Primer combination for identifying active ingredients of golden camellia and application of primer combination

Abstract

The invention discloses a primer combination for identifying active ingredients of golden camellia. The primer combination comprises forward primers F01 to F48 as shown in sequences 1 to 48 in a sequence table and reverse primers R01 to R48 as shown in sequences 49 to 96 in the sequence table. According to the method, the total DNA of the golden camellia leaves is extracted and mixed with the primer combination to prepare a PCR amplification system, PCR amplification is conducted, then electrophoresis detection is conducted on amplification products, obtained strips are analyzed, identification of the active ingredients of the golden camellia can be achieved, and a scientific basis is provided for screening and cultivation of good golden camellia varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a primer combination for identifying active ingredients of Camellia nitidissima and its application. Background Art

[0002] Camellia nitidissima is an evergreen shrub of the genus Camellia in the family Theaceae. Camellia nitidissima has golden-yellow petals, and is a rare ornamental plant and germplasm resource in the world. Moreover, Camellia nitidissima contains more than a dozen trace elements such as natural organic germanium, selenium, manganese, molybdenum, vanadium, zinc, etc. that have important health care values for the human body, as well as tea polyphenols and essential amino acids for the human body, and has health care functions such as cancer prevention, inhibiting tumor growth, reducing blood lipids, preventing atherosclerosis, and improving the body's immune function. In recent years, the planting scale of Camellia nitidissima has been continuously expanding. However, in the process of cultivation and promotion of Camellia nitidissima, the variety resources are uneven, resulting in differences in the content of beneficial components in the harvested Camellia nitidissima, which in turn affects the quality of Camellia nitidissima processed products. Therefore, how to screen excellent varieties with high active ingredients is one of the research focuses in the current cultivation of Camellia nitidissima.

[0003] SSR molecular marker (Simple Sequence Repeat) is a molecular marker technology based on short tandem repeat units in DNA sequences, and is widely used in fields such as genetic diversity analysis, germplasm resource identification, molecular breeding, and gene mapping. It has the advantages of high polymorphism, large amount of information, low experimental cost, mature technology, and being suitable for comparison between related species. However, at present, there are few reports on the technical solutions of using SSR molecular marker technology to identify Camellia nitidissima varieties or identify the active ingredients of Camellia nitidissima, and no suitable primer combination for detection has been seen. Summary of the Invention

[0004] In view of the above deficiencies, the present invention discloses a primer combination for identifying active ingredients of Camellia nitidissima and its application, and realizes the identification of active ingredients of Camellia nitidissima based on SSR molecular marker technology, providing a scientific basis for the screening and cultivation of excellent Camellia nitidissima varieties.

[0005] The present invention is implemented by the following technical solutions: A primer combination for identifying active ingredients of Camellia nitidissima, which includes forward primers F01 to F48 shown in sequences 1 to 48 in the sequence listing and reverse primers R01 to R48 shown in sequences 49 to 96 in the sequence listing.

[0006] Among them, the forward primers F01 - F03 and the reverse primers R01 - R03 are used to identify the flavonoid active ingredients in Camellia nitidissima; the forward primers F04 - F25 and the reverse primers R04 - R25 are used to identify the polyphenolic active ingredients in Camellia nitidissima; the forward primers F026 - F46 and the reverse primers R26 - R46 are used to identify the polysaccharide active ingredients in Camellia nitidissima; the forward primers F47 - F48 and the reverse primers R47 - R48 are used to identify the saponin active ingredients in Camellia nitidissima.

[0007] For the application of the primer combination for identifying the active ingredients of Camellia nitidissima, take the leaves of Camellia nitidissima as samples to extract total DNA. Then, use the total DNA as a template and mix it with the primer combination for detection to prepare a PCR amplification system. Then, perform PCR amplification, electrophoretically detect the products of PCR amplification, and analyze the obtained bands to determine the corresponding active ingredients in the samples.

[0008] Furthermore, the procedure of the PCR amplification is as follows: S1, 3 min at 94 °C; S2, 30 s at 94 °C, 30 s at 56 °C, 30 s at 72 °C, for a total of 35 cycles; S3, 5 min at 72 °C.

[0009] The present technical solution has the following beneficial effects compared with the prior art: After extracting total RNA from the leaves of multiple varieties of Camellia nitidissima as samples in the present invention, reverse transcription is carried out for RNA-seq sequencing. Through techniques such as Trinity assembly, functional annotation of databases such as KEGG and COG for analysis, SSR molecular markers related to the active ingredients of Camellia nitidissima are screened. Then, primer combinations for identifying the SSR molecular markers are designed and screened based on these SSR molecular markers. By extracting the total DNA of the leaves of Camellia nitidissima, and then performing a PCR amplification reaction using the primer combination, electrophoretically detecting the products of PCR amplification and analyzing the obtained bands, it can be determined whether the corresponding active ingredients are contained in the samples, thus realizing the rapid and accurate identification of the active ingredients of Camellia nitidissima and providing a scientific basis for the screening and cultivation of excellent Camellia nitidissima varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 It is the electrophoretic detection result diagram of identifying the molecular marker Fla1 in different varieties of Camellia nitidissima in the embodiment, where 1 - 6 correspond to Camellia pubipetala, Camellia pingguoensis var. terminalis, Camellia crassifolia, Camellia vietnamensis, Camellia assimilis, and Camellia microcarpa in sequence.

[0011] Figure 2 It is the electrophoretic detection result diagram of identifying the molecular marker PP12 in different varieties of Camellia nitidissima in the embodiment, where 1 - 6 correspond to Camellia pubipetala, Camellia pingguoensis var. terminalis, Camellia crassifolia, Camellia vietnamensis, Camellia assimilis, and Camellia microcarpa in sequence.

[0012] Figure 3 It is the electrophoretic detection result graph for identifying the molecular marker PP34 in different varieties of Camellia nitidissima in the examples. Among them, 1-6 correspond to C. pubipetala, C. pingguoensis, C. crassifolia, C. chuangtsoensis, C. xiashiensis, and C. microcarpa in sequence.

[0013] Figure 4 It is the electrophoretic detection result graph for identifying the molecular marker PS1 in different varieties of Camellia nitidissima in the examples. Among them, 1-6 correspond to C. pubipetala, C. pingguoensis, C. crassifolia, C. chuangtsoensis, C. xiashiensis, and C. microcarpa in sequence.

[0014] Figure 5 It is the electrophoretic detection result graph for identifying the molecular marker PS19 in different varieties of Camellia nitidissima in the examples. Among them, 1-6 correspond to C. pubipetala, C. pingguoensis, C. crassifolia, C. chuangtsoensis, C. xiashiensis, and C. microcarpa in sequence.

[0015] Figure 6 It is the electrophoretic detection result graph for identifying the molecular marker Sa7 in different varieties of Camellia nitidissima in the examples. Among them, 1-6 correspond to C. pubipetala, C. pingguoensis, C. crassifolia, C. chuangtsoensis, C. xiashiensis, and C. microcarpa in sequence. Detailed implementation manners

[0016] The present invention is further illustrated by the following examples, but it is not limited to the present invention. For the specific experimental conditions and methods not specified in the following examples, the technical means adopted are usually the conventional means well known to those skilled in the art.

[0017] Example: The screening process of the primer combination for identifying the active ingredients of Camellia nitidissima is as follows: (1) Select the leaves of different varieties of Camellia nitidissima as samples (such as C. pubipetala, C. pingguoensis, C. crassifolia, C. chuangtsoensis, C. xiashiensis, C. microcarpa, etc.), extract total RNA, then reverse transcribe the total RNA and perform RNA-seq sequencing. Use Trinity software for assembly and perform unigene annotation using the functional annotation of databases such as KEGG and COG. According to the unigene annotation information, screen SSR molecular markers related to the active ingredients of Camellia nitidissima (such as polyphenols, polysaccharides, flavonoids, and saponins), and obtain a total of 78 molecular markers related to the active ingredients of Camellia nitidissima; Among them, there are 4 molecular markers related to flavonoid active ingredients: molecular marker Fla1: (AG)6, molecular marker Fla2: (GTAT)5, molecular marker Fla3: (GCT)5, molecular marker Fla8: (CT)9; There are 8 molecular markers related to saponin active ingredients: Such as molecular marker Sa6: (AG)8tgaaactgaaattcacagtcccatacgcaatttctcattcgtttatggaggtgaa(GAT)5, molecular marker Sa7: (AGA)5, molecular marker Sa1: (AAG)6, molecular marker Sa3: (ATC)7, molecular marker Sa5: (AG)6, etc.; There are 31 molecular markers related to polyphenolic active ingredients, such as molecular marker PP21: (AT)7agt(AG)6, molecular marker PP34: (AT)6, molecular marker PP12: (CT)6, molecular marker PP40: (GTT)6, molecular marker PP20: (GA)8, molecular marker PP24: (TAG)7, etc.; There are 35 molecular markers related to polysaccharide active ingredients, such as molecular marker PS1: (AG)7, molecular marker PS15: (GTGTCT)5, molecular marker PS19: (GTG)5, molecular marker PS22: (GA)7, molecular marker PS36: (ACT)5, molecular marker PS5: (CCG)7, molecular marker PS28: (AG)7, molecular marker PS34: (GAA)5, etc.; (2) Design corresponding amplification primers according to the SSR molecular markers screened in step (1). Extract total DNA from Camellia nitidissima leaves (the extraction kit HiPure SF Plant DNA Mini Kit produced by Guangzhou Meiji Biotechnology Co., Ltd. can be used). Then mix the total DNA as a template with the designed amplification primers to prepare a PCR amplification system. The total volume of the PCR amplification system is 20 μL. The PCR amplification system includes 10 μL of reaction buffer (such as TSINGKE_Master_Mix produced by Beijing Tsingke New Industry Biotechnology Co., Ltd.), 1 μL of forward primer with a concentration of 10 μM, 1 μL of reverse primer with a concentration of 10 μM, 1 μL of total DNA template with a concentration of 20 ng / μL, and 7 μL of ddH2O; Amplify the PCR amplification system. After optimization, the amplification program is: S1, 3 min at 94 °C; S2, 30 s at 94 °C, 30 s at 56 °C, 30 s at 72 °C, for a total of 35 cycles; S3, 5 min at 72 °C; (3) Perform electrophoresis detection on the amplification products, select the amplification primers that meet the expected product size and have clear bands, and finally obtain the forward primers F01 - F48 as shown in sequences 1 - 48 in the sequence listing and the reverse primers as shown in sequences 49 - 96 in the sequence listing.

[0018] In addition, it should be understood that although this specification is described according to embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A primer combination for identifying active ingredients of Camellia nitidissima Chi, characterized in that: It includes forward primers F01 to F48 as shown in Sequences 1 to 48 in the sequence listing and reverse primers R01 to R48 as shown in Sequences 49 to 96 in the sequence listing.

2. The application of the primer combination for identifying the active components of Camellia nitidissima as described in claim 1, characterized in that: For the said application, take the leaves of Camellia nitidissima as samples to extract total DNA. Then, use the total DNA as a template and mix it with the said primer combination to prepare a PCR amplification system. Then, perform PCR amplification, conduct electrophoresis detection on the products of PCR amplification, and analyze the obtained bands to determine whether the corresponding active ingredients are contained in the samples.

3. The application according to claim 2, characterized in that: The program of the said PCR amplification is as follows: S1, 3 min at 94 °C; S2, 30 s at 94 °C, 30 s at 56 °C, 30 s at 72 °C, for a total of 35 cycles; S3, 5 min at 72 °C.

Images