SiRNA (small interfering ribonucleic acid) functionalized tetrahedral framework nucleic acid composite material as well as preparation method and application thereof
The tFNA-siRNA complex addresses the delivery challenges of siRNA by enhancing cellular uptake and specificity, effectively silencing IGFBP7 to treat AKI, demonstrating improved renal function and reduced injury markers.
Patent Information
- Application Number
- CN202510481454.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-17
- Publication Date
- 2025-07-15
AI Technical Summary
In the prior art, siRNA is difficult to pass stably to target cells, especially in the treatment of acute renal injury. The targeting and cell membrane penetration of siRNA to the IGFBP7 gene are insufficient, resulting in poor treatment effect.
A siRNA functionalized tetrahedral framework nucleic acid composite material is designed to form an efficient cell membrane permeability and gene targeting composite material through the binding of tetrahedral framework nucleic acid and siRNA-IGFBP7, thereby achieving continuous downregulation of the IGFBP7 gene.
Effectively inhibits IGFBP7 gene expression, reduces serum creatinine and urea nitrogen levels, reduces renal tissue loss, and restores renal function, providing a new treatment path for acute renal injury.
Smart Images
Figure CN120305415A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedical technologies, and particularly to a siRNA-functionalized tetrahedral framework nucleic acid composite material, a preparation method thereof, and an application thereof. Background Art
[0002] Acute kidney injury (AKI) is a syndrome induced by multiple etiologies, with both high incidence and mortality rates, which is particularly prominent in patients in the intensive care unit (ICU). The pathophysiological process of AKI is intricate, covering multiple aspects such as mitochondrial dysfunction, oxidative stress response, and apoptosis. Currently, the treatment measures for AKI are relatively limited, mainly relying on supportive therapies, and specific drugs are scarce. In view of this, exploring new treatment means is of crucial significance for optimizing the recovery prospects of AKI patients.
[0003] Insulin-like growth factor-binding protein 7 (IGFBP7) is a protein with multiple functions and plays a key role in the process of AKI. Research shows that IGFBP7 can serve as a biomarker for early diagnosis of AKI, and in AKI mouse models induced by cisplatin, ischemia-reperfusion injury (IRI), and lipopolysaccharide (LPS), the deficiency of IGFBP7 can improve renal dysfunction, histological damage, programmed apoptosis, and inflammatory response. Further research indicates that IGFBP7 may participate in the onset and progression of AKI by regulating mitochondrial function.
[0004] Small interfering RNA (siRNA), also known as short interfering RNA or silencing RNA, blocks the translation of a specific gene's mRNA by interfering with the post-transcriptional degradation process of the mRNA that matches the complementary nucleotide sequence. As a core element in the RNA interference (RNAi) mechanism of gene silencing, siRNA itself has some limitations. For example, its small size makes it easy to be cleared by the kidneys, its strong hydrophilicity makes it difficult to cross the cell membrane alone to reach the target location, and it is vulnerable to attack by nucleases in the body and degraded. To achieve an ideal gene regulation effect, it is necessary to carefully select an appropriate gene vector to protect and assist the therapeutic siRNA to achieve efficient transfection.
[0005] Tetrahedral framework nucleic acid (tFNA) is a three-dimensional nanostructure formed by four single-stranded DNAs through specific base pairing, with high stability and biocompatibility. Due to its unique spatial conformation and surface negative charge, tFNAs can freely penetrate the cell membrane to achieve efficient intracellular delivery. In addition, tFNAs also have the advantages of being easily functionalized and prepared, and can carry a variety of bioactive molecules, such as small molecule drugs, siRNAs, etc., to achieve precise targeted therapy.
[0006] In summary, the use of siRNA related to the silenced IGFBP7 gene as a drug still has problems such as low stability and difficulty in penetrating cell membranes. Therefore, there is an urgent need in the art to develop a new drug delivery system for this siRNA. At present, there are few literature reports on the application of tFNA in loading drugs into siRNA. Summary of the Invention
[0007] Aiming at the deficiencies of the prior art, the present invention provides a siRNA-functionalized tetrahedral framework nucleic acid composite material, its preparation method and application. A tetrahedral framework nucleic acid composite material combined with siRNA related to the silenced IGFBP7 gene is designed, which combines the strong cell membrane permeability of tFNA and the gene targeting specificity of siRNA-IGFBP7. This composite material effectively and continuously down-regulates the expression of IGFBP7, thereby achieving the purpose of treating acute kidney injury.
[0008] To achieve the above object, the present invention is realized through the following technical solutions:
[0009] A siRNA-functionalized tetrahedral framework nucleic acid composite material, wherein the tetrahedral framework nucleic acid is synthesized from 4 ssDNA sequences with DNA sticky ends, and then the synthesized tetrahedral framework nucleic acid is combined and assembled with the sticky ends of siRNA-IGFBP7 to obtain the composite material, and the forward and reverse strand sequences of the siRNA-IGFBP7 are as shown in SEQ ID NO.5 and SEQ ID NO.6.
[0010] Preferably, the 4 ssDNAs with DNA sticky ends are sS1, sS2, sS3 and sS4 respectively, and the sequence of sS1 is as shown in SEQ ID NO.1; the sequence of sS2 is as shown in SEQ ID NO.2; the sequence of sS3 is as shown in SEQ ID NO.3; the sequence of sS4 is as shown in SEQ ID NO.4.
[0011] Preferably, the molar ratio of the tetrahedral framework nucleic acid to siRNA is 1:4.
[0012] The preparation method of the above siRNA-functionalized tetrahedral framework nucleic acid composite material includes the following steps:
[0013] (1) Add 4 ssDNA sequences with DNA sticky ends to TM buffer, and after vortex centrifugation, perform self-assembly to obtain tetrahedral framework nucleic acid;
[0014] (2) Mix the above tetrahedral framework nucleic acid and siRNA-IGFBP7 according to a molar ratio of 1:4 and incubate to obtain a tetrahedral framework nucleic acid carrying siRNA-IGFBP7.
[0015] Preferably, in the step (1), the conditions in the self-assembly process are as follows: first heat to 95 °C and maintain for 5 min, then cool to 4 °C and hold for 30 min.
[0016] Preferably, in the step (2), the incubation conditions are incubation at 37 °C for 2 h.
[0017] The above composite material can be used to prepare a drug for treating acute kidney injury.
[0018] Preferably, the drug is used to reduce the levels of creatinine and urea nitrogen in the serum.
[0019] Preferably, the drug is used to reduce the expression of the kidney injury marker KIM1.
[0020] Preferably, the drug is used to reduce kidney tissue loss and / or restore kidney function.
[0021] The present invention provides a siRNA-functionalized tetrahedral framework nucleic acid composite material, its preparation method and application. Compared with the prior art, the advantages are as follows:
[0022] The present invention combines the efficient cell membrane penetration ability of tetrahedral framework nucleic acid and the precise targeting of siRNA against the IGFBP7 gene, and constructs a tetrahedral framework nucleic acid-siRNA composite system for silencing the IGFBP7 gene; this system can effectively inhibit the expression of the IGFBP7 gene and provides a new way for the treatment of acute kidney injury. In view of the limitations of current drugs for treating kidney injury, the application prospect disclosed by the present invention shows extremely high practical value. Description of the Drawings
[0023] Figure 1 This is for verifying the knockdown effect of the designed IGFBP7-siRNA in mouse renal tubular epithelial cells mTEC by Western blot and Real-time PCR in Example 2 of this application;
[0024] Figure 2 This is for verifying the successful synthesis of tFNA and tFNA-siRNA by polyacrylamide gel electrophoresis in Example 3 of this application. Lane 1 is tFNA-siRNA, lane 2 is tFNA, lane 3 is siRNA, lane 4 is sS1, lane 5 is sS2, lane 6 is sS3, lane 7 is sS4, lane 8 is sS1 + sS2, and lane 9 is sS1 + sS2 + sS3;
[0025] Figure 3 This is for further verifying the successful synthesis of tFNA-siRNA by polyacrylamide gel electrophoresis in Example 3 of this application. Lane 1 is tFNA-siRNA and lane 2 is siRNA;
[0026] Figure 4 These are the atomic force microscopy (AFM) image and transmission electron microscopy (TEM) image of the tFNA-siRNA complex in Example 3 of this application.
[0027] Figure 5 These are the particle size dimensions of tFNA and the tFNA-siRNA complex in Example 3 of this application.
[0028] Figure 6 These are the targeting and kidney tissue distribution of Cy5-fluorescently labeled tFNA in normal mice in Example 4 of this application.
[0029] Figure 7 These are the fluorescence images of normal mouse kidney sections taken at specific time points using a laser confocal microscope in Example 4 of this application.
[0030] Figure 8 These are the measurements of creatinine and blood urea nitrogen levels in the sera of mice in each group using creatinine and blood urea nitrogen assay kits in Example 5 of this application.
[0031] Figure 9 These are the Western blot change diagrams of renal tissues of mice in each group measured by the Western blot method in Example 5 of this application.
[0032] Figure 10 These are the immunofluorescences of KIM1 levels in kidney sections of mice in each group in Example 5 of this application.
[0033] Figure 11 These are the results and evaluation diagrams of staining mouse kidney tissues with an H&E staining kit in Example 5 of this application.
[0034] Figure 12 These are the measurements of creatinine and blood urea nitrogen levels in the sera of mice in each group using creatinine and blood urea nitrogen assay kits in Example 6 of this application.
[0035] Figure 13 These are the Western blot change diagrams of renal tissues of mice in each group measured by the Western blot method in Example 6 of this application.
[0036] Figure 14 These are the immunofluorescences of KIM1 levels in kidney sections of mice in each group in Example 6 of this application.
[0037] Figure 15 These are the results and evaluation diagrams of staining mouse kidney tissues with an H&E staining kit in Example 6 of this application. Detailed implementation manners
[0038] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the following clearly and completely describes the technical solutions in the embodiments of the present invention in conjunction with the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0039] Example 1:
[0040] Preparation of tetrahedral framework nucleic acid carrying siRNA-IGFBP7:
[0041] 1. Pre-designed 4 ssDNAs (sS1, sS2, sS3, sS4) with DNA sticky ends:
[0042] Single-stranded DNA nucleotide sequence of sS1 (SEQ ID NO.1):
[0043] TTGACCTGTGAATTACTAACCTTTGTGTCTAACTAAACAGCATGCTAGACGAAGTCAGCCGCCAATGTA;
[0044] Single-stranded DNA nucleotide sequence of sS2 (SEQ ID NO.2):
[0045] TTGACCTGTGAATTTATCACCAGGCAGTTGACAGTCTAGCATGCTGTTTAAGATGCGAGGGTCCAATAC;
[0046] Single-stranded DNA nucleotide sequence of sS3 (SEQ ID NO.3):
[0047] TTGACCTGTGAATTTCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACATTGGCGGCTGACT;
[0048] Single-stranded DNA nucleotide sequence of sS4 (SEQ ID NO.4):
[0049] TTGACCTGTGAATTTAGACACAAAGGTTAGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT;
[0050] Prepare the sense and antisense strand sequences of siRNA-IGFBP7:
[0051] sense(5'-3')AGGUGUUCUUGAGCUGUGAGGUCAU(SEQ ID NO.5);
[0052] antisense(5'-3')UUCACAGGUCAAAUGACCUCACAGCUCAAG AACACCU(SEQ ID NO.6);
[0053] 2. Preparation:
[0054] Add sS1, sS2, ssS3, and sS4 into TM buffer (10 mM Tris-HCl, 50 mM MgCl2, pH = 8.0). After vortexing and centrifuging, heat it to 95°C in a metal water bath for 5 minutes, then cool it to 4°C and keep it for 30 minutes, and self-assemble into tFNA according to the base complementary pairing principle.
[0055] Mix tFNA with siRNA-IGFBP7 at a molar ratio of 1:4 and incubate at 37°C for 2 hours to obtain tetrahedral framework nucleic acid carrying siRNA-IGFBP7 (tFNA-siRNA complex).
[0056] Example 2:
[0057] Verify the knockdown effect of siRNA-IGFBP7 in mouse renal tubular epithelial cells mTEC:
[0058] 1. Design siRNA-IGFBP7
[0059] First, obtain the Accession Number of the gene on the NCBI website, then use BLOCK-iT TM RNAi Designer for design, and finally verify the obtained sequence on the cells.
[0060] 1. Transfection of small interfering RNA (siRNA)
[0061] Seed mTEC cells in a 6-well plate and culture until they reach about 60% confluence at the bottom of the 6-well plate. Transfect the cells using jetPRIME according to the manufacturer's instructions. Replace the medium 6 h after transfection and transfect for a total of 24 h. Collect the cells for subsequent experimental operations.
[0062] 3. Western blot analysis
[0063] First, a cell lysate was prepared by mixing RIPA buffer purchased from Beyotime with protease inhibitor PMSF at a ratio of 1:100. The prepared lysate was added to a pre-weighed cell plate that had been treated with drugs to lyse the cells. The supernatant was collected by centrifugation at 12,000 rpm for 20 - 30 min at 4°C. Then, it was thoroughly mixed with protein loading buffer at a ratio of 4:1, heated and denatured in a metal water bath at a temperature above 95°C, cooled on ice for 3 - 4 min, and stored at -20°C for later use. Subsequently, the protein samples were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a polyvinylidene difluoride (PVDF) membrane under constant voltage. The PVDF membrane with protein bands was incubated with 5% skim milk prepared with TBST solution (0.1% Tween 20) at room temperature for 1 - 2 h to block non-specific binding. After blocking, the protein bands were washed three times with TBST, 10 min each time. Then, they were incubated with the primary antibody overnight at 4°C. The next day, the primary antibody was recovered, and the protein bands were washed three times with TBST, 10 min each time. Subsequently, they were incubated with the corresponding secondary antibody at 37°C for 1 - 2 h. After incubation, the protein bands were washed three times with TBST. The developing solution was prepared using an ECL chemiluminescence kit (ECL-plus), and the protein bands were detected using a developer. Subsequently, the gray value of the bands was analyzed using Image J software.
[0064] 4. Extraction and quantification of mRNA
[0065] Total RNA was extracted from mTEC cells using Trizol reagent. The RNA concentration was measured using a DS-11 spectrophotometer. According to the RNA concentration, the total RNA was reverse transcribed into cDNA using the HiScript III First Strand cDNA Synthesis Kit according to the instructions. In the real-time quantitative PCR (RT-qPCR) reaction mixture, 1 μl of each forward and reverse primer for each target gene, 5 μl of 2× SYBR-Green-PCR amplification reagent, and 3 μl of cDNA solution were added. After mixing evenly, the samples were loaded onto the machine for detection. After RT-PCR amplification, the CT values of the target genes and internal reference genes in the control group and the test group were output. Calculations and comparisons were made based on the CT values of each group. The forward and reverse primers used in PCR are shown in Table 1 below.
[0066] Table 1
[0067]
[0068] From Figure 1 It can be seen that siRNA-IGFBP7 significantly knocked down the expression level of IGFBP7 mRNA in mTEC cells and inhibited the secretion of IGFBP7 protein. The final sequence of siRNA-IGFBP7 is:
[0069] sense(5'-3')AGGUGUUCUUGAGCUGUGAGGUCAU;
[0070] antisense(5'-3')AUGACCUCACAGCUCAAGAACACCU。
[0071] Example 3:
[0072] Characterization of the tFNA-siRNA complex:
[0073] The morphology of the tFNA-siRNA nanomaterial was detected by PAGE gel electrophoresis, atomic force microscopy (AFM) and transmission electron microscopy (TEM). The sizes and Zeta potentials of the tFNA and tFNA-siRNA nanostructures were measured in a nanoparticle size potentiometer.
[0074] 1. Polyacrylamide gel electrophoresis (PAGE)
[0075] Since no substances such as urea and SDS are added to this gel electrophoresis, it will not damage the structure of DNA. It is a common electrophoresis technique for separating oligonucleotides or proteins. Add the 12% PAGE gel solution to the sample well, insert the comb and wait for the gel to solidify. Mix tFNA-siRNA and siRNA (siRNA-IGFBP7) with the loading buffer respectively and add them to the sample well. Complete the electrophoresis in a 0.5x TBE solution environment, and then develop the nucleic acid gel under a chemiluminescent imager. According to the different migration speeds of DNA with different base numbers and different molecular weights under the action of current in the pore size, different bands with a gradient distribution are formed. The results of PAGE gel electrophoresis are as Figure 2 shown. According to the position difference of DNA in the band, we can see that tFNA and tFNA-siRNA were successfully synthesized. To further verify the successful binding of tFNA and siRNA, only siRNA carried Cy5 fluorescence and a PAGE electrophoresis experiment was carried out. As Figure 3 shown, siRNA was successfully loaded onto tFNA and the binding efficiency was high.
[0076] 2. Transmission electron microscopy (TEM)
[0077] After diluting 1 μM of tFNA-siRNA to 100 nM with TM buffer, take a little sample and slowly drop it on the copper grid. After counterstaining for 3 min, the morphology of tFNA-siRNA was determined by transmission electron microscopy. Figure 4 The left is the transmission electron microscopy result of tFNA-siRNA. It can be seen from the figure that the white tFNA-siRNA is evenly distributed in the dark gray background medium and a triangular-like structure is observed.
[0078] 3. Atomic Force Microscope (AFM)
[0079] After diluting tFNA-siRNA to 100 nM with TM buffer, 20 μL of the sample was pipetted onto a freshly cleaved mica sheet. The droplet was left on the mica surface to adsorb for 15 minutes. The morphology of tFNA-siRNA was measured by AFM using the tapping mode. Figure 4 The right shows the atomic force microscopy result of tFNA-siRNA. It can be seen from the figure that the shape is a triangular-like structure and is evenly distributed in the solution.
[0080] 4. Nanoparticle Size and Zeta Potential Analyzer
[0081] tFNA-siRNA and siRNA were respectively diluted to 100 nM with TM buffer. 1 mL of each sample was added into the zeta potential cell and the particle size cell, and the two were placed into the particle size and zeta potential analyzer for detection and data analysis. The Zeta potential and particle size of tFNA and tFNA-siRNA Figure 5 ). Both tFNA and tFNA-siRNA are negatively charged, with Zeta potentials of -2.43 mV and -5.35 mV respectively, and sizes of 4.175 nm and 9.939 nm respectively. Both show small sizes and negative charges, ensuring efficient cellular uptake ability.
[0082] Example 4:
[0083] Verify the targeting and kidney tissue distribution of tFNA in normal mice
[0084] The back skin of the mouse was depilated to expose the kidney. Cy5-labeled tFNA (50 μL) was injected into the tail vein of the mouse, and fluorescence images were collected using a small animal in vivo imaging system at specific times to obtain real-time fluorescence images of the mouse. The shooting results are as Figure 6 shown. tFNA accumulates the most in the kidney at the 5-minute time point and is basically metabolized within about 2 hours. To study cell distribution, the mice were sacrificed at 5, 30, 60, and 120 minutes after injection. The liver was collected and frozen, 4-μm sections were cut, stained with DAPI, and mounted. Laser confocal microscopy was used to visualize the fluorescence images. From Figure 7 it can be seen that tFNA accumulates the most in the kidney at the 5-minute time point, is basically metabolized within about 2 hours, and tFNA is mainly distributed in the renal tubules.
[0085] Example 5:
[0086] Verify the knockdown and therapeutic effects of tFNA-siRNA in mice with acute kidney injury induced by CLP model
[0087] The animal experiments were approved by the Experimental Animal Ethics Committee of Anhui Medical University. Normal male C57BL / 6 mice, 8 - 10 weeks old, with appropriate body weight and good health, without congenital blindness, dental deformities and other adverse symptoms, were selected. All mice were adaptively fed for 1 week before the experiment, with the temperature maintained at 23 ± 2°C, humidity at 50% ± 10%, 12 hours of light and 12 hours of darkness during the day and night, and the light and darkness adjusted naturally.
[0088] 1. Establish a CLP model
[0089] An acute kidney injury model induced by sepsis (CLP) in mice was established. Mice were anesthetized by intramuscular injection of Zoletil (50 mg / kg), the abdominal hair was removed, and a midline incision (2 cm) was made below the diaphragm to expose the cecum. The cecum - colon junction (1.5 cm from the bottom of the cecum) was ligated with 4 - 0 nylon surgical suture. A 20 mL sterile syringe was used to puncture from the mesenteric edge to the opposite mesenteric edge, and then the cecum was gently squeezed near the puncture point to extrude a small amount of intestinal contents (the amount of cecal contents extruded each time should be kept consistent to ensure model consistency). The cecum with the extruded contents was returned to the abdominal cavity, the abdominal cavity was closed, and the peritoneum and skin were sutured layer by layer. The skin was disinfected again with iodine. After the operation, the mice received subcutaneous injection of normal saline at 37°C at a dose of 1 mL / 20 g body weight for fluid resuscitation. The next experiment was carried out 24 h after the operation.
[0090] The mice were randomly divided into five groups (6 mice in each group): control group (normal mice), CLP group, CLP - tFNA group, CLP - siRNA group, and CLP - tFNA - siRNA group. The administration groups were given drugs through the tail vein (3 μM, 100 μL / 10 g) at 4 h and 14 h after perforation respectively. The mice were sacrificed 24 h after the operation, and serum and kidney tissue samples were collected for subsequent experiments.
[0091] 2. Creatinine (Cre) determination
[0092] The specific operation process is shown in Table 2 below:
[0093] Table 2
[0094]
[0095] Creatinine content (μmol / L) = [(Measured A2 - K * Measured A1) - (Blank A2 - K * Blank A1)] / [(Standard A2 - K * Standard A1) - (Blank A2 - K * Blank A1)] * Standard concentration (442 μmol / L);
[0096] Note: Dilution factor K = (Sample volume + Volume of Enzyme Solution A) / (Sample volume + Volume of Enzyme Solution A + Volume of Enzyme Solution B) = 186 / 246;
[0097] 3. Determination of Blood Urea Nitrogen (BUN)
[0098] The specific operation process is as shown in Table 3 below:
[0099] Table 3
[0100] Blank tube Standard tube Measurement tube Double-distilled water (mL) 0.02 0 0 10 mmol / L standard (mL) 0 0.02 0 Sample to be measured 0 0 0.02 Reagent 1 1 1 1 Reagent 2 application solution 1 1 1
[0101] Mix well, place in a water bath at 100 °C for exactly 15 min, and immediately cool with tap water. At a wavelength of 520 nm, with a 1 cm light path, use double-distilled water to zero the instrument, and measure the OD values of each tube.
[0102] Note: 10 mmol / L blood urea nitrogen = 280.1 mg / L.
[0103] The levels of BUN and CRE in serum are considered as markers reflecting kidney function. The measurement results of creatinine and blood urea nitrogen in each group are as Figure 8 shown. It can be seen from the figure that tFNA-siRNA can reduce the levels of creatinine and blood urea nitrogen in CLP-induced AKI mice.
[0104] 4. Take the kidney tissues of the above five groups of mice for Western blotting experiments. The measurement results are as Figure 9 shown. tFNA-siRNA can inhibit the expression of IGFBP7 in CLP-induced AKI mice.
[0105] 5. Immunofluorescence
[0106] Cut the sample tissues evenly and place them in an embedding cassette, then pour in the embedding agent to completely immerse the tissues for cryo-embedding; use a cryostat to cut sections, and the kidney tissue sections are generally cut at 4 μm; after the sections are cut, place them in acetone for fixation for 10 min, rinse twice with PBS, and the last time rinse with PBST; then drain the sections and draw a circle with a hydrophobic pen, add the blocking solution (10% BSA solution) to block for 1.5 h, rinse twice with PBS again, and the last time rinse with PBST; first gently drain the sections, then use a dropper to add the appropriate proportion of KIM1 primary antibody (prepared with 1% BSA solution), take out the wet box and add a small amount of water to maintain a humid incubation environment, then place the sections in the wet box (keep the wet box stable), and then place the wet box in a 4 °C refrigerator for overnight incubation; the next day, take out the sections and rinse twice with PBS and once with PBST, each time for 3 minutes; after draining the sections, gently absorb the periphery of the circle with absorbent paper, add the corresponding fluorescent secondary antibody dropwise in the circle, and incubate at 37 °C in the dark for 2 h; after washing, add DAPI staining solution and incubate in the dark for 5 min; after washing, add an anti-fluorescence quenching agent and cover the slides; use an inverted fluorescence microscope for microscopic examination. The immunofluorescence results are as Figure 10 shown. tFNA-siRNA can reduce the expression level of the kidney injury factor KIM1 in CLP-induced AKI mice, thereby alleviating the decline of renal function caused by sepsis-induced AKI.
[0107] 6. Hematoxylin-Eosin Staining (H&E Staining)
[0108] The middle part of the mouse kidney fixed in 4% paraformaldehyde solution was embedded in paraffin blocks, and the paraffin blocks were cut into 5-μm-thick slices with a microtome and placed on glass slides. After drying in an oven at 65 °C for 1-2 h, the slides were dewaxed in xylene twice, 10 min each time. And then dewaxed in gradient ethanol of 100%, 90%, 85%, and 75%, 5 min each time. The cell nuclei were stained with hematoxylin, and after the staining was completed, the slides were rinsed under running tap water, differentiated with a differentiating solution, stained with a blue-resistant solution for 1-2 min, and then the tissue sections were stained with 1% eosin for the cytoplasm, dehydrated with gradient ethanol, and sealed. The slides were observed under an optical microscope and scanned with a slide scanner. The renal injury score indicated the degree of tubular injury: 0 = normal, 1 = 1-10%, 2 = 10-25%, 3 = 26-50%, 4 = 51-75%, 5 = 76-95%, 6 = more than 96%.
[0109] The differences in H&E staining further supported the protective effect of the tFNA-siRNA complex on the kidney, Figure 11 in the CLP group and the CLP-tFNA group and the CLP-siRNA group, the level of renal tubular injury in mice increased significantly, while in the CLP-tFNA-siRNA group, the level of renal tubular injury in mice decreased significantly, indicating that tFNA-siRNA had a significant improvement effect on the renal tissue pathology of septic mice.
[0110] Example 6:
[0111] Verification of the knockdown and therapeutic effects of tFNA-siRNA in mice with acute kidney injury in the IR model
[0112] 1. Construction of the IR model
[0113] An acute kidney injury model of ischemic reperfusion (I / R) in mice was established. After the mice were anesthetized, two kidneys were exposed, and the bilateral renal pedicles were clamped with a microvascular clamp for 40 minutes of ischemia. After ischemia, the clamp was released and reperfusion was performed for 24 h for the next experiment.
[0114] The mice were randomly divided into five groups (6 mice in each group): control group (normal mice), IR group, IR-tFNA group, IR-siRNA group, and IR-tFNA-siRNA group. The administration groups were administered through the tail vein at 4 h and 14 h after reperfusion (3 uM, 100 μl / 10 mg). The mice were sacrificed 24 h after the operation, and serum and kidney tissue samples were collected for subsequent experiments.
[0115] The measurement results of creatinine and blood urea nitrogen in each group were as Figure 12As shown. It can be seen from the figure that tFNA-siRNA can significantly reduce the creatinine and blood urea nitrogen levels in IR-induced AKI mice.
[0116] Continue to perform Western blot experiments on the kidney tissues of the above five groups of mice, and the measurement results are as Figure 13 shown. tFNA-siRNA can inhibit the expression of IGFBP7 in IR-induced AKI mice.
[0117] The immunofluorescence results of KIM1 levels are as Figure 14 shown. tFNA-siRNA can significantly reduce the expression level of the kidney injury factor KIM1 in CLP-induced AKI mice and alleviate the decline of renal function caused by sepsis.
[0118] In hematoxylin-eosin staining Figure 15 it was observed that necrosis, transparency, and exfoliated cells filled the tubules in the first three groups, while the damage in the IR-tFNA-siRNA treatment group was significantly reduced, and the brush border of the proximal tubules was in good shape. It shows that tFNA-siRNA can significantly reduce the dilation and rupture necrosis of the tubules in the kidneys of mice caused by sepsis and can alleviate the decline of renal function caused by sepsis.
[0119] Experimental Example 7
[0120] Statistical analysis
[0121] All in vivo experimental data in this study were presented as the mean ± standard error of six independent biological replicate samples, and in vitro experimental data were presented as the mean ± standard error of three independent biological replicate samples. GraphPad Prism 8.0.2 software was used to analyze the data, and one-way analysis of variance was used to detect the means of multiple groups of samples (ANOVA). Statistical significance was marked as: Statistical significance was marked as: *P<0.05, **P<0.01, ***P<0.001 compared with the normal control group.
[0122] In summary, the present invention prepares a tFNA-siRNA complex, which co-delivers siRNA with tFNA as a carrier. The tFNA-siRNA complex of the present invention has the characteristics of simple synthesis, stable performance, good biocompatibility, etc.; in addition, the tFNA-siRNA complex of the present invention can effectively deliver siRNA and achieve a persistent silencing effect, reduce kidney tissue necrosis, and restore renal function, providing a new option for clinical practice and having great potential to become a new drug for acute kidney injury.
[0123] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A siRNA-functionalized tetrahedral framework nucleic acid composite material, characterized in that: The tetrahedral framework nucleic acid is synthesized from 4 ssDNA sequences with DNA sticky ends, and then the synthesized tetrahedral framework nucleic acid is combined and assembled with the sticky ends of siRNA-IGFBP7 to obtain a composite material, and the forward and reverse strand sequences of the siRNA-IGFBP7 are as shown in SEQ ID NO.5 and SEQ ID NO.
6.
2. The composite material according to claim 1, wherein: The 4 ssDNAs with DNA sticky ends are sS1, sS2, sS3 and sS4 respectively, and the sequence of sS1 is as shown in SEQ ID NO.1; the sequence of sS2 is as shown in SEQ ID NO.2; the sequence of sS3 is as shown in SEQ ID NO.3; the sequence of sS4 is as shown in SEQ ID NO.
4.
3. The composite material according to claim 1, wherein: The molar ratio of the tetrahedral framework nucleic acid to siRNA is 1:
4.
4. A method for preparing a composite material according to any one of claims 1-3, characterized in that, The preparation method includes the following steps: (1) Add 4 ssDNA sequences with DNA sticky ends to TM buffer, and perform self-assembly after vortex centrifugation to obtain tetrahedral framework nucleic acid; (2) Mix the above tetrahedral framework nucleic acid with siRNA-IGFBP7 at a molar ratio of 1:4 and incubate to obtain a tetrahedral framework nucleic acid carrying siRNA-IGFBP7.
5. The preparation method according to claim 4, characterized in that: In the self-assembly process in step (1), the conditions are to heat to 95 °C and maintain for 5 min, and then cool to 4 °C and keep for 30 min.
6. The preparation method according to claim 4, characterized in that: The incubation conditions in step (2) are incubation at 37 °C for 2 h.
7. Use of a composite material as described in any one of claims 1-3 in the preparation of a drug for treating acute kidney injury.
8. The application according to claim 7, characterized in that: The drug is used to reduce the levels of creatinine and blood urea nitrogen in serum.
9. The application according to claim 7, wherein: The drug is used to reduce the expression of the kidney injury marker KIM1.
10. The application according to claim 7, wherein: The drug is used to reduce kidney tissue loss and / or restore renal function.