Bifidobacterium animalis lactis ca360 and uses thereof
By promoting mineral absorption through Bifidobacterium lactis subsp. Ca360, the problem of low mineral absorption efficiency has been solved, achieving non-pharmacological intervention improvement for osteoporosis and iron deficiency anemia.
Patent Information
- Application Number
- CN202510791325.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-13
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2045-06-13
AI Technical Summary
In existing technologies, low mineral absorption efficiency makes it difficult to effectively treat health problems such as osteoporosis and iron deficiency anemia, and common drug interventions have side effects, lacking effective non-drug intervention methods.
This invention provides a strain of Bifidobacterium lactis Ca360 that improves the absorption of minerals such as calcium, iron, and zinc by promoting the production of short-chain fatty acids and the transport of metal ions in the intestine, thereby improving osteoporosis and iron deficiency anemia.
Bifidobacterium animalis subsp. lactis Ca360 can significantly improve mineral absorption, improve osteoporosis and iron deficiency anemia, and provide health improvement effects without drug intervention.
Smart Images

Figure CN120330110B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of microorganisms and food, in particular to animal bifidobacterium lactis Ca360 and its application, the strain can promote the absorption and transport of minerals, improve osteoporosis and iron deficiency anemia. BACKGROUND
[0002] Minerals (such as calcium, iron, zinc, etc.) are important nutrients for maintaining normal physiological functions of the human body, participating in bone development, nerve conduction, blood formation and immune regulation, and many other life activities. However, low mineral absorption efficiency is a common nutritional problem worldwide, which can easily cause mineral deficiency and lead to serious health risks. Minerals cannot be synthesized in the human body and must be supplemented through diet. The minerals that are more likely to be deficient in the diet of Chinese residents mainly include calcium, iron, zinc, iodine, and selenium. Among them, calcium, iron, and zinc are the most common minerals that are easily deficient.
[0003] Osteoporosis is a bone metabolic disorder disease characterized by damage to bone tissue microstructure, continuous decrease in the ratio of bone mineral content to bone matrix, thinning of bone mass, decrease in bone trabecula number, increase in bone fragility, and increase in risk of fracture. At present, the treatment methods for osteoporosis are limited. Although the drug-based intervention method has certain effect, it cannot completely cure the disease and long-term medication will also cause many side effects to the patients, resulting in ineffective treatment of the disease.
[0004] Iron is a component of hemoglobin; it is involved in the transport and exchange of oxygen and carbon dioxide; it is a constituent material of enzymes and is also essential for energy production. Insufficient intake can cause anemia, pale complexion, tongue pain, fatigue, lack of appetite, nausea, and sensitivity to cold.
[0005] Zinc is the most important element. Zinc is a component of more than 200 enzymes in the body and DNA, RNA, and is an essential substance for growth and development. It is also important for wound healing. It can regulate the secretion of hormones from organs such as testes and ovaries, help effectively relieve stress, and promote the health of the nervous system and the brain, especially for fetuses in development. It is helpful for the formation of bones and teeth, the growth of hair, and the constancy of energy. Symptoms of insufficient intake: taste and smell are not sensitive, at least two fingernails have white spots, susceptible to infection, skin stretch marks, acne or excessive skin oil secretion, low fertility, pale skin, depression, lack of appetite.
[0006] SCFAs, especially acetic acid, propionic acid, and butyric acid, not only indirectly improve bone health by promoting intestinal barrier function and nutrient absorption, but also directly promote bone formation and inhibit bone resorption by reducing systemic inflammation and regulating bone metabolism-related hormones. Butyric acid enhances osteoblast function, while propionic acid inhibits osteoclast activity. Studies have shown that probiotics have a positive impact on the composition and metabolism of the gut microbiome of iron, calcium, selenium, and zinc. Furthermore, probiotics have an independent role in promoting mineral absorption. In addition, certain specific probiotic strains can improve mineral absorption by lowering intestinal pH, secreting organic acids, promoting intestinal mucosal health, or regulating the expression of metal ion transporters. However, the effects of different strains on promoting mineral absorption vary significantly. Bifidobacterium lactis has been reported to improve osteoporosis or promote bone health, but few strains have been found to simultaneously promote mineral absorption and transport while also improving osteoporosis and iron deficiency anemia. In addition, the most well-known commercial probiotic that promotes mineral absorption, improves bone health, and relieves anemia is Lactobacillus plantarum Lp299V. Summary of the Invention
[0007] This invention first provides a subspecies of Bifidobacterium lactis (Bifidobacterium animalis) Bifidobacterium animalis subsp. lactis Ca360, the animal Bifidobacterium lactis subsp. ( Bifidobacterium animalis subsp. lactis Ca360 was deposited on October 30, 2024, at the China General Microbiological Culture Collection Center (No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing), and classified as *Bifidobacterium animalis* subsp. *lactamella*. Bifidobacterium animalis subsp. lactis The strain number is BL-M40, and the preservation number is CGMCC No. 32403.
[0008] In one or more embodiments, the 16S rRNA gene nucleic acid sequence of Bifidobacterium lactis subsp. Ca360 described herein is shown in SEQ ID NO:3.
[0009] The present invention also provides a culture of Bifidobacterium animalis subsp. Ca360 with accession number CGMCC No. 32403.
[0010] In one or more embodiments, the culture further contains a culture medium, such as MRS medium.
[0011] The present invention also provides a pharmaceutical composition comprising (1) a pharmaceutically acceptable excipient and (2) a subsp. *Bifidobacterium animalis* with accession number CGMCC No. 32403, a culture as described in any embodiment herein, or a formulation as described in any embodiment herein.
[0012] In one or more embodiments, the adjuvant is suitable for animal Bifidobacterium lactis.
[0013] The present application also provides a microbial preparation comprising the animal Bifidobacterium lactis Ca360 with the CGMCC No. 32403 and / or its culture, lysate or extract.
[0014] In one or more embodiments, the preparation is selected from one or more of the following: powder, pill, capsule, granule, tablet, oil drop, liquid preparation or gel.
[0015] In one or more embodiments, the preparation further comprises at least one excipient suitable for microbial preparation.
[0016] In one or more embodiments, the preparation is a bacterial suspension comprising the animal Bifidobacterium lactis and a buffer. The buffer can be a phosphate buffer, preferably PBS.
[0017] In one or more embodiments, the preparation is a bacterial powder comprising the animal Bifidobacterium lactis described herein. The method for preparing the bacterial powder comprises: centrifuging the fermentation broth of the animal Bifidobacterium lactis, collecting the bacterial bodies, adding a freeze-drying protective agent to the obtained bacterial bodies, and vacuum freeze-drying to obtain a freeze-dried powder.
[0018] The present application also provides a product comprising the animal Bifidobacterium lactis Ca360 described in any of the embodiments herein, the culture described in any of the embodiments herein and / or the preparation described in any of the embodiments herein.
[0019] In one or more embodiments, the product is a food, a health product or a pharmaceutical product.
[0020] In one or more embodiments, the food further comprises a raw material, wherein the adjuvant in the raw material comprises but is not limited to additives and / or nutritional fortifiers.
[0021] In one or more embodiments, the additives comprise but are not limited to flavorings, stabilizers, thickeners, preservatives, antioxidants, emulsifiers.
[0022] In one or more embodiments, the nutritional fortifiers comprise but are not limited to vitamins, minerals, amino acids, fatty acids, dietary fibers.
[0023] In one or more embodiments, the food comprises but is not limited to dairy products, soy products, probiotic powders, probiotic oil drops, dietary fiber supplements, nutrition bars, rice flour, fruit puree, fruit and vegetable juice, food solid beverage, fruit juice, ice cream, candy, biscuit, infant formula, food for special medical purposes.
[0024] In one or more embodiments, the dosage form of the health product includes, but is not limited to, a powder, a tablet, a granule, a capsule, a solution, an emulsion, or a suspension.
[0025] In one or more embodiments, the dosage form of the health product includes, but is not limited to, a powder, a tablet, a granule, a capsule, a solution, an emulsion, or a suspension.
[0026] In one or more embodiments, the pharmaceutical product further comprises a pharmaceutically acceptable excipient.
[0027] The present application also provides the use of the animal Bifidobacterium lactis Ca360 having the CGMCC No. 32403 or the microbial preparation described in any one of the embodiments herein, wherein the use is selected from one or more of the following: (a) use in the manufacture of a medicament for increasing the content of short chain fatty acids in the gut; (b) use in the manufacture of a medicament for improving uterine atrophy or symptoms thereof; (c) use in the manufacture of a medicament for promoting mineral absorption and transport; (d) use in the manufacture of a medicament for improving osteoporosis or symptoms thereof; (e) use in the manufacture of a medicament for improving iron deficiency anemia or symptoms thereof, (f) use in the manufacture of a gastric acid-resistant, intestinal fluid-resistant, and / or bile salt-resistant microbial preparation, (g) use in the manufacture of a medicament for improving zinc deficiency or symptoms thereof. The present application also provides the use of the animal Bifidobacterium lactis Ca360, the culture, preparation, and / or product described in any one of the embodiments herein, wherein the use comprises one or more of the following: (a) non-therapeutic purpose of increasing the content of short chain fatty acids in the gut; (b) non-therapeutic purpose of improving uterine health status; (c) non-therapeutic purpose of promoting mineral absorption and transport; (d) non-therapeutic purpose of improving bone health status; (e) non-therapeutic purpose of improving iron metabolism; or (f) non-therapeutic purpose of improving zinc deficiency.
[0028] In one or more embodiments, the short chain fatty acid is total short chain fatty acid.
[0029] In one or more embodiments, the short chain fatty acid comprises one or more selected from the group consisting of acetic acid, propionic acid, and butyric acid.
[0030] In one or more embodiments, the uterine atrophy or symptoms thereof is caused by estrogen deficiency.
[0031] In one or more embodiments, the mineral is a divalent metal element, preferably comprising one or more selected from the group consisting of calcium (Ca), iron (Fe), and zinc (Zn), preferably, the mineral is calcium element.
[0032] In one or more embodiments, the form of the mineral present in the product comprises one or more selected from the group consisting of: ionic form (such as Ca2+, Fe2+, Zn2+), salt (such as calcium carbonate, ferrous sulfate, zinc gluconate), oxide (such as zinc oxide, iron oxide), complex.
[0033] In one or more embodiments, the product is a food product, a health product, or a pharmaceutical product.
[0034] In one or more embodiments, the food product further comprises an ingredient, wherein the ingredient comprises, but is not limited to, an additive and / or a nutritional fortifier.
[0035] In one or more embodiments, the additive comprises, but is not limited to, a flavoring, a stabilizer, a thickener, a preservative, an antioxidant, an emulsifier.
[0036] In one or more embodiments, the nutritional fortifier comprises, but is not limited to, a vitamin, a mineral, an amino acid, a fatty acid, a dietary fiber.
[0037] In one or more embodiments, the food product comprises, but is not limited to, a dairy product, a soy product, a probiotic powder, a probiotic oil droplet, a dietary fiber supplement, a nutrition bar, a rice powder, a fruit puree, a fruit-vegetable juice, a food solid beverage, a fruit juice, an ice cream, a candy, a biscuit, an infant formula, a food for special medical purposes.
[0038] In one or more embodiments, the dosage form of the health product comprises, but is not limited to, a powder, a tablet, a granule, a capsule, a solution, an emulsion, or a suspension.
[0039] In one or more embodiments, the dosage form of the pharmaceutical product comprises, but is not limited to, a powder, a tablet, a granule, a capsule, a solution, an emulsion, or a suspension.
[0040] In one or more embodiments, the pharmaceutical product further comprises a pharmaceutically acceptable excipient. BRIEF DESCRIPTION OF DRAWINGS
[0041] Figure 1 : Gram stain of the strain: Gram stain positive;
[0042] Figure 2 : Plate streaking of the strain;
[0043] Figure 3 : Growth curve of the strain;
[0044] Figure 4: Hemolytic plate negative; 1. Negative control bacteria: Listeria innocua CICC 10417; 2. Positive control bacteria: Staphylococcus aureus CICC 10473; 3. Sample: Bifidobacterium animalis lactis Ca360. Note: Test report number: CICC 25-0282-00497.04-00900.
[0045] Figure 5 : Tolerance of Bifidobacterium animalis lactis Ca360 to artificial gastric juice, artificial intestinal juice and artificial bile salt;
[0046] Figure 6 : In vitro fermentation model of simulated intestinal tract: short-chain fatty acids, pH and intracellular and extracellular phytase;
[0047] Figure 7 : Bifidobacterium animalis lactis Ca360 can promote the absorption of Ca, Fe and Zn by cells;
[0048] Figure 8 : Osteoporosis mouse model: body weight and uterine index;
[0049] Figure 9 : Osteoporosis mouse model: blood indicators;
[0050] Figure 10 : Osteoporosis model: MicroCT bone microstructure;
[0051] Figure 11 : Osteoporosis model: short-chain fatty acids in mouse feces;
[0052] Figure 12 : Iron deficiency anemia model: blood cell analysis.
[0053] Figure 13 : Zinc metabolism mouse model: blood zinc content and related protein expression.
[0054] Figure 14 : Zinc metabolism mouse model: colon HE staining results. DETAILED DESCRIPTION
[0055] Probiotics have a positive impact on the composition and metabolism of intestinal microbiota of iron, calcium and zinc. And probiotics have an independent effect on promoting mineral absorption. Certain specific probiotic strains can increase the absorption rate and utilization rate of minerals by reducing intestinal pH, secreting organic acids, promoting intestinal mucosa health or regulating metal ion transporter expression, promoting the absorption of calcium and iron by the body, and thus promoting bone health or improving iron deficiency anemia. However, different strains have significant differences in promoting mineral absorption.
[0056] The application provides an animal Bifidobacterium lactis subsp. Ca360 which can promote mineral absorption and has the functions of improving osteoporosis, iron deficiency anemia and regulating zinc metabolism.
[0057] Animal Bifidobacterium lactis subsp.
[0058] The application first provides an animal Bifidobacterium lactis subsp. Ca360 which has been preserved in the China General Microbiological Culture Collection Center (No. 3, Beichen West Road, Haidian District, Beijing) on October 30, 2024, and is classified and named as animal Bifidobacterium lactis subsp. (Bifidobacterium animalis subsp. lactis), with a strain number of BL-M40 and a preservation number of CGMCC No. 32403. The animal Bifidobacterium lactis subsp. Ca360 belongs to the genus Bifidobacterium and is isolated from the intestinal tract of healthy children in Anyang, Henan. The genus Bifidobacterium is a gram-positive, non-motile, rod-shaped, sometimes bifurcated at one end, strictly anaerobic bacterial genus, which widely exists in the digestive tract, vagina and oral cavity of humans and animals. The 16S rRNA gene nucleic acid sequence of the animal Bifidobacterium lactis subsp. Ca360 described in the present application is shown in SEQ ID NO: 3. The animal Bifidobacterium lactis subsp. Ca360 described in the present application does not contain drug-resistant genes and virulence genes.
[0059] The application also provides a culture of the animal Bifidobacterium lactis subsp. Ca360 with a preservation number of CGMCC No. 32403. The culture described herein also contains a culture medium, and any suitable culture medium for Bifidobacterium is included, such as BS medium, MRS medium, BBL medium and Bifidobacterium agar medium.
[0060] The present application also provides a lysate of the animal Bifidobacterium lactis subspecies Ca360 with the preservation number of CGMCC No. 32403. The methods for lysing the animal Bifidobacterium lactis subspecies are known in the art, such as physical lysing methods (ultrasonic lysing, high-pressure homogenization lysing, glass bead grinding method), chemical lysing methods (enzymatic method, surfactant lysing), biological lysing methods (bacteriophage lysing, autolysis method), combined lysing methods (enzymatic + ultrasonic, chemical + physical). A person skilled in the art can select a lysing method according to the composition and morphological requirements of the lysate.
[0061] The present application also provides an extract (such as polysaccharides, proteins, nucleic acids, metabolites, etc.) of the animal Bifidobacterium lactis subspecies Ca360 with the preservation number of CGMCC No. 32403. The methods for preparing the extract of the animal Bifidobacterium lactis subspecies are known in the art, including but not limited to: pretreatment of bacterial cells (centrifugation, washing), lysing of bacterial cells to release components (for reference to the lysing methods described above, a person skilled in the art can select a suitable lysing method according to the target component), separation and purification of the extract (a person skilled in the art can select a separation technique according to the properties of the target component, for example: polysaccharides (water extraction and alcohol precipitation method, column chromatography), proteins (salting-out method, chromatography method, electrophoresis), nucleic acids (phenol-chloroform method, column extraction method), metabolites (gas chromatography, high-performance liquid chromatography)), concentration and drying (rotary evaporation, ultrafiltration, freeze-drying, spray drying). A person skilled in the art knows the detection methods for the purity and activity of the extract.
[0062] Therefore, the present application also provides a preparation containing the animal Bifidobacterium lactis subspecies Ca360 with the preservation number of CGMCC No. 32403 and / or a culture, lysate or extract thereof. In some embodiments, the agent is a microbial preparation. In one or more embodiments, the preparation can be a powder, a pill, a capsule, a granule, a tablet, an oil drop, a liquid preparation or a gel.
[0063] It should be understood that although the animal Bifidobacterium lactis subspecies Ca360 provided in the examples of the present application is isolated from the intestinal tract of a healthy child, the same genetic sequence derived from the intestinal tract of an animal or fermented food is also included within the scope of the present application, as long as a person skilled in the art can easily isolate and purify the bacterial species therefrom according to the information provided in the present application after reading the present application.
[0064] Applications of the animal Bifidobacterium lactis subspecies
[0065] The present application also provides the animal Bifidobacterium lactis subspecies Ca360 for use as a medicament. Bifidobacterium animalis subsp. lactis) use of Ca360 or a microbial preparation described herein, including one or more selected from: (a) use in the manufacture of a medicament for increasing the content of short chain fatty acids in the gut; (b) use in the manufacture of a medicament for improving uterine atrophy or symptoms thereof; (c) use in the manufacture of a medicament for promoting mineral absorption and transport; (d) use in the manufacture of a medicament for improving osteoporosis or symptoms thereof; (e) use in the manufacture of a medicament for improving iron deficiency anemia or symptoms thereof, (f) use in the manufacture of a medicament for gastric acid resistance, intestinal fluid resistance and / or bile salt resistance, (g) use in the manufacture of a medicament for improving zinc deficiency or symptoms thereof.
[0066] Herein, short chain fatty acids are total short chain fatty acids, and the short chain fatty acids comprise one or more selected from: acetic acid, propionic acid and butyric acid. The term "short chain fatty acid" refers to an organic fatty acid with less than 6 carbon atoms, mainly including acetic acid, propionic acid and butyric acid. In the gut, short chain fatty acids can provide energy for intestinal cells (butyric acid is the main energy source for colon epithelial cells) and regulate glycolipid metabolism (such as propionic acid can regulate blood glucose and affect lipid synthesis), maintain the balance of intestinal flora (provide nutrients for beneficial bacteria, inhibit the growth of harmful bacteria, and regulate the diversity and stability of the flora), enhance the intestinal barrier function (promote the expression of tight junction proteins and maintain the mucus layer), and regulate the intestinal immune system (affect the function of immune cells, balance inflammatory mediators, and reduce intestinal inflammation).
[0067] Herein, uterine atrophy refers to the reduction in uterine volume and the reduction in function, which is associated with a decrease in estrogen levels (such as after menopause). Symptoms associated with uterine atrophy include, but are not limited to, changes in menstruation, frequent urination, urinary urgency or incontinence, lower abdominal distension or dull pain. In some embodiments, improving the symptoms of uterine atrophy includes increasing the uterine index.
[0068] Herein, symptoms of osteoporosis include, but are not limited to, low back pain, limb pain, height loss, humpback, bone fracture, difficulty breathing, cough, shortness of breath, muscle weakness, loose and falling teeth, decrease in bone mineral density, decrease in bone volume fraction, decrease in bone surface tissue volume ratio, or decrease in trabecular bone number, etc. caused by osteoporosis. In some embodiments, improving the symptoms of osteoporosis includes: reducing bone resorption levels, reducing parathyroid hormone levels, increasing VD3 levels, improving bone destruction activity, promoting calcium and phosphorus metabolism balance, increasing bone mineral density, increasing bone surface tissue volume ratio, increasing trabecular bone number, and increasing trabecular spacing.
[0069] Herein, symptoms of iron deficiency anemia include, but are not limited to, fatigue, dizziness, loss of appetite, abdominal distension, glossitis, angular stomatitis, palpitations, shortness of breath, rapid heart rate, murmur, dry skin, dry hair, growth retardation, syncope, low ferritin levels, or high serum total iron binding capacity, etc. caused by iron deficiency anemia. In some embodiments, improving symptoms of iron deficiency anemia includes increasing hemoglobin levels, increasing hematocrit levels, increasing mean corpuscular volume levels, increasing ferritin levels, decreasing serum total iron binding capacity, increasing iron stores, reducing the need for iron transport.
[0070] Herein, symptoms of zinc deficiency include, but are not limited to, malnutrition, growth retardation, reproductive abnormalities, susceptibility to infection, poor appetite, poor skin, low serum zinc levels, high inflammation levels, etc. caused by zinc deficiency. In some embodiments, improving symptoms of zinc deficiency includes increasing serum zinc levels, increasing serum SOD enzyme activity, increasing serum GPx enzyme activity, improving antioxidant levels, alleviating inflammation, reducing inflammatory cell infiltration, modulating gut microbiota, enhancing barrier function, inhibiting pro-inflammatory pathways, improving gut microenvironment, promoting zinc absorption.
[0071] The present application also provides uses of the animal bifidobacterium Bifidobacterium lactis Ca360, the culture, the preparation, and / or the product described in any of the embodiments herein, the uses include one or more selected from: (a) non-therapeutic purposes of increasing short-chain fatty acid content in the gut; (b) non-therapeutic purposes of improving uterine health; (c) non-therapeutic purposes of promoting mineral absorption and transport; (d) non-therapeutic purposes of improving bone health; (e) non-therapeutic purposes of improving iron metabolism; or (f) non-therapeutic purposes of improving zinc deficiency.
[0072] Herein, non-therapeutic purposes of improving uterine health (e.g. uterine health caused by a decrease in estrogen levels) include improving menstrual changes, improving urinary frequency, improving urinary urgency, improving urinary incontinence, improving lower abdominal distension or dull pain.
[0073] Herein, non-therapeutic purposes of improving bone health (e.g. bone health caused by a decrease in estrogen levels) include reducing bone resorption levels, reducing parathyroid hormone levels, increasing VD3 levels, improving bone destruction activity, promoting calcium and phosphorus metabolism balance, increasing bone mineral density, increasing bone surface tissue volume ratio, increasing trabecular bone number, increasing trabecular spacing.
[0074] Herein, non-therapeutic purposes of improving iron metabolism include increasing hemoglobin levels, increasing hematocrit levels, increasing mean corpuscular volume levels, increasing ferritin levels, decreasing serum total iron binding capacity, increasing iron stores, reducing the need for iron transport.
[0075] Herein, the non-therapeutic purpose of improving zinc deficiency includes: increasing serum zinc level, increasing serum SOD enzyme activity, increasing serum GPx enzyme activity, improving antioxidant level, regulating intestinal flora, enhancing barrier function, improving intestinal microenvironment, or non-therapeutic purpose of promoting zinc absorption.
[0076] Herein, the mineral comprises one or more selected from the group consisting of calcium (Ca), iron (Fe) and zinc (Zn) elements, preferably, the mineral is calcium. Wherein, the form of existence of the mineral in the product comprises one or more selected from the group consisting of ionic state (such as Ca²⁺, Fe²⁺, Zn²⁺), salt (such as calcium carbonate, ferrous sulfate, zinc gluconate), oxide (such as zinc oxide, iron oxide), complex.
[0077] As used herein, "improving" includes any beneficial or desired effect on symptoms or pathology of a disease or pathological condition, and can include even a small reduction in one or more measurable markers of a disease or condition (e.g., osteoporosis). Improving can optionally include a reduction or alleviation of symptoms of a disease or condition, or a delay in progression of a disease or condition. "Improving" does not necessarily indicate a complete remission or cure of a disease or condition or its associated symptoms.
[0078] Product
[0079] The present application also provides a product or microbial preparation comprising the animal Bifidobacterium lactis Ca360 with the preservation number of CGMCC No. 32403, culture, lysate, extract thereof. The product described herein can be a food, health product or pharmaceutical product.
[0080] The product can also comprise minerals and micronutrients, such as trace elements and vitamins recommended by government agencies such as USRDA. For example, the product can comprise one or more of the following micronutrients per daily dose: calcium, magnesium, phosphorus, iron, zinc, copper, iodine, selenium, vitamin C, vitamin B1, vitamin B6, vitamin B2, niacin, vitamin B12, folic acid, biotin, vitamin D, vitamin E.
[0081] The product can comprise at least one other type of other food-grade bacteria. As used herein, food-grade bacteria refers to bacteria used and generally recognized as safe for use in food, such as Lactobacillus, Bifidobacterium, and the food-grade bacteria is preferably probiotic bacteria. The probiotic bacteria refers to live microorganisms that, when ingested in adequate amounts, confer health benefits to the host. The product can further comprise at least one prebiotic. The prebiotic refers to a food substance intended to promote the growth of probiotic bacteria.
[0082] For the purpose of the present application, a product is considered to contain Bifidobacterium animalis lactis Ca360 if it contains viable or non-replicating Bifidobacterium animalis lactis Ca360 cells, any cell fragments of Bifidobacterium animalis lactis Ca360, any fraction containing a culture of Bifidobacterium animalis lactis Ca360, and / or a culture medium or a part thereof used for culturing Bifidobacterium animalis lactis Ca360. Said fraction refers to different parts of the culture obtained after separation, classification or fractionation of the culture by certain methods, which can contain at least one of Bifidobacterium animalis lactis Ca360 cells, cell fragments, metabolites, culture, lysate and extracts of said culture, in different concentrations.
[0083] The food products described herein include, but are not limited to, plant-based food, animal-based food, microbially fermented food, processed food, food additive. Further, the food products include, but are not limited to, dairy products, soy products, probiotic oil droplets, dietary fiber supplements, nutrition bars, rice flour, fruit puree, fruit and vegetable juice, food solid beverage, fruit juice, ice cream, candy, biscuit, infant formula, special medical purpose food. The food products can also include raw and auxiliary materials, and the auxiliary materials include, but are not limited to, additives and / or nutritional enhancers. The additives described herein include, but are not limited to, essence and flavor, stabilizer, thickening agent, preservative, mineral, vitamin, malt dextrin.
[0084] “Special medical purpose food (FSMP)” is a food specially processed and prepared to meet the special needs of nutrients or diet for people with limited food intake, digestive and absorption disorders, metabolic disorders or specific disease states. It includes: total nutritional formula food (such as liquid diet for dysphagia), specific total nutritional formula food (such as formula for diabetes, formula for liver disease), non-total nutritional formula food (such as electrolyte formula, amino acid component formula.
[0085] For example, a bacterial suspension suitable for intragastric administration can be obtained by culturing, centrifuging, resuspending in PBS, or can be prepared by mixing bacterial powder with PBS. The method for preparing bacterial powder is known in the art, for example, centrifuging the fermentation broth of Bifidobacterium animalis lactis Ca360 with the preservation number CGMCC No. 32403, collecting the bacterial cells, adding a freeze-drying protective agent to the obtained bacterial cells, and vacuum freeze-drying to obtain a freeze-dried powder. The present application also provides the bacterial powder prepared by the method.
[0086] In one or more embodiments, the product is a solid beverage, probiotic oil droplets, compressed tablet candy, dairy products, modulated milk powder, infant milk powder. Among them, the solid beverage refers to a solid product with moisture not higher than 5 grams per 100 grams of finished product, such as instant coffee, fruit juice, milk tea powder, etc., which has the characteristics of easy storage and carrying; probiotic oil droplets are a product that ingests probiotics through oral administration, and the oil droplet composition can well protect the probiotics, allowing them to survive in the digestive system and exert their efficacy; compressed tablet candy refers to a solid candy made of sugar or syrup (powder) as the main raw material, through mixing, granulation, compression molding and related processes; dairy products refer to various foods made of raw fresh cow (sheep) milk and its products as the main raw material; modulated milk powder is a product that adds various nutritional fortifiers (such as vitamins, minerals, probiotics, DHA, ARA, etc.) on the basis of milk powder, such as pregnant woman milk powder, middle-aged and elderly milk powder, children's growth milk powder; infant milk powder is specially designed for infants to meet the nutritional needs of infant growth and development, and contains a variety of nutritional ingredients such as protein, fat, carbohydrates, vitamins and minerals, etc.
[0087] The dosage form of the health care product described herein includes but is not limited to powder, tablet, granule, capsule, solution, emulsion or suspension.
[0088] The dosage form of the drug described herein includes but is not limited to powder, tablet, granule, capsule, solution, emulsion or suspension. The drug described herein also includes pharmaceutically acceptable excipients.
[0089] The term "pharmaceutically acceptable excipient" refers to a carrier and / or excipient that is compatible with the subject and the active ingredient in pharmacology and / or physiology, which is well known in the art (see, for example, Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995), and includes but is not limited to: pH adjuster, surfactant, adjuvant, ionic strength enhancer. For example, the pH adjuster includes but is not limited to phosphate buffer; the surfactant includes but is not limited to cationic, anionic or non-ionic surfactant, such as Tween-80; the ionic strength enhancer includes but is not limited to sodium chloride.
[0090] Preferably, the excipients described herein do not affect the viability of the bacterial cells. For example: diluents / carriers (lactose, microcrystalline cellulose (MCC), starch and derivatives, mannitol, maltodextrin), protective agents (lyoprotectants such as trehalose, sucrose, glucose, polyvinylpyrrolidone (PVP), dextran, sodium glutamate, glycine, antioxidants such as vitamin C, glutathione), binding agents and disintegrating agents (hydroxypropyl methylcellulose (HPMC), polyvinyl alcohol (PVA), cross-linked povidone (PVPP), sodium carboxymethyl starch (CMS-Na)), coating materials (acrylic resin, hydroxypropyl methylcellulose phthalate, ethyl cellulose), lubricants and glidants (magnesium stearate, microfine silica, talc), other functional excipients (pH adjustors such as citric acid-sodium citrate buffer pair, osmotic pressure adjustors such as sodium chloride, flavoring agents and aromatics such as steviol glycosides, sucralose, fruit flavoring). An exemplary excipient combination for a probiotic lyophilized powder is trehalose, maltodextrin, and mannitol, which, upon lyophilization, forms a high viable cell count formulation, and an exemplary enteric tablet excipient includes microcrystalline cellulose, cross-linked povidone, enteric coating material.
[0091] Other aspects of the application will be apparent to those skilled in the art from consideration of the disclosure herein. It is intended that the specification and examples be considered exemplary only, with the true scope of the application being indicated by the following claims. Methods and reagents used in the examples are conventional in the art unless otherwise indicated.
[0092] Examples
[0093] The examples are illustrated in detail below, and exemplary representations are shown in the accompanying drawings. Where the description refers to the drawings, same numbers in different drawings refer to the same or similar elements unless otherwise noted. The methods described in the following examples do not represent all implementations consistent with the present application. Rather, they are merely examples of systems and methods consistent with some aspects of the present application as described in detail in the claims.
[0094] In the examples of the present application, experimental data are expressed as Mean ± S.E.M, and data were analyzed using PRISM version 10.0 (GraphPad, San Diego, CA, USA), and differences between groups were analyzed using One-way ANOVA followed by Tukery’s multiple comparison test, and p<0.05 was considered statistically significant.
[0095] Example 1: Cultivation, identification and preservation of Bifidobacterium animalis subsp. lactis Ca360
[0096] The animal Bifidobacterium lactis Ca360 of the application is isolated from the intestinal tract of healthy children in Anyang, Henan.
[0097] 1.1. Isolation and culture of the strain
[0098] The stool of healthy children was collected and diluted by gradient dilution method to obtain a diluent. 100 μL of the diluent was spread on MRS medium containing 0.5% cysteine, and incubated at 37°C anaerobically for 48-72 h. Different shapes were picked to new MRS medium plates according to the shape, size, color, etc. of the colonies, and line separation and purification were performed (see Figure 2 ), to obtain the isolated strain Ca360.
[0099] The culture medium used was ordinary MRS medium. The isolated strain was subjected to Gram staining and hydrogen peroxide enzyme test, and then potential strains were selected according to the characteristics of Gram staining positive (see Figure 1 ) and no hydrogen peroxide enzyme. The DNA of the strain was extracted, and the 16s rRNA fragment universal primer 27F / 1492R was used for PCR amplification and sequencing, and then the gene sequence was compared with the NCBI gene library to obtain the animal Bifidobacterium lactis Ca360. The 16S rRNA gene sequencing result is shown in SEQ ID NO: 3.
[0100] 1.2. Preservation and activation of the strain
[0101] The animal Bifidobacterium lactis Ca360 was configured into a bacterial solution, 20% glycerol was added to the bacterial solution to a final concentration, and then mixed and placed in a -80°C refrigerator for preservation. After thawing under ice bath conditions, the bacterial solution was inoculated into a previously prepared MRS culture dish using a sterile inoculation loop, and placed in an anaerobic incubator for growth for about 48 h until complete colonies grew in the culture dish (see Figure 2 ). The strain growth curve is shown in Figure 3 .
[0102] 1.3. Preservation of the strain
[0103] The animal Bifidobacterium lactis Ca360 was preserved in the China General Microbiological Culture Collection Center (No. 3, Beichen West Road, Chaoyang District, Beijing) on October 30, 2024, and was named as animal Bifidobacterium lactis (Bifidobacterium animalis subsp. lactis). The strain preservation strain number is BL-M40, and the preservation number is CGMCC No. 32403.
[0104] Example 2: Tolerance of animal Bifidobacterium lactis Ca360 to artificial gastric juice, artificial intestinal juice and artificial bile salt
[0105] In this embodiment, the acid tolerance of the animal Bifidobacterium lactis Ca360 of the application in artificial gastric juice, artificial intestinal juice and artificial bile salt was tested, and Lactobacillus plantarum Lp299V with good tolerance and mineral absorption promotion was used as a positive control strain.
[0106] The test method was as follows: the rejuvenated lactic acid bacterial strain was inoculated in MRS liquid medium, and cultured at 37°C for 18 h, then centrifuged at 4°C and 2500 rpm for 10 min, and the bacterial cells were collected.
[0107] The test strain was incubated in artificial gastric juice (SGJ pH 1.5, pH 2.5, pH 3.5) at different pH for 3 h, in artificial intestinal juice (pH 6.8) for 4 h, and in artificial bile salt (0.1%, 0.3% and 1%) at different concentrations for 24 h, and then viable plate counting was performed to evaluate the acid tolerance and intestinal juice tolerance of the strain. The survival rate = (the number of viable bacteria after treatment / the number of viable bacteria at 0 time) x 100%.
[0108] The survival rate of the strain in artificial gastric juice is shown in Figure 5 (A), the survival rate of animal Bifidobacterium lactis Ca360 in artificial gastric juice (pH 2.5) for 3 h was 69.4%, and the survival rate in artificial gastric juice (pH 3.5) for 3 h was 93.6%, which had no significant difference (p>0.05) with the positive strain (Lp299V) (A). Figure 5 (A). It showed that the animal Bifidobacterium lactis Ca360 of the application had excellent gastric acid tolerance and could smoothly pass through the stomach to the gastrointestinal tract.
[0109] The survival rate of the strain in artificial intestinal juice is shown in Figure 5 (B), the survival rate of animal Bifidobacterium lactis Ca360 in artificial intestinal juice (pH 6.8) for 4 h was 61.2%, which had no significant difference (p>0.05) with the positive strain (Lp299V) (B). Figure 5 (B). The survival rate of the strain in artificial bile juice is shown in Figure 5 (C), the survival rate of animal Bifidobacterium lactis Ca360 in 0.3% artificial bile salt for 24 h was 66.3%, and the survival rate in 1% artificial bile salt for 24 h was 23.3%, which had no significant difference (p>0.05) with the positive strain (Lp299V). It showed that the animal Bifidobacterium lactis Ca360 of the application had intestinal juice tolerance and bile salt tolerance, and could survive and colonize in the intestinal tract.
[0110] Example 3: Safety evaluation of animal Bifidobacterium lactis Ca360 strain
[0111] The results of the MIC value, i.e. sensitivity test of Bifidobacterium animalis subsp. lactis Ca360 are shown in Table 1.
[0112] 3.1. Hemolytic test
[0113] The rejuvenated Bifidobacterium animalis subsp. lactis Ca360 strain was inoculated on blood agar plates and incubated in a 37 °C incubator for 36 h. No hemolysis was observed, i.e. the hemolysis was negative. This indicates that the target strain is a non-pathogenic bacterium and has a high safety. Figure 4
[0114] 3.2. MIC test
[0115] The strain resistance was determined according to the method of EFSA 5206-2018 “Guidelines on the characterisation of a microbial species for use in a feed additive or a production of a fermented product” 2.2.1 Methodology for antimicrobial susceptibility. The results show that Bifidobacterium animalis subsp. lactis Ca360 is sensitive to ampicillin, vancomycin, gentamicin, streptomycin, erythromycin, clindamycin, tetracycline, chloramphenicol (Table 1).
[0116] Table 1. Results of MIC value, i.e. sensitivity test of Bifidobacterium animalis subsp. lactis Ca360
[0117] Antibacterial drugs Critical value (mg / L) MIC value (mg / L) Drug sensitivity Ampicillin 2 0.064 Sensitive Vancomycin 2 0.25 Sensitive Gentamicin 64 64 Sensitive Streptomycin 128 16 Sensitive Erythromycin 1 0.064 Sensitive Clindamycin 1 ≤0.032 Sensitive Tetracycline 8 8 Sensitive Chloramphenicol 4 1 Sensitive
[0118] Note: 1. MIC: minimum inhibitory concentration
[0119] Example 4: In vitro simulation of human intestinal fermentation: simulation of in vivo fermentation of probiotic bacteria
[0120] The simulated intestinal flora medium was prepared according to the following medium formula table (Table 2). After heating and stirring until the medium was dissolved, the medium was divided into a flask and filled with gas. After closing the lid, it was placed in a pressure sterilization pot for sterilization. For the rejuvenated bacterial liquid, 2-3% of the bacterial liquid was inoculated into the flask using a sterile 1 mL syringe. After mixing, it was placed in a constant temperature incubator at 37 °C for 24 hours. After the culture was completed, the pH and SCFA were detected.
[0121] Table 2. Formula of simulated intestinal medium (1L)
[0122] Ingredients Content Trypticase 10g Yeast extract 2.5g L-cysteine 1g Hematin 2ml Sodium chloride 0.9g CaCl2·6H2O 0.009g KH2PO4 0.45g K2HPO4 0.45g MgSO4.7H2O 0.09g Vitamin I 200 μl Resazurin (1 mg / ml) 1ml Starch 8g
[0123] Note: In Table 1, before heating, hemin 5 mg / ml in 1M NaOH was added, and 100 μl of vitamin II solution was added per 1L PBS. The formula of the vitamin I solution in Table 1 and the vitamin II solution added to the resazurin are shown in Tables 3 and 4, respectively.
[0124] Table 3. Vitamin I solution formulation (40 mL, -30 °C storage)
[0125] Ingredients Content Biotin (VH) 2 mg cobalamin (VB 12 )]]> 2 mg p-Aminobenzoic acid 6 mg Folic acid 10 mg pyridoxine (VB6) 30 mg
[0126] Table 4. Vitamin II solution formulation (1 mL, -30 °C storage)
[0127] Ingredients Content Thiamine (VB1) 5 mg Riboflavin (VB2) 5 mg
[0128] The pH of the sample was measured using a handheld pH meter. Before measurement, the electrode was cleaned with UP water three times, and then the electrode was placed in the sample solution after the residual water was absorbed with experimental paper. The reading was recorded after the reading was stable.
[0129] The short-chain fatty acids in the fermentation broth sample were quantitatively evaluated using the external standard calibration method of gas chromatography. Briefly, 500 μL of the fermentation broth to be determined was added with 100 μL of 15.0168 μmol / mL crotonic acid, mixed and centrifuged at 16000 rpm for 5 minutes, and the supernatant was collected and filtered into a sampling bottle with a water system filter membrane. 0.5 μL of the supernatant was determined using a gas chromatography system equipped with a DB-FFAP column. The chromatographic conditions were as follows: the column temperature was increased to 180 °C at a rate of 20 °C per minute for 1 minute, and then increased to 220 °C at a rate of 50 °C per minute for 1 minute; the split ratio was 10:1, and the flow rate was 2.8 mL / min per minute.
[0130] In order to detect the phytase activity of the strain, 100 μL of the bacterial liquid of the strain to be determined after subculture was added into 10 mL of MRS medium, and incubated at 37 °C and 200 rpm for 24 h. After rapid freezing and thawing three times, the culture solution was centrifuged at 4 °C and 8,000 rpm for 10 min, and the supernatant was collected. The activity of phytase was detected and analyzed using a phytase assay kit (Beijing Boxi Shengong Technology Co., Ltd.).
[0131] An in vitro simulation of human intestinal fermentation model was used, as shown in Figure 6 The animal Bifidobacterium lactis Ca360 can ferment to produce acetic acid, propionic acid, butyric acid and other substances, which are significantly higher than the positive strain Lp299V (p<0.0001).
[0132] Example 5: Promoting the absorption and transport of minerals by cells
[0133] Human colon cancer cell Caco-2 was purchased from Wuhan Ponsay Life Science Co., Ltd. The cell line was cultured in DMEM (Servicebio, G4511), which is a modified version of Dulbecco Eagle medium, enriched with 10% fetal bovine serum (FBS, Gibco, 10,270,106) and supplemented with 1% penicillin-streptomycin (Beyotime, C0222). The cell line was used between the 10th and 25th passages. The medium was changed every two days after the cells reached confluence.
[0134] 1. Cytotoxicity test
[0135] The cytotoxicity of the test strain was evaluated on the Caco-2 cell line. The test strain was incubated in the culture medium for 24 h and washed in HBSS buffer, then the strain density was adjusted to 10 7 CFU / mL in DMEM medium, and the cells were grown in 96-well tissue culture plates for 7 days until confluence, washed twice in PBS buffer, and then 300 μL of different bacterial suspensions were added to the cell monolayer. PBS buffer was used as a negative control. After incubation at 37 °C and 5% CO2 for 24 h, 50 μL of cell supernatant was taken, and lactate dehydrogenase (LDH) activity was determined using an in vitro toxicology assay kit based on LDH (Sigma-Aldrich, St. Louis, USA). The results were expressed as a percentage of the LDH activity of negative cells.
[0136] 2. Ca, Fe, Zn absorption and transport cell experiment
[0137] Cells were seeded at 50,000 cells / well on Transwell permeable support (0.4 µm, polyester membrane) in 12-well tissue culture plates and incubated for 15–20 days in a CO2 incubator containing 95% O2 and 5% CO2. The transepithelial resistance (TEER) of the Caco-2 monolayer was measured using a voltmeter-ohmmeter MilliCell resistance system (Merck Millipore, Burlington, USA). The TEER value was calculated according to the following equation: TEER(Ω⋅cm^2)=(R_t-R_0)×S. A TEER value greater than 600 was considered to indicate monolayer formation. Some modifications were made to the method used by Raveschot C et al. to determine calcium ion transport efficiency. Bacterial suspensions were prepared as described in Section 2.5. Caco-2 cell monolayers were washed twice with HBSS. Then, 500 μL of bacterial suspension (DMEM medium as a control) and CaCl2 (250 mM), Zn2SO4 (50 μM), and FeSO4 (50 μM) were added to the upper chamber (apical side) of the cells. The cells were incubated at 37 °C and 5% CO2 for 24 h. The lower chamber medium was collected, and calcium content was measured using inductively coupled plasma atomic emission spectrometry (iCAP7400, Thermo Fisher Scientific, USA). Caco-2 cell monolayers were washed with HBSS, followed by washing with ice-cold buffer and cell collection. Intracellular fluid was then collected using a rapid freeze-thaw method, and the collected intracellular fluid was also measured for cellular calcium uptake using inductively coupled plasma atomic emission spectrometry.
[0138] The absorption and transport of minerals by the strain were studied using Caco-2 cells. For example... Figure 7 As shown, neither the strain (Lp299V) nor the added minerals (CaCl2, FeSO4, ZnSO4) were toxic to the cells. Both strains Lp299V and Ca360 significantly promoted the cells' absorption of CaCl2. 2+ Fe 2+ and Zn 2+ The absorption and transport of Ca360 (p<0.05) were enhanced, and Ca360 promoted the absorption and transport of Ca360. 2+ The translocation rate of [specific component] was significantly higher than that of Lp299V. This indicates that *Bifidobacterium animalis* subsp. *lactobacter* Ca360 has a significant function in promoting mineral absorption and translocation, particularly in promoting the absorption and translocation of Ca. 2+ Absorption and transport are most efficient (p<0.0001).
[0139] Example 6: Study on the intervention effect of probiotics on an ovariectomized osteoporosis mouse model
[0140] Ovariectomy method: After depilation, the skin was disinfected with 10% povidone iodine, the mice were anesthetized and aseptic operation was performed. At the intersection of the bilateral femur and the spinal column horizontal line, the bilateral ovarian tissue was found and removed.
[0141] 50 four-week-old female C57BL / 6J mice were kept in a temperature range of 23-25 °C, humidity of 40-60%, and consistent 12-hour light / dark cycle. After domestication and feeding for 1 week, the mice were randomly grouped according to body weight, and 30 mice were subjected to ovariectomy (OVX), 10 mice were divided into a sham operation group (Sham group) (sutured immediately after skin incision), and the remaining 10 mice were divided into a normal control group (Control group). After recovery for one week, the ovariectomized mice were randomly divided into the following 3 groups (1) model control group (OVX group, n = 10), (2) OVX + Lactobacillus plantarum Lp299V (Lp299v group, n = 10), (3) OVX + Bifidobacterium animalis ssp. lactis Ca360 (Ca360 group). After grouping, the mice were given the test substance by gavage once a day, and the probiotic groups, i.e., the Lp299v group and the Ca360 group, were given the corresponding probiotics by gavage, with a dose of 1 × 10 9 cfu / d / mouse, and the sham operation group (Sham group), the model control group (OVX group), and the normal control group (Control group) were given the corresponding PBS by gavage.
[0142] After 10 weeks of intervention, all mice were sacrificed, and samples such as uterus, femur, tibia, etc. were collected, and indicators related to osteoporosis such as uterine coefficient, bone microstructure, bone structure model parameters, blood, colon, and feces were determined.
[0143] The body weight changes of the animals before and after intervention are shown in Figure 8 A. After the model was successfully established, the body weight of the sham operation group (Sham group) was significantly lower than that of the ovariectomized groups, and was consistent with the normal control group. This is consistent with the significant increase in body weight of postmenopausal women. There was no significant difference between the ovariectomized model group and the intervention groups.
[0144] The uterine coefficient of mice is an important indicator for evaluating estrogen-like effects or drug effects, and its calculation method is the ratio of uterine wet weight to body weight multiplied by 100% (i.e., uterine coefficient = uterine mass / mouse body mass × 100%). The experimental results show that Figure 8B), the uterus coefficient of the ovariectomized model group (OVX) was significantly lower than that of the sham operation group (Sham) and the normal control group (Control) (p<0.0001), indicating that after ovariectomy, with the decrease of estrogen in the body, the uterus atrophied significantly. After the intervention of probiotics, the uterus coefficient of the Lp299v group had no difference with the OVX group, while the uterus index of the Ca360 group of mice was significantly higher than that of the OVX group (p<0.001), indicating that the animal Bifidobacterium lactis Ca360 can significantly improve the uterine atrophy caused by ovariectomy.
[0145] The results of the hematology-related indicators of osteoporosis showed that Figure 9 After ovariectomy, the levels of tartrate-resistant acid phosphatase (TRACP-5b) and parathyroid hormone (PTH) in the OVX group were significantly higher than those in the Control group (p<0.001) and the Sham group (p<0.0001), while the levels of 1,25-(OH)2 D3 and serum phosphorus were significantly lower than those in the Control group and the Sham group. This indicates that the sudden drop in estrogen after ovariectomy triggers a high turnover state of bone metabolism, characterized by increased bone resorption (TRACP-5b↑) and increased compensatory PTH secretion. PTH maintains blood calcium stability and reduces blood phosphorus by regulating bone calcium release and kidney phosphorus excretion. The decrease in VD3 exacerbates the imbalance of calcium and phosphorus metabolism, but the compensatory effect of PTH makes the blood calcium not significantly fluctuate.
[0146] After the intervention of probiotics, the levels of TRACP-5b and PTH in the Lp299v group and the Ca360 group were significantly reduced, and the level of 1,25-(OH)2 D3 was significantly increased. The Ca360 group had a significantly better ability to reduce the level of TRACP-5b than the Lp299v group. This indicates that the animal Bifidobacterium lactis Ca360 can significantly improve the bone destruction activity caused by ovariectomy (estrogen deficiency) and promote the balance of calcium and phosphorus metabolism.
[0147] The results of the micro-CT bone tissue analysis showed that Figure 10 The bone trabecula arrangement of the OVX group of mice was sparse, the boundary cavity was obvious, the bone microstructure was damaged, and the bone mineral density (BMD), bone volume fraction (BV / TV), bone surface tissue volume ratio (BS / TV), and trabecular number (Tb.N) were significantly decreased, and the trabecular spacing (Tb.Sp) was significantly increased. These characteristics are typical manifestations of bone loss caused by estrogen deficiency.
[0148] The therapeutic effect on osteoporosis is generally verified by the increase of bone density and the improvement of bone trabecula parameters. The BMD, BS / TV and Tb.N of the Ca360 intervention group of mice were significantly increased, and the trabecular spacing (Tb.Sp) was significantly increased, and there was no significant difference with the Sham group and the normal control group. This indicates that the animal Bifidobacterium lactis Ca360 can significantly improve the osteoporosis caused by ovariectomy.
[0149] Example 7: Fecal metabolites detection in ovariectomized osteoporosis mouse model by probiotics
[0150] Short-chain fatty acids in mouse samples were quantitatively evaluated using external standard calibration method of gas chromatography. Briefly, 500 μL of fecal and PBS suspension (1:9) to be determined was added with 100 μL of 15.0168 μmol / mL crotonic acid, mixed and centrifuged at 16000 rpm for 5 minutes, and the supernatant was collected and filtered into a sampling bottle with a water system filter membrane. 0.5 μL of the supernatant was determined using a gas chromatography system equipped with a DB-FFAP column. The chromatographic conditions were as follows: the column temperature was raised to 180°C at a rate of 20°C per minute for 1 minute, and then raised to 220°C at a rate of 50°C per minute for 1 minute; the split ratio was 10:1, and the flow rate was 2.8 mL / min per minute.
[0151] The data results are shown in Table 2 as follows: Figure 11
[0152] Total short-chain fatty acids: The acetic acid content in the feces of OVX group mice was significantly lower than that of Sham group and Control group (p<0.0001). Compared with the OVX group, the acetic acid content in the feces of probiotic Lp299v and Ca360 groups was significantly higher than that of the OVX group (p<0.0001 and p<0.0001), and the acetic acid content in the Ca360 group was significantly higher than that in the normal control group (p<0.05).
[0153] Acetic acid: The acetic acid content in the feces of OVX group mice was significantly lower than that of Sham group and Control group. Compared with the OVX group, the acetic acid content in the feces of probiotic Lp299v and Ca360 groups was significantly higher than that of the OVX group (p<0.001 and p<0.0001), and the acetic acid content in the Ca360 group was significantly higher than that in the normal control group (p<0.05).
[0154] Propionic acid: The acetic acid content in the feces of OVX group mice was significantly lower than that of Sham group and Control group (p<0.0001). Compared with the OVX group, the propionic acid content in the feces of probiotic Lp299v and Ca360 groups was significantly higher than that of the OVX group (p<0.01 and p<0.001),
[0155] Butyric acid: The butyric acid content in the feces of OVX group mice was lower than that of Sham group and Control group (p<0.05). Compared with the OVX group, the butyric acid content in the feces of probiotic Lp299v and Ca360 groups was significantly higher than that of the OVX group (p<0.01 and p<0.001).
[0156] Example 8: Iron deficiency anemia (IDA) mouse model and probiotic intervention
[0157] Iron deficiency anemia (IDA) mouse model construction method: After one week of adaptation, the mice were randomly divided into the following groups using SPSS: normal control group, model group, positive control group, Lp299v group and Ca360 group. During the experiment: normal control group (Control group): fed with low-iron feed and intragastrically administered with 3 mg / kg bw of FeSO4; model group (IDA group): iron-deficient diet, intragastrically administered with 200 μL of normal saline; positive strain control group (Lp299v group): iron-deficient diet, intragastrically administered with 200 μL of plant lactobacillus Lp299v at a dose of 1 x 10 9 cfu / mL) and FeSO4 (3 mg / kg bw); probiotic Ca360 group: iron-deficient diet, intragastrically administered with 200 μL of animal lactobacillus bifidum Ca360 (1 x 10 9 cfu / mL) and FeSO4 (3 mg / kg bw). The mice were taken blood from the tail vein at a fixed time every week during the experiment for biochemical detection, and after 4 weeks, the model group with hemoglobin (HGB) <90 g / L was judged as modeling completed, and the experiment was stopped to collect blood for detection. The whole blood biochemical analyzer was used to analyze the blood routine index.
[0158] The blood routine results showed that ( Figure 12 ), the hemoglobin (HGB), hematocrit (HCT) and mean corpuscular volume (MCV) of the IDA group mice were significantly lower than those of the NC group, indicating that the IDA model successfully induced typical anemia characteristics. After Ca360 treatment, the HGB, HCT and MCV of the mice were significantly improved. Ca360 treatment significantly increased the ferritin level (Ferritin) and significantly reduced the serum total iron binding capacity (TIBC), suggesting that these treatments may improve iron metabolism by increasing iron reserves and reducing the demand for iron transport. It is shown that animal bifidobacterium lactis Ca360 can significantly improve iron deficiency anemia.
[0159] Example 9: Zinc deficiency mouse model and probiotic intervention
[0160] Modeling and intervention
[0161] Zinc deficiency mouse model construction method: After one week of adaptation, the mice were randomly divided into the following groups using SPSS: normal control group, model group, and intervention group (including zinc gluconate group, zinc sulfate group, and Ca360 group), 10 mice per group. During the experiment: normal control group (Control group): standard diet + 200 μL normal saline; zinc deficiency model group (model group): low zinc diet + 200 μL normal saline by gavage; zinc sulfate group (ZnSO4 group): low zinc diet + ZnSO4; zinc gluconate group: low zinc diet + zinc gluconate; Ca360 group: low zinc diet, 200 μL of animal milk bifidobacterium Ca360 (1×10 9 The dose of Zn in the zinc sulfate group, zinc gluconate group, and Ca360 group was 5.22 mg Zn / kg / d. On day 21, the mice were euthanized, and blood and colon tissue were collected. The colon tissue was treated for histopathological analysis (10% paraformaldehyde fixation), and the serum was subjected to biochemical testing.
[0162] The zinc content of the standard diet was 6.96 mg / kg.bw Zn, and the zinc content of the low zinc feed was 1.74 mg / kg.bw Zn.
[0163] ELISA detection
[0164] The serum zinc (Zn) content, nitric oxide (NO) level, superoxide dismutase (SOD) activity, and glutathione peroxidase (GPx) activity of each group of mice were detected using commercial ELISA kits AKBL007M, AKNM005M, AKAO001M, and AKPR014M (Boxbio, China) according to the kit instructions.
[0165] HE staining
[0166] The paraffin sections were treated with deparaffinization to water, and then placed in environmentally friendly deparaffinization liquids I and II for 20 minutes each, anhydrous ethanol I and II for 5 minutes each, 75% alcohol for 5 minutes, and then rinsed with tap water. The frozen sections were removed from the -20°C refrigerator and restored to room temperature, then fixed with tissue fixative for 15 minutes and rinsed with running water. After that, the sections were placed in high-definition constant dye pretreatment liquid for 1 minute; stained with hematoxylin dye for 3-5 minutes, rinsed with tap water, differentiated using differentiation liquid, rinsed again, and then blued with bluing liquid, and finally rinsed thoroughly with running water. Then, the sections were dehydrated in 95% alcohol for 1 minute and then stained in eosin dye for 15 seconds. After staining, the sections were transparently treated with anhydrous ethanol I, II, III for 2 minutes each, n-butanol I, II for 2 minutes each, xylene I, II for 2 minutes each, and finally sealed with neutral balsam. Finally, microscopic examination was performed under a microscope, and images were collected for analysis.
[0167] Result analysis
[0168] ELISA detection results show that the serum Zn content of the model group mice is significantly lower than that of the Control group, indicating that the low-zinc mouse model is successfully established. The serum zinc content of the intervention group is significantly higher than that of the model group, and there is no significant difference with the Control group. Figure 13
[0169] Studies have shown that zinc deficiency can significantly affect the activity of nitric oxide enzyme, and thus affect the generation and metabolism of NO. In the zinc-deficient mouse model, the change in serum NO level is mainly manifested as an increase in NO content. The serum NO level of the model group mice increased significantly, while the serum NO level of the intervention group supplemented with the same dose of Zn decreased significantly.
[0170] Zinc plays an important role in antioxidant processes. Zinc deficiency can lead to a decrease in the antioxidant capacity of mice, an increase in lipid peroxidation levels, and a decrease in superoxide dismutase (SOD) activity. In this experiment, the intake of Ca360 can also significantly increase the enzyme activity of serum SOD and glutathione peroxidase (GPx) in mice. This shows that the intake of Ca360 can significantly improve the antioxidant level of zinc-deficient mice.
[0171] HE staining results show that zinc-deficient mice have obvious intestinal macrophage infiltration compared with the normal control group, indicating that their immune barrier is damaged and inflammatory response is activated. Supplementation with zinc gluconate and zinc sulfate can partially alleviate inflammation, and the inflammatory area is mainly limited to the basal side. The effect of probiotic Ca360 is more significant, significantly reducing inflammatory cell infiltration, which may improve the intestinal microenvironment, promote zinc absorption by regulating intestinal flora, enhancing barrier function and inhibiting pro-inflammatory pathways. Figure 14
[0172] Partial sequence
[0173] SEQ ID NO: 127F
[0174] agagtttgatcctggctcag
[0175] SEQ ID NO: 2 1492R
[0176] ggttaccttgttacgactt
[0177] SEQ ID NO: 3 16S rRNA gene sequencing
[0178]
Claims
1. Bifidobacterium animalis subsp. lactis, deposited with China General Microbiological Culture Collection Center, and having the accession number CGMCC No. 32403.
2. A culture of the Bifidobacterium animalis subsp. lactis of claim 1.
3. The culture of claim 2, wherein, The culture further comprises a culture medium.
4. A microbial preparation, characterized in that, The microbial preparation is a microbial preparation comprising the Bifidobacterium animalis subsp. lactis of claim 1 or the culture thereof as an active ingredient.
5. The microbial preparation of claim 4, wherein The microbial preparation further comprises at least one excipient suitable for a microbial preparation, and / or The microbial preparation is a powder, a pill, a capsule, a granule, a tablet, an oil drop, a liquid preparation, or a gel, and / or The microbial preparation is resistant to gastric acid, intestinal fluid, and / or bile salt.
6. A pharmaceutical composition comprising (1) a pharmaceutically acceptable excipient, and (2) the Bifidobacterium animalis subsp. lactis of claim 1, the culture of claim 2 or 3, and / or the preparation of claim 4 or 5.
7. A product comprising the Bifidobacterium animalis subsp. lactis of claim 1, the culture of claim 2 or 3, and / or the preparation of claim 4 or 5.
8. The product of claim 7, wherein, The product is a food.
9. The product of claim 8, wherein, The type of the food includes a plant-based food, an animal-based food, a microbially fermented food, a processed food, a food additive.
10. The product of claim 8, wherein the food further comprises an excipient.
11. The product of claim 10, wherein, The excipient includes an additive and / or a nutritional fortifier.
12. The product of claim 11, wherein The additive includes one or more selected from the group consisting of a flavoring, a stabilizer, a thickening agent, a preservative, an antioxidant, an emulsifier, and / or The nutritional fortifier includes one or more selected from the group consisting of a vitamin, a mineral, an amino acid, a fatty acid, a dietary fiber.
13. The product of claim 8, wherein the food includes one or more selected from the group consisting of a dairy product, a soy product, a probiotic powder, a probiotic oil drop, a dietary fiber supplement, a nutrition bar, a rice powder, a fruit puree, a fruit-vegetable juice, a food solid beverage, a fruit juice, an ice cream, a candy, a biscuit, an infant formula, a food for special medical purposes.
14. The product of claim 7, wherein, The product is a health food.
15. The product of claim 14, wherein, The dosage form of the health food includes a powder, a tablet, a granule, a capsule, a solution, an emulsion, a suspension.
16. Use of the Bifidobacterium animalis lactis of claim 1, the culture of claim 2 or 3, and / or the preparation of claim 4 or 5, the use comprising: (a) use in the manufacture of a medicament for improving osteoporosis; (b) use in the manufacture of a medicament for improving iron deficiency anemia; (c) use in the manufacture of a microbial preparation resistant to gastric acid, intestinal fluid, and / or bile salt; (d) use in the manufacture of a medicament for improving zinc deficiency; or (e) use in the manufacture of a medicament for improving uterine atrophy caused by removal of the ovary.
17. The use according to claim 16, wherein The osteoporosis is caused by estrogen deficiency.
18. Use of the Bifidobacterium animalis lactis of claim 1, the culture of claim 2 or 3, and / or the preparation of claim 4 or 5, the use comprising: (a) use in the manufacture of a medicament for ameliorating the symptoms of osteoporosis comprising a decrease in bone mineral density, a decrease in bone volume fraction, a decrease in bone surface to tissue volume ratio, or a decrease in trabecular number; (b) use in the manufacture of a medicament for ameliorating the symptoms of iron deficiency anemia comprising low ferritin levels or high serum total iron binding capacity; or (c) use in the manufacture of a medicament for ameliorating the symptoms of zinc deficiency comprising low ferritin levels or high serum total iron binding capacity.
19. The use according to claim 18, wherein the compound is ###00010### 18 The symptoms of osteoporosis are caused by estrogen deficiency.
20. Use of the Bifidobacterium animalis lactis of claim 1, the culture of claim 2 or 3, the preparation of claim 4 or 5, and / or the product of claim 8 or 14, the use comprising: (a) non-therapeutic use to promote the absorption and transport of minerals selected from one or more of: Ca 2+ , Fe 2+ and Zn 2+ ; (b) use for non-therapeutic purposes to improve the health status of the skeleton; (c) use for non-therapeutic purposes to increase the content of short chain fatty acids in the intestinal tract, the short chain fatty acids being total short chain fatty acids or the short chain fatty acids being one or more selected from the group consisting of acetic acid, propionic acid and butyric acid; (d) use for non-therapeutic purposes to improve the health status of the uterus; (e) use for non-therapeutic purposes to improve iron metabolism; or (f) use for non-therapeutic purposes to improve zinc deficiency.
21. The use of claim 20, wherein, The mineral absorption and transport is absorption and transport of minerals by cells. The symptoms of osteoporosis are caused by estrogen deficiency.
20. Use of the Bifidobacterium animalis lactis of claim 1, the culture of claim 2 or 3, the preparation of claim 4 or 5, and / or the product of claim 8 or 14, the use comprising: (b) use for non-therapeutic purposes to improve the health status of the skeleton; (c) use for non-therapeutic purposes to increase the content of short chain fatty acids in the intestinal tract, the short chain fatty acids being total short chain fatty acids or the short chain fatty acids being one or more selected from the group consisting of acetic acid, propionic acid and butyric acid; (d) use for non-therapeutic purposes to improve the health status of the uterus; (e) use for non-therapeutic purposes to improve iron metabolism; or (f) use for non-therapeutic purposes to improve zinc deficiency. The mineral absorption and transport is absorption and transport of minerals by cells.
Citation Information
Patent Citations
Bifidobacterium lactis capable of preventing osteoporosis and application of bifidobacterium lactis capable of preventing osteoporosis
CN110964656A
Cited By
Application of phytobacterium plantarum Hi188 in promotion of bone health
CN121667389A
Use of lactobacillus plantarum hi188 in promoting bone health
CN121667389B
Specific detection primer of bifidobacterium longum subsp. Longum BBMN68 and application thereof
CN122060887A
Specific detection primer of bifidobacterium longum subsp. longum bbmn68 and application thereof
CN122060887B