A SNP molecular marker related to milk fat rate in dairy cows, a detection product and its application

By identifying the SNP molecular marker chr5:92772499 in the dairy cows, the identification and selection of high-cream fat rate cattle was achieved, and the problem of improving milk fat traits in the prior art was solved, and the cream fat rate and economic benefits were improved.

CN120290749BActive Publication Date: 2025-09-05INST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510747863.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-06
Publication Date
2025-09-05
Estimated Expiration
2045-06-06

AI Technical Summary

Technical Problem

In the prior art, the research results on genetic improvement of dairy cow's milk fat traits are limited, and the lack of effective SNP sites makes it difficult to achieve accurate improvement of the milk fat rate.

Method used

A SNP molecular marker related to milk fat rate of dairy cows is provided, located in genome chr5:92772499, with a polymorphism of T or C. It can identify high-cream fat rate cows by PCR amplification and sequencing, design primer pairs and develop detection kits for identification and selection of high-cream fat rate cows.

Benefits of technology

It improves the cream fat rate of the dairy cows, increases economic benefits, provides a basis for the improvement of genetic breeding of high-yield dairy cows, and reduces breeding costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290749B_ABST
    Figure CN120290749B_ABST
Patent Text Reader

Abstract

The present invention discloses a SNP molecular marker related to the milk fat rate of dairy cows, a detection product and an application, which belong to the field of molecular biology and genetic breeding technology. The SNP molecular marker is located at chr5:92772499 in the dairy cow genome, the polymorphism is T or C, and the coordinate position is based on the reference genome ARS-UCD2.0. When the SNP polymorphism is T, the milk fat rate of the milk produced by the dairy cow is higher. The above-mentioned SNP molecular marker provided by the present invention can be used to identify and screen dairy cows with high milk fat rate, as well as to assist breeding, which is conducive to increasing the frequency of high-yield advantage SNPs containing the molecular marker in the dairy cow population, thereby increasing the milk fat rate of the population and increasing economic benefits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biology and genetic breeding technology, and in particular to a SNP molecular marker related to milk fat content in dairy cows, a detection product and an application thereof. Background Art

[0002] Milk fat is the primary carrier of fat-soluble vitamins (such as vitamins A and D) and essential fatty acids (such as conjugated linoleic acid) in milk. A higher milk fat percentage generally indicates a higher content of these nutrients. Milk fat percentage also directly affects the viscosity and smoothness of milk. Milk with a high milk fat percentage has a richer taste and a richer aroma, while milk with a low milk fat percentage has a thinner texture. Screening for SNP markers associated with milk fat percentage in regionalized cattle herds provides a tool for molecular-assisted breeding and can effectively promote targeted improvements in milk fat percentage.

[0003] against GPAM Genetic research has revealed that three SNPs (I18-652A>G and I18-726A>G) detected in Chinese Holstein dairy cattle are significantly associated with traits such as milk fat percentage and milk protein percentage. Further functional validation has shown that these genes directly influence mammary triglyceride content by regulating the expression of the AGPAT4 gene, a gene involved in the fat metabolism signaling pathway (Zhao Yaolu, Correlation Analysis and Functional Verification of Genetic Polymorphisms of the gpam Gene and Milk Fat Traits in Dairy Cows, Master's Thesis, Jilin University, June 2017). Analysis of Chinese Holstein dairy cattle has shown that these SNPs are not only associated with mastitis resistance but also influence milk production traits such as milk fat percentage and milk protein percentage through a synergistic effect of multiple genes (Lü Xiaoqing et al., Association Analysis of Three SNPs with Mastitis and Milk Production Traits in Chinese Holstein Cattle, Chinese Journal of Dairy, February 2024, pp. 11-15).

[0004] Previous studies have shown that SNP markers have important application potential in the genetic improvement of milk fat traits in dairy cows, but research results are limited and there are not many SNP sites to choose from. Further exploration and screening of more milk fat rate-related SNPs are still needed to achieve precise improvement of milk fat traits. Summary of the Invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to milk fat content in dairy cows, a detection product and an application thereof, so as to lay a solid foundation for breeding high-yielding dairy cows.

[0006] The technical solution of the present invention is described in detail as follows:

[0007] In the first aspect, the present invention provides a SNP molecular marker related to milk fat rate in dairy cows. The SNP molecular marker is located at chr5:92772499 in the dairy cow genome, the polymorphism is T or C, and the coordinate position of the SNP molecular marker is based on the cattle reference genome ARS-UCD2.0.

[0008] Optionally, the above-mentioned SNP molecular marker is the 47th nucleotide of SEQ ID NO: 1 in the sequence listing, and the polymorphism is T or C.

[0009] In a second aspect, the present invention provides the use of the above-mentioned SNP molecular marker in identifying dairy cows with high milk fat content. When the polymorphism of the SNP molecular marker is T, the milk produced by the dairy cow has the trait of high milk fat content.

[0010] Optionally or preferably, in the above application, the method for identifying a high milk fat percentage dairy cow comprises the following steps:

[0011] (1) Extracting genomic DNA from the cow to be identified;

[0012] (2) Using the genomic DNA obtained in step (1) as a template and the nucleotide sequences shown in SEQ ID NOs: 2-3 as primers, PCR amplification was performed to obtain an amplification product containing a SNP molecular marker. The amplification product was 113 bp, and the 47th position was a SNP molecular marker;

[0013] (3) The amplified products were sequenced, and the SNP molecular marker genotype combinations from high to low milk fat content were TT, TC, and CC.

[0014] In a third aspect, the present invention provides an application of the above-mentioned molecular marker in assisted breeding of dairy cows. When the polymorphism of the SNP molecular marker is T, the milk produced by the dairy cow has a high milk fat rate trait.

[0015] In a fourth aspect, the present invention provides a product for detecting the above-mentioned SNP molecular marker, wherein the product is a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2~3.

[0016] In a fifth aspect, the present invention provides a product for detecting the above-mentioned SNP molecular markers, which is a detection kit. The detection kit includes a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2~3.

[0017] In a sixth aspect, the present invention provides the use of the above-mentioned detection product in identifying dairy cows with high milk fat content. When the SNP molecular marker polymorphism is T, the milk produced by the dairy cow has the trait of high milk fat content.

[0018] In a seventh aspect, the present invention provides an application of the above-mentioned detection product in assisted breeding of dairy cows. When the SNP molecular marker polymorphism is T, the milk produced by the dairy cow has a high milk fat rate trait.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention provides a SNP molecular marker associated with milk fat content in dairy cows. The marker is located at chr5:92772499 in the dairy cow genome and has a polymorphism of T or C. Analysis and verification confirm that the dominant allele is T. This SNP molecular marker allows livestock managers to select and retain dominant genotypes using molecular biology techniques, thereby increasing the frequency of high-yield SNPs containing this molecular marker within a dairy cow population, thereby improving the milk fat content of the population and increasing economic benefits. The marker can also be used for genetic breeding and improvement of high-yield dairy cows. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the sequencing peak diagram of the chr5:92772499 (T>C) site polymorphism. DETAILED DESCRIPTION

[0022] In order to enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the embodiments described are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.

[0023] Example 1

[0024] 1. DNA sample collection and genetic data analysis

[0025] (1) Blood or hair follicle samples were collected from 1,915 Holstein cows in six large-scale farms.

[0026] Holstein cattle samples were collected from six ranches across the country. The location of the ranches and the number of samples collected from each ranch are shown in Table 1 .

[0027] Table 1 Location of the ranches where samples were collected and the number of samples collected

[0028]

[0029] (2) The genotypes of the collected samples were determined using the Illumina BovineSNP50 chip. Genotyping was performed by Newgene Biotech (Shanghai) Co., Ltd., and a total of 47,843 SNP marker loci were genotyped.

[0030] (3) The genomic estimated breeding value of milk fat percentage for each individual is estimated based on the genotype. The genomic estimated breeding value is provided by the United States Dairy Cattle Genetics and Breeding Committee (CDCB).

[0031] Genomic Estimated Breeding Value (GEBV) is a genetic potential prediction indicator calculated by the United States Dairy Cattle Genetics and Breeding Committee (CDCB) by integrating genomic data, production performance records and multidimensional genetic evaluation models.

[0032] (4) A genome-wide association analysis of milk fat percentage genomic breeding values ​​was performed using GEMMA software based on genotype data. A mixed linear model was used as the analysis model, with pasture and cow age as covariates. The FDR method was used to correct for multiple testing. The association analysis results showed that the most significant SNP locus (chr5:92772499T>C) was significant, with a P value of 0.0015 after FDR correction.

[0033] 2. Identification of dominant alleles

[0034] Among the 1915 Holstein cattle collected, the present invention compared the genomic estimated breeding values ​​of milk fat percentage of different genotypes at the SNP site chr5:92772499 (T>C). The results are shown in Table 2.

[0035] Table 2 Genomic estimated breeding values ​​of milk fat percentage in dairy cows with different genotypes of chr5:92772499 (T>C)

[0036]

[0037] For chr5:92772499 (T>C), the estimated genomic breeding values ​​for milk fat percentage are C / C: 0.024, C / T: 0.049, and T / T: 0.06. Because a larger genomic breeding value for milk fat percentage indicates a higher milk fat percentage, the dominant allele at chr5:92772499 (T>C) is T.

[0038] 3. Sequence amplification

[0039] (1) Blood collection from the cattle tail vein

[0040] Holstein cattle were selected as experimental materials, and blood was collected from the tail vein of the cattle.

[0041] (2) Genomic DNA extraction

[0042] Take 500 μL of whole blood and add 500 μL of STE lysis buffer, followed by 50 μL of 10% SDS and 5 μL of proteinase K (20 mg / ml). Lyse at 56°C for approximately 3 hours until the lysate is clear. Add the same volume of saturated phenol (250 μL) and chloroform / isoamyl alcohol (24:1) (250 μL). Gently shake for 20 minutes and centrifuge at 12,000 rpm for 10 minutes. Remove the supernatant and repeat the above steps until no protein layer remains between the aqueous and organic phases. Remove the supernatant and add the same volume of chloroform / isoamyl alcohol. Gently shake for 20 minutes and centrifuge at 12,000 rpm for 10 minutes. Remove the supernatant and add 1 / 10 volume of 3M NaAc (pH 5.2) and 2 volumes of cold anhydrous ethanol. Shake well, let stand at -20°C for 20 minutes, and centrifuge at 12,500 rpm for 20 minutes. Precipitate the nucleic acids at the bottom of the tube. Discard the supernatant and wash the pellet with 70% ethanol. Collect the pellet and air-dry until all the ethanol has evaporated. Dissolve the DNA in 20 μL of TE (containing RNase A). Incubate at 37°C for approximately 30 minutes and then store at 4°C. Analyze the DNA sample by 1% agarose gel electrophoresis and determine its concentration and purity using a UV spectrophotometer.

[0043] (3) Primer design

[0044] According to the target gene sequence where the SNP site is located, a pair of specific primers are designed.

[0045] Forward primer F is: 5'-TGGTTTGTCTTTTGACCCAGTT-3' (SEQ ID NO: 2),

[0046] The reverse primer R is: 5'-CCAAAGTGACAGCACAGAGGG-3' (SEQ ID NO: 3).

[0047] (4) Polymerase chain reaction

[0048] PCR amplification was performed using the above primers. The reaction system was as follows: 10× Buffer 1 μL, 2.5 mM dNTP 0.8 μL, 2.5 mM MgCl2 0.6 μL, forward primer F (10 μM) 0.1 μL, reverse primer R (10 μM) 0.5 μL, Taq enzyme (5 U / μL) 0.1 μL, template 0.5 μL, LC Green saturated fluorescent dye 0.7 μL, and H2O was added to make up to 10 μL.

[0049] Amplification reactions were performed on an Applied Biosystems PCR system using the following reaction conditions: 95°C for 5 min, 35 cycles of 95°C for 30 s, 59°C for 30 s, and 72°C for 1 min, and 72°C for 5 min. The genotypes of the PCR products were determined by Sanger sequencing.

[0050] The amplified product is 113 bp, and the specific nucleotide sequence is as follows:

[0051] 5'-TGGTTTGTCTTTTGACCCAGTTTAAAGCTAATGGATTTGTGTTCGC T ACTTTTATATCCTCAGATATCTTCCCTGAATCATGTGATTTTTTCCCCTCTGTGCTGTCACTTTGG-3' (SEQ ID NO: 1), where position 47 (underlined) is a SNP site with a polymorphism of T or C. The sequencing peak diagram of the polymorphism at chr5:92772499 (T>C) is shown in Figure 1 .

[0052] By selecting individuals from the core group of dairy cows and using the above-mentioned molecular biology-related technologies to detect the genotype of the chr5:92772499 (T>C) site, and selecting favorable individuals for breeding, the milk fat percentage trait of the dairy cow group can be improved, breeding efficiency can be improved, breeding costs can be reduced, breeding income can be increased, and the foundation for breeding new breeds of excellent dairy cows with high milk fat percentage can be laid.

[0053] Example 2

[0054] To verify the relationship between the chr5:92772499 (T>C) locus and the milk fat percentage of Holstein cows, the genotype of the chr5:92772499 (T>C) locus was identified in 195 Holstein cows from a Holstein herd using the Sanger sequencing method. The milk fat percentages of individuals with different genotypes were compared, and the results are shown in Table 3.

[0055] Table 3 Average milk fat percentage of individuals with different genotypes at the chr5:92772499 (T>C) locus in the validation population

[0056]

[0057] The test results showed that three genotypes were present in the Holstein cow population tested. Among all the groups tested, the average daily milk fat percentage of cows with the T / T genotype was 4.22%, the average daily milk fat percentage of cows with the T / C genotype was 4.04%, and the average daily milk fat percentage of cows with the C / C genotype was 3.79%. This result is consistent with the conclusion in Example 1, where individuals with the TT genotype had the highest milk fat percentage, followed by individuals with the TC genotype, and individuals with the CC genotype had the lowest milk fat percentage.

[0058] One-way ANOVA revealed that there were significant differences in the mean milk fat percentage among different genotypes, with a significant P value of 6.41-E42 (Table 4).

[0059] Table 4. One-way ANOVA results of milk fat percentage of individuals with different genotypes at chr5:92772499 (T>C) in the validation population

[0060]

[0061] A one-way ANOVA was performed on the average milk fat percentage of individuals with three genotypes at the chr5:92772499 (T>C) locus in the validation population in Table 3. It was found that there were statistically significant differences in the means among different groups, indicating that the polymorphism of the chr5:92772499 (T>C) locus was significantly correlated with the average milk fat percentage trait.

[0062] The present invention identifies a SNP site associated with the milk fat rate of dairy cows, and detects the genotype of individual dairy cows at this site through molecular biology related techniques. Through association analysis with the estimated breeding value of the milk fat rate trait of dairy cows, individuals with favorable genotypes are selected for breeding. This can increase the frequency of the dominant milk fat rate allele in the dairy cow population, reduce the feeding cost of the pasture, improve the breeding efficiency, and provide a new method for the genetic improvement of the milk fat rate trait of dairy cows.

[0063] This document uses specific examples to illustrate the inventive concept in detail. The above embodiments are only intended to help understand the core concept of the present invention. It should be noted that any obvious modifications, equivalent substitutions, or other improvements made by a person skilled in the art without departing from the inventive concept should be included within the scope of protection of the present invention.

Claims

1. Application of a SNP molecular marker related to milk fat content in identifying high milk fat content cows, characterized in that: The SNP molecular marker is located at chr5:92772499 in the cow genome, the polymorphism is T or C, and the coordinate position is based on the reference genome ARS-UCD2.0; when the SNP molecular marker polymorphism is T, the milk produced by the cow has a high milk fat rate trait.

2. The use according to claim 1, characterized in that The SNP molecular marker is the 47th nucleotide of SEQ ID NO: 1 in the sequence list, and the polymorphism is T or C.

3. The use according to claim 1, characterized in that The method for identifying high milk fat percentage cows includes the following steps: (1) Extracting genomic DNA from the cow to be identified; (2) Using the genomic DNA obtained in step (1) as a template and the nucleotide sequences shown in SEQ ID NOs: 2-3 as primers, PCR amplification was performed to obtain an amplification product containing a SNP molecular marker. The amplification product was 113 bp, and the 47th position was a SNP molecular marker; (3) The amplified products were sequenced, and the SNP molecular marker genotype combinations from high to low milk fat content were TT, TC, and CC.

4. Application of SNP molecular markers related to milk fat content in dairy cow assisted breeding, characterized in that: The SNP molecular marker is located at chr5:92772499 in the dairy cow genome, the polymorphism is T or C, and the coordinate position is based on the reference genome ARS-UCD2.0; when the SNP molecular marker polymorphism is T, the milk produced by the dairy cow has a high milk fat rate trait.

5. Application of a product for detecting SNP molecular markers related to milk fat content in dairy cows in identifying high milk fat content dairy cows, characterized in that: The SNP molecular marker is located at chr5:92772499 in the cow genome, the polymorphism is T or C, and the coordinate position is based on the reference genome ARS-UCD2.0; the product includes a primer pair, and the primer pair nucleotide sequence is shown in SEQ ID NO:2~3.

6. Use of a product for detecting SNP molecular markers related to milk fat content in dairy cows in identifying high milk fat content dairy cows, characterized in that: The SNP molecular marker is located at chr5:92772499 in the cow genome, the polymorphism is T or C, and the coordinate position is based on the reference genome ARS-UCD2.0; the product is a detection kit, including a primer pair, and the nucleotide sequence of the primer pair is shown in SEQ ID NO:2~3.