to operate, highly effective and specific, and has significant effects, as well as being environmentally friendly. It has great application prospects in whitefly control. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Changes in BtRPSA gene expression in Bemisia tabaci from Lingshui region after feeding on dsEGFP and dsBtRPSA (* indicates significant differences between the control and treatment groups, 0.01<P≤0.05);

[0026] Figure 2 Differences in heat tolerance of Bemisia tabaci at 42°C in Lingshui area before and after BtRPSA interference (*** indicates significant differences between the control and treatment groups, P≤0.001).

[0027] Figure 3 Differences in heat tolerance of Bemisia tabaci at 43°C in Lingshui area before and after BtRPSA interference (* indicates significant difference between the control and treatment groups, 0.01<P≤0.05). DETAILED DESCRIPTION

[0028] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. Below, in conjunction with specific examples, the present invention will be further described in detail with reference to data. The following examples are merely for illustration of the present invention and are not intended to limit the scope of the present invention in any way.

[0029] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0030] The whitefly used in the following examples is the MED cryptic species (Mediterranean, i.e., Q-type whitefly), which was collected from Lingshui, Hainan in 2017 and then reared in an insectary with tobacco plants (temperature 27±1°C, relative humidity 60±5%, photoperiod 16L:8D).

[0031] RNA was extracted using the TRIzol method (Thermo Fisher Scientific, USA). The reverse transcription reagent (EvoM-MLV RT Mix Kit with gDNA Clean for qPCR) was purchased from AG Aikerui Biotechnology Co., Ltd., the dsRNA synthesis kit (TranscriptAid T7 High Yield Transcription Kit) was purchased from Thermo Fisher Scientific Co., Ltd., the kit used in the PCR reaction system (Premix TaqTM) was purchased from TAKARA Biotechnology Co., Ltd., and SteadyPure micro PCR & gel recovery reagent was purchased from AG Aikerui Biotechnology Co., Ltd.

[0032] The data processing method of the following examples: For the analysis of the results of the dsRNA bioassay on whiteflies, the search speed of whiteflies was statistically analyzed using Excel 2021, and the differences between different groups were analyzed using independent sample T test using SPSS 26.0 software. For the analysis of the changes in target gene expression after RNA interference, RT-qPCR data were analyzed using 2 -△△Ct The data were analyzed using the independent sample T test using SPSS 26.0 software.

[0033] Example 1

[0034] A dsRNA for biological control of Bemisia tabaci is prepared by the following method:

[0035] (1) Primers were designed based on the open reading frame of the BtRPSA gene of Bemisia tabaci (shown in SEQ ID NO. 1) for synthesizing dsRNA. The primer sequences are shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0036] SEQ ID NO.1(5'→3'):

[0037] ATGTCAGGCGGGCTAGACGTATTGAGTCTCAAAGAAGATGATGTGACCAAAATGCTGGTTGCCACTGCGCACATTGGCACAACCAATGTTAACTTCCAGTTGGAATCCTATGTCTACAAACGGAGGAAGGATGGTGTTCACATCATCAACCTGCGCAAAACTTGGGAGAAACTCCTGTTGGCCGCAAGAGCAATTGCTGCTGTAGAAAACCCTGCTGATGTCTACGTCATCTCTTCCCGGCCTTATGGACAGAGAGCAGTTCTTAAATTCGCCACTCACACTGGTGCCACCCCCATCGCTGGGCGATTCACACCTGGTGCTTTCACCAATCAGATTCAAGCTGCTTTCCGAGAGCCGCGTATCTTAGTTGTCACAGACCCTGAATTTGACCACCAACCTGTGACAGAAGGATCATATGTGAATATTCCTGTTATTGCGCTGTGCAGCACAGACTCCCCCACTCGTTACATCGATATCGCTATTCCATGTAATAACAAGACACCCACCTCAATAGGTCTTATGTGGTGGTTATTAGCACGTGAGGTTCTGAGGTTACGAGGTTTAATCACCCGAGAAAGCAAATGGGACGTCGTCGTTGACTTGTTCTTCTACAGAGACCCAGAAGAGGCAGAGAAAGAAGAACTGGCTGCAAAGGAAGCTGCTCCTGCTGCTGTCCCAGCTGTAAAGGCTGCTGAAGGTATCGAATACACAGCCCAGGCCGATGACTGGAATATCCCAGCCGTACCTGAGGTCGCCCCAGTCGCCCAAGATTGGAATGCTGAGGTCCCAGCCGTAGCTCCAGTCCCTGTTGCTGCTGCTGCACCAGTGTACGCACCACCCCCCACACAAGCTGCCGATGACTGGACTGCACCCGTTTCAGAGGAATGGCAAGCAGGCACAGAATGGGCCAGTGGTAGTGGGAACTGGAACTAA

[0038] dsBtRPSA-F: 5'-taatacgactcactataggggAAACGGAGGAAGGATGGTGT-3' (SEQ IDNO.2);

[0039] dsBtRPSA-R: 5'-taatacgactcactatagggCGTCCCATTTGCTTTCTCGG-3' (SEQ IDNO.3);

[0040] (2) Forty newly emerged adults of Bemisia tabaci were placed in a 1.5 mL centrifuge tube and total RNA was extracted using the TRIzol method. The concentration and quality of RNA were measured using an ultra-micro UV spectrophotometer (N60). The RNA was then reverse transcribed using the EvoM-MLV RT Mix Kit with gDNA Clean for qPCR, AG, according to the instructions to synthesize the first-strand cDNA.

[0041] (3) using the Bemisia tabaci cDNA synthesized in step (2) as a template, and performing PCR amplification using the primer pair shown in SEQ ID NO. 2 and SEQ ID NO. 3;

[0042] The reaction system for PCR amplification was as follows: 25 μL of Premix Taq (TaKaRa TaqTM Version 2.0plus dye), 2 μL of upstream primer (10 μmoL / L), 2 μL of downstream primer (10 μmoL / L), 2 μL of template, and dd H2O was added to make up to 50 μL.

[0043] The PCR amplification reaction procedure was as follows: pre-denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 40 s, and then extension at 72°C for 10 min. The amplified product was stored at 4°C.

[0044] (4) After the PCR reaction in step (3) is completed, the amplification results are detected by agarose gel electrophoresis, and the PCR product obtained above is recovered and purified using SteadyPure Micro PCR & Gel Recovery Reagent (AG Aikerui Biotechnology Co., Ltd.) and used as a template for in vitro transcription of dsRNA.

[0045] A 512-bp PCR amplification product was obtained by PCR. After sequencing and deletion of the T7 promoter sequence, a 472-bp nucleotide sequence was obtained, which is the target sequence for synthesizing dsRNA from the BtRPSA gene, as shown in SEQ ID NO.4. The dsRNA from the BtRPSA gene is a double-stranded RNA consisting of a sense strand and an antisense strand. The nucleotide sequence corresponding to the sense strand is shown in SEQ ID NO.4, and the nucleotide sequence corresponding to the antisense strand is the reverse complement of SEQ ID NO.4.

[0046] SEQ ID NO.4 (5'→3'):

[0047] AAACGGAGGAAGGATGGTGTTCACATCATCAACCTGCGCAAAACTTGGGAGAAACTCCTGTTGGCCGCAAGAGCAATTGCTGCTGTAGAAAACCCTGCTGATGTCTACGTCATCTCTTCCCGGCCTTATGGACAGAGAGCAGTTCTTAAATTCGCCACTCACACTGGTGCCACCCCCATCGCTGGGCGATTCACACCTGGTGCTTTCACCAATCAGATTCAAGCTGCTTTCCGAGA GCCGCGTATCTTAGTTGTCACAGACCCTGAATTTGACCACCAACCTGTGACAGAAGGATCATATGTGAATATTCCTGTTATTGCGCTGTGCAGCACAGACTCCCCACTCGTTACATCGATATCGCTATTCCATGTAATAACAAGACACCCACCTCAATAGGTCTTATGTGGTGGTTATTAGCACGTGAGGTTCTGAGGTTACGAGGTTTAATCACCCGAGAAAGCAAATGGGACG

[0048] (5) using the PCR product purified in step (4) as a template for in vitro transcription of dsRNA to prepare dsRNA;

[0049] The in vitro transcription system for dsRNA is as follows: NTPMix 8μL, 5× TranscriptAid Reaction Buffer 4μL, TrunscriptAid Enzyme Mix 2μL, and template 6μL. Incubate at 37°C for at least 2 hours.

[0050] After the reaction, add a single enzyme digestion system to remove residual template DNA and single-stranded RNA. The single enzyme digestion system is 2 μL of DNase I. Incubate at 37°C for 30 min.

[0051] The product was stored in a -20°C refrigerator to obtain dsRNA for biological control of Bemisia tabaci, which was designated as dsBtRPSA.

[0052] Example 2: Inhibition of BtRPSA Gene Expression in Bemisia tabaci by dsBtRPSA

[0053] The following tests were conducted in Lingshui (LS):

[0054] 100 newly emerged adults of Bemisia tabaci were placed in cylindrical test tubes. The tubes were sealed with filter paper. The dsBtRPSA prepared in Example 1 was diluted to 750 ng / μL in a 20% sucrose solution. The solution was then added to the filter paper from above the tube cap. The test tubes were gently rotated to completely coat the filter paper with the dsBtRPSA solution. The insects were then placed in the insectary for feeding. Newly emerged adults of Bemisia tabaci fed dsEGFP served as a control group, specifically fed with an equal concentration of dsEGFP in a sucrose solution. Three replicates were performed for each group.

[0055] Here, dsEGFP refers to dsRNA derived from the enhanced green fluorescent protein gene (EGFP). In the preparation method, the primers used for dsRNA synthesis are shown in SEQ ID NOs. 5 and 6. The template used for PCR amplification is a laboratory-stored plasmid containing the EGFP gene. The resulting PCR product is 520 bp in size, and its specific sequence is shown in SEQ ID NO. 7. The remaining reagents and methods used are the same as those used in the method for preparing dsBtRPSA in Example 1. The dsRNA derived from the EGFP gene is double-stranded RNA, consisting of a sense strand and an antisense strand. The nucleotide sequence corresponding to the sense strand is shown in SEQ ID NO. 7, and the nucleotide sequence corresponding to the antisense strand is the reverse complement of SEQ ID NO. 7.

[0056] dsEGFP-F: 5'-taatacgactcactatagggg CCTGAAGTTCATCTGCACCA-3' (SEQ IDNO.5);

[0057] dsEGFP-R: 5'-taatacgactcactataggg GTGCTCAGGTAGTGGTTGTCG-3' (SEQ IDNO.6);

[0058] SEQ ID NO.7 (5'→3'):

[0059] CCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCAT CGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCAC

[0060] Two days after whiteflies began feeding on dsRNA, newly emerged adults were collected from whiteflies treated with 750 ng / μL dsBtRPSA and dsEGFP, with three biological replicates collected for each treatment. RNA was extracted and purified from each group, then reverse-transcribed into cDNA and diluted 20-fold to serve as a template for quantitative PCR. RT-qPCR analysis was performed using the following primers:

[0061] The quantitative primers for the BtRPSA gene are as follows:

[0062] F:5'-CCGAGAAAGAAATGGGACG-3' (SEQ ID NO.8);

[0063] R: 5'-CAGTTCTTCTTTCTCTGCCTCT-3' (SEQ ID NO.9);

[0064] The primers for the internal reference gene Actin are as follows:

[0065] F: 5'-TCTTCCAGCCATCCTTCTTG-3' (SEQ ID NO. 10);

[0066] R: 5'-CGGGTGATTTCCTTCTGCATT-3' (SEQ ID NO. 11);

[0067] The RT-qPCR system was (10 μL): 1.6 μL of ddH2O, 5 μL of 2×SYBR Green (AG), 0.20 μL of upstream primer and downstream primer (10 μM) and 3.0 μL of cDNA first-strand template.

[0068] RT-qPCR reaction instrument Bio-Rad CFX Connect Real-Time system (BIO-RAD, USA).

[0069] The reaction conditions were 95°C for 2 min; 95°C for 15 s, 60°C for 30 s, 39 cycles, with 3 technical replicates for each sample.

[0070] The results are as follows Figure 1 As shown. Using dsEGFP as a control, the relative expression of the BtRPSA gene in whiteflies fed dsBtRPSA was analyzed two days after feeding. The results showed that BtRPSA expression in whiteflies fed dsBtRPSA showed a significant downward trend compared to that in whiteflies fed dsEGFP. On the second day after feeding dsRPSA, BtRPSA expression in the Lingshui strain decreased by approximately 36.6% compared to the control group, further demonstrating that dsBtRPSA feeding induces a strong RNAi effect in whiteflies, significantly reducing BtRPSA expression and, in turn, inhibiting heat tolerance.

[0071] Example 3: Application of dsBtRPSA in Reducing Heat Tolerance of Bemisia tabaci

[0072] An experiment was conducted in Lingshui (LS) area to investigate the effect of feeding dsBtRPSA on the heat tolerance of Bemisia tabaci.

[0073] 100 newly emerged adults of Bemisia tabaci were placed in cylindrical test tubes. The tubes were sealed with filter paper. dsBtRPSA was diluted to 750 ng / μL in a 20% sucrose solution and added to the filter paper from above the tube cap. The tubes were gently swirled to coat the filter paper with the dsBtRPSA solution. The insects were then placed in an insectary and fed for 48 hours. Newly emerged adults of Bemisia tabaci fed dsEGFP served as a control group, specifically fed with an equal concentration of dsEGFP in a sucrose solution. Three replicates were used for each group.

[0074] A heat shock assay was used to assess the heat tolerance of whiteflies fed dsRNA. The following method was used: a group of 60 whiteflies were placed in a bioassay tube covered with 1% agar and a tobacco leaf on one end, with the other end being airtight. The tubes were then placed in an incubator at 42°C and 60% relative humidity for 2 hours. Mortality was determined after the heat shock.

[0075] The results are as follows Figure 2 As shown in Figure 2, after continuously feeding newly emerged adults of Bemisia tabaci with dsBtRPSA for 48 hours, the mortality rate of newly emerged adults of Bemisia tabaci showed an increasing trend. Figure 2 The results showed that there was a significant difference between the Lingshui dsBtRPSA-treated group and the control group, indicating that dsBtRPSA consumption can induce a strong RNAi effect in whiteflies, affecting their heat tolerance.

[0076] Example 4: Application of dsBtRPSA in Reducing Heat Tolerance of Bemisia tabaci

[0077] An experiment was conducted in Lingshui (LS) area to investigate the effect of feeding dsBtRPSA on the heat tolerance of Bemisia tabaci.

[0078] 100 newly emerged adults of Bemisia tabaci were placed in cylindrical test tubes. The tubes were sealed with filter paper. dsBtRPSA was diluted to 750 ng / μL in a 20% sucrose solution and added to the filter paper from above the tube cap. The tubes were gently swirled to coat the filter paper with the dsBtRPSA solution. The insects were then placed in an insectary and fed for 48 hours. Newly emerged adults of Bemisia tabaci fed dsEGFP served as a control group, specifically fed with an equal concentration of dsEGFP in a sucrose solution. Three replicates were used for each group.

[0079] A heat shock assay was used to assess the heat tolerance of whiteflies fed dsRNA. Sixty whiteflies were placed in a bioreactor tube covered with 1% agar and a tobacco leaf on one end, with the other end permeable to air. The tubes were then placed in an incubator at 43°C and 60% relative humidity for one hour. Mortality was determined after the heat shock.

[0080] The results are as follows Figure 3 As shown in Figure 2, after continuously feeding newly emerged adults of Bemisia tabaci with dsBtRPSA for 48 hours, the mortality rate of newly emerged adults of Bemisia tabaci showed an increasing trend. Figure 3 The results showed that there was a significant difference between the Lingshui dsBtRPSA-treated group and the control group, indicating that dsBtRPSA consumption can induce a strong RNAi effect in whiteflies, affecting their heat tolerance.

[0081] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other manner. Any person skilled in the art may utilize the above-disclosed technical content to modify or modify the present invention into equivalent embodiments. However, any simple modifications, equivalent variations, and modifications to the above embodiments that do not depart from the technical content of the present invention and are based on the technical essence of the present invention remain within the scope of protection of the present invention.

Claims

1. Bemisia tabaci BtRPS The use of dsRNA of a gene in controlling Bemisia tabaci or preparing an agent for controlling Bemisia tabaci is characterized in that: Bemisia tabaci BtRPS The nucleic acid sequence of the gene is shown in SEQ ID NO.1, and the primers for synthesizing dsRNA are shown in SEQ ID NO.2 and SEQ ID NO.

3.

2. The use according to claim 1, characterized in that By gene silencing, the BtRPS The expression of genes reduces the heat tolerance of whiteflies.

3. A dsRNA for biological control of Bemisia tabaci, characterized in that: Targeting Bemisia tabaci BtRPS Gene design primers, synthesis of specific Bemisia tabaci BtRPS dsRNA of a gene; Bemisia tabaci BtRPS The nucleic acid sequence of the gene is shown as SEQ ID NO.1; the primers are shown as SEQ ID NO.2 and SEQ ID NO.3; the nucleic acid sequence corresponding to the dsRNA positive strand is shown as SEQ ID NO.4; and the nucleotide sequence corresponding to the antisense strand is the reverse complementary sequence of SEQ ID NO.

4.

4. An agent for controlling Bemisia tabaci, characterized in that: Containing the dsRNA according to claim 3.

5. A method for controlling Bemisia tabaci, characterized in that: By gene silencing, the BtRPS Gene expression reduces the heat tolerance of Bemisia tabaci, which BtRPS The nucleic acid sequence of the gene is shown in SEQ ID NO.

1. The gene silencing method is RNA interference. The RNA interference is achieved by feeding the whitefly with the gene. BtRPS The dsRNA of the gene and the primers for synthesizing the dsRNA are shown in SEQ ID NO.2 and SEQ ID NO.3.

Images