A visual detection kit for specific diagnosis of the bovine theileria annulata under constant temperature conditions

By designing a CRISPR/Cas13a system with specific crRNA and RPA reaction products, a highly sensitive and specific detection method for *Theileria ringeri* was achieved, solving the problems of missed detection and equipment dependence in existing technologies, and providing a visual detection method suitable for general laboratories.

CN120330182BActive Publication Date: 2026-03-20LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410069133.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-17
Publication Date
2026-03-20
Estimated Expiration
2044-01-17

AI Technical Summary

Technical Problem

Existing methods for detecting *Theileria annulata* in cattle have the risk of false negatives, especially when the infection rate in cattle is low. Microscopic and molecular detection methods require specialized equipment and professional operation and have low sensitivity. The CRISPR/Cas13a detection system lacks specific design for detecting *Theileria annulata* in cattle.

Method used

A crRNA specifically targeting the surface antigen of bovine *Theileria annulata* sporozoites was designed for the CRISPR-Cas13a system. By combining the RPA reaction product and a reporter molecule, highly sensitive and specific detection of *Theileria annulata* was achieved through isothermal incubation under constant temperature conditions and detection with a test strip.

Benefits of technology

It achieves highly sensitive and specific detection of *Theileria annulata*, enabling rapid and visual identification of *Theileria annulata* under isothermal conditions, reducing the risk of missed detection, and is suitable for general laboratory environments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330182B_ABST
    Figure CN120330182B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological detection, and particularly relates to a visual detection kit for specifically diagnosing Theileria annulata under constant temperature conditions; the kit comprises RPA reaction products, crRNA, Cas13a protein, RNase inhibitor, reporter molecule, T7 RNA polymerase, NTP and NTT, the RPA reaction products are obtained by amplification of a primer pair shown in SEQ ID NO. 4 and 5, and the sequence of the crRNA is shown in SEQ ID NO. 1; the method is that the RPA reaction products, the crRNA, the Cas13a protein, the RNase inhibitor, the reporter molecule, the T7 RNA polymerase, the NTP and the NTT are mixed and incubated at an isothermal temperature; the incubation product is transferred into a detection buffer, inserted into a test strip, and the result is observed after incubation. The detection method has high sensitivity and high specificity, and can be used for specific detection of Theileria annulata.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of in vitro diagnostic products, and particularly relates to a visual detection kit for specifically diagnosing bovine Theileria annulata under constant temperature conditions. BACKGROUND

[0002] Theileria annulata disease is caused by the parasitism of Theileria annulata of the Theileria family in the red blood cells and mononuclear macrophage system cells of cattle, and the transmission medium is small Asian hard ticks. There is a sexual reproduction process in the tick body. The Theileria annulata disease in China is mainly caused by Theileria annulata. The disease is distributed in many countries in the world and has been reported in many provinces in China. The disease has caused serious economic losses to the cattle industry, and therefore the prevention and treatment of the disease are still important and necessary.

[0003] The traditional diagnosis method of Theileria annulata is to observe the parasites in red blood cells and the parasites in lymph node puncture fluid under a microscope, but when the cattle infection rate is low, the parasites cannot be directly observed under a microscope, which is easy to cause missed detection. With the development of science and technology, molecular detection technologies such as polymerase chain reaction (PCR), reverse line blot (RLB), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), and fluorescence quantitative PCR (qPCR) and serological enzyme-linked immunosorbent assay (ELISA) have been successfully established for the detection of Theileria annulata. Among them, recombinase polymerase amplification (RPA) and enzyme-linked immunosorbent assay (ELISA) have been combined with immunochromatographic test strips to realize visual detection. However, all the above detection methods have their own limitations. Microscope examination and molecular detection require special instruments and equipment and professional operators, and the visual detection methods established have low sensitivity and may have the risk of missed detection in actual application.

[0004] The clustered regularly interspaced short palindromic repeat (CRISPR) system is a repeated palindromic sequence existing in bacteria, which has the function of capturing invading exogenous DNA genes. When exogenous genes invade bacteria, CRISPR-associated proteins, i.e. Cas series of proteins, can integrate the obtained specific exogenous genes into the spacer sequence of the CRISPR structure, and when the exogenous genes invade again, the exogenous genes can be quickly recognized and destroyed by the function of endonuclease. The CRISPR and Cas are referred to as CRISPR-Cas system, and the technology modified from the system is currently widely used in gene editing, molecular diagnosis and other aspects.

[0005] The Cas series has now been developed into three subgroups of Cas9, Cas12 and Cas13. Cas9 technology is mainly applied to gene editing and targeted removal at the DNA level. Cas13a has the characteristics of specific recognition of pathogenic RNA. With the development of technology, the CRISPR / Cas13a system combined with RPA and other specific high-sensitivity enzymatic reporter unlocking (SHERLOCK) platforms are widely used in the detection of various pathogens, and have the characteristics of constant temperature, rapidness, high sensitivity and high specificity. However, for different pathogen detection, the selection of crRNA in the CRISPR / Cas13a detection system and the preparation of RPA reaction products have a greater impact on the detection results. Therefore, for different pathogen detection, the selection of crRNA, the preparation of RPA reaction products, the selection of probes and the CRISPR / Cas13a detection system also need to be considered, and there is no specific CRISPR / Cas13a detection method for the detection of Theileria annulata. SUMMARY

[0006] In view of the above technical problems, the purpose of the present application is to provide a kit and a visual detection method for the differential diagnosis of Theileria annulata under constant temperature conditions. The highly sensitive and highly specific detection of Theileria annulata is achieved. Specifically, the following contents are included:

[0007] In a first aspect, the present application provides a crRNA for specific targeting of Theileria annulata sporozoite surface antigen in a CRISPR-Cas13a system, wherein the sequence of the crRNA is shown as SEQ ID NO. 1.

[0008] In a second aspect, the present application provides a primer pair for amplifying the crRNA of the first aspect, wherein the primer pair comprises a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 3.

[0009] In a third aspect, the present application provides a kit for the differential diagnosis of Theileria annulata under constant temperature conditions, wherein the kit comprises an RPA reaction product, the crRNA of the first aspect, a Cas13a protein, an RNase inhibitor, a reporter molecule, a T7 RNA polymerase, NTP and NTT, and the RPA reaction product is obtained by amplification of the upstream and downstream primer pairs shown as SEQ ID NO. 4 and 5.

[0010] Preferably, the RPA reaction system and procedure are as follows:

[0011] Upstream primer (10 mM) as shown in SEQ ID NO. 4, 2.4 μl;

[0012] Downstream primer (10 mM) as shown in SEQ ID NO. 5, 2.4 μl;

[0013] Primer Free Rehydration Buffer, 29.5 μl;

[0014] Genomic DNA, 1 μl;

[0015] Enzyme-free water to make up 47.5 μl;

[0016] The above-mentioned substances are added into the dry powder tube provided with the RPA kit, mixed, 2.5 μL of 280 mM MgOAc is added on the tube cover, and after centrifugation, the reaction is carried out at 37°C for 20 min.

[0017] Preferably, the reporter molecule is a single-stranded RNA containing at least 2 consecutive bases U and a fluorescent group and a quenching group.

[0018] Preferably, the sequence of the reporter molecule is 5'-6-FAM-UUUUUUUUUUUUUU-Biotin-3'.

[0019] In a fourth aspect, the present application provides the use of the kit of the third aspect described above in the detection of non-diagnostic therapeutic purpose of Theileria annulata.

[0020] In a fifth aspect, the present application provides a method for detecting non-diagnostic therapeutic purpose of Theileria annulata, which comprises: mixing and incubating isothermally RPA reaction product, crRNA of the first aspect described above, Cas13a protein, RNase inhibitor, reporter molecule, T7 RNA polymerase, NTP, NTT; transferring the incubation product into a detection buffer, inserting into a test strip, observing the results after incubation; the RPA reaction product is obtained by amplification with the primer pair as shown in SEQ ID NO. 4 and 5.

[0021] Preferably, the reporter molecule is a single-stranded RNA containing at least 2 consecutive bases U and a fluorescent group and a quenching group.

[0022] Preferably, the reporter molecule is LF-PolyU, and its sequence is 5'-6-FAM-UUUUUUUUUUUUUU-Biotin-3'.

[0023] Preferably, the isothermal incubation condition is:

[0024] Detection system: RPA reaction product, 5 μL; crRNA 10 μM, 1 μL; Cas13a protein 166 μg / ml, 1 μL; RNase inhibitor, 2 μL; LF-PolyU, 2 μL; T7 RNA polymerase Mix, 0.6 μL; NTP Buffer Mix, 2.5 μL; DTT (0.1 M), 2 μL; Enzyme-free water, 33.9 μL;

[0025] Incubate the prepared system at 37℃ for 1h.

[0026] Preferably, the crRNA is obtained by annealing the forward primer shown in SEQ ID NO. 2 and the reverse primer shown in SEQ ID NO. 3 and purification.

[0027] Preferably, the preparation method of the crRNA is as follows:

[0028] Dilute the forward primer shown in SEQ ID NO. 2 and the reverse primer shown in SEQ ID NO. 3 to 50 μM using enzyme-free sterile water. Perform the annealing reaction system as follows:

[0029] Enzyme-free water, 40 μL; DNA oligonucleotide annealing buffer (5×), 20 μL; forward primer (50 μM), 20 μL; reverse primer (50 μM), 20 μL;

[0030] The annealing conditions of the PCR instrument are as follows:

[0031] 95℃ for 2 min to denature the oligo completely; decrease by 0.1℃ every 8 s to 25℃; store at 4℃ for a short time;

[0032] Use 2% agarose nucleic acid gel electrophoresis to cut and recover the brightest position of the band;

[0033] Use the T7 transcription kit to transcribe the DNA double strand obtained by annealing into RNA, and prepare the system as follows:

[0034] Enzyme-free water, supplement to 30 μL; NTP Buffer Mix, 10 μL; DNA template, 1 μg; DTT (0.1 M), 1.5 μL; T7 RNA Polymerase Mix, 2 μL;

[0035] Put the prepared system into a 37℃ constant temperature incubator and incubate overnight for 16 h;

[0036] Remove the DNA template using DNase I (from the T7 transcription kit): add 30 μL of enzyme-free water to each 20 μL reaction, then mix 2 μL of DNase I, and incubate at 37℃ for 15 min;

[0037] The RNA product was purified using an RNA purification kit according to the instructions. After the concentration was measured, it was stored at -80℃ for later use.

[0038] The beneficial effects of this invention are as follows: Firstly, this invention provides a kit for the differential diagnosis of *Theileria annulare* under isothermal conditions. The kit includes RPA reaction products, crRNA, Cas13a protein, RNase inhibitor, reporter molecule, T7 RNA polymerase, NTP, and NTT. The RPA reaction products are obtained by amplification using the primer pairs shown in SEQ ID NO. 4 and 5, and the crRNA sequence is shown in SEQ ID NO. 1. Secondly, this invention provides a visual detection method for the differential diagnosis of *Theileria annulare* under isothermal conditions. The method involves mixing the RPA reaction products, crRNA, Cas13a protein, RNase inhibitor, reporter molecule, T7 RNA polymerase, NTP, and NTT and incubating them isothermally. The incubation product is then transferred to a detection buffer, a test strip is inserted, and the results are observed after incubation. Specifically, this invention designs multiple sets of crRNAs targeting the surface antigens of *Theileria annulare* sporozoites, of which only one set (shown in SEQ ID NO. 1) of crRNA sequences is applied to the CRISPR / Cas13a detection system, enabling specific detection of *Theileria annulare*. In summary, the detection method of the present invention has high sensitivity and high specificity, and can be used for the specific detection of *Theileria annulata*. Attached Figure Description

[0039] Figure 1 Test strip instructions;

[0040] Figure 2 Results of CRISPR / Cas13a-specific detection of Theileria rings;

[0041] Figure 3 The results of CRISPR / Cas13a sensitivity testing for *Theileria annulata* are shown, where 1 is a positive control for *Theileria annulata*; 2-12 are pET30a(+)-SPAG 1.42×10⁻⁶. 9 -1.42×10 -1 ;13 is a negative control. Detailed Implementation

[0042] The present invention will be described in detail below through specific embodiments, but the scope of protection of the present invention is not limited to the following embodiments. Any technical solution that can be conceived by those skilled in the art based on the present invention and in combination with common knowledge in the art shall fall within the scope of protection of the present invention.

[0043] The reagents used in this invention include:

[0044] Reagents for expressing LwCas13a protein: Rosetta competent cells (TaKaRa company); ampicillin 20 mg / ml; LB medium; IPTG 1M / L; sterilized PBS (Biodee company); Binging Buffer 20mM Tris-HCL, 500mM NaCl, 10mM Imidazole; Eluent Buffer 20mM Tris-HCL, 500mM NaCl, 500mM Imidazole; Storage Buffer 50mM Tris-HCL, 600mM NaCl, 5% Glycerol; dialysis bag (Solepap company); SUMO buffer 20mM Tris-HCL, 500mM NaCl, 0.15% IGEPAL CA-630 (Sigma company); SUMO enzyme (APE company); 30kDa ultrafiltration tube (Merck company); BCA protein quantification kit (ThermoFisher company); 10% SDS-PAGE Color Preparation kit (Shenguo biological company);

[0045] Reagents for crRNA preparation: DNA oligonucleotide annealing buffer (Biyun Tian company); RNA purification kit (Shenguo biological company); Enzyme-free sterile water (Solepap company); agarose (Polymer beauty company); DL2000 Marker (TaKaRa company); dithiothreitol (DTT) 0.1M;

[0046] Construction of SPAG positive plasmid: pET30a(+);

[0047] Reagents required for RPA reaction: RPA Kit (TwistAMP company);

[0048] Reagents required for CRISPR / Cas13a reaction: HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs company); RNase inhibitor (murine, New England Biolabs company); Milenia HybriDetect1 (TwistAMP company);

[0049] Genomic extraction: M5 blood genomic extraction kit (Polymer beauty); anhydrous ethanol (marketed).

[0050] Example 1 Visual detection method for differential diagnosis of bovine Theileria annulata under constant temperature conditions

[0051] 1. Obtaining of Lwcas13a protein

[0052] Lwcas13a plasmid was transformed into Rosetta competent cells, after overnight culture at 37°C, 1:1000 was inoculated into 400 ml ampicillin-resistant LB medium, and incubated at 37°C until the OD600 was between 0.4 and 0.6. Then 500 nM IPTG was added, and the culture was incubated at 18°C and 160 rpm for 20 h. Then the bacteria were collected by centrifugation at 4°C and 12000 rpm for 10 min. The bacteria were resuspended and washed twice with PBS, and then resuspended with Binding Buffer. After ultrasonic disruption, the mixture was centrifuged at 4°C and 12000 rpm for 30 min. The supernatant was collected, filtered with a 0.22 μm filter, combined with a nickel column overnight, washed with Binding Buffer to remove impurities, and then eluted with 300 mM Eluent Buffer to obtain the target protein. After WB confirmed that the eluate was the target protein, it was dialyzed three times in SUMO enzyme buffer, each time for 1 h, using 330 ml of buffer. Then the dialyzed protein was incubated with SUMO enzyme overnight, and then concentrated to about 200 μL using a 30 kDa ultrafiltration tube, pre-cooled centrifuge at 4°C and 3500 rpm. Then 500 μL Storage Buffer was added, and the mixture was concentrated to 200 μL again. The concentrated protein was aliquoted and stored in a -80°C refrigerator, and the protein concentration was determined by BCA.

[0053] 2. Extraction of genome from blood

[0054] According to the instructions, the extracted genome was stored at -20°C for standby.

[0055] 3. Design and synthesis of specific primers according to the nucleotide sequence of the surface antigen (SPAG) of the bovine Theileria annulata sporozoite

[0056] Theileria annulata upstream primer (SPAG-RPA-F): 5'- ATTTAATTCAATAGGGTTAGGTTTCAAAATAGC-3' (underlined is the T7 promoter), as shown in SEQ ID NO. 4; TAATACGACTCACTATAGGG Theileria annulata downstream primer (SPAG-RPA-R): 5'- TGATTATTTCTGAGATTTTGACTATAAATGCTG-3', as shown in SEQ ID NO. 5;

[0057]

[0058] ​crRNA (SPAG-crRNA): 5'-GAAAUUAAUACGACUCACUAUAGGG (T7 promoter) GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC (anchoring sequence for Cas13a protein) AAAUCAUCUCCAAAAUUCUUUAGUUUUAUCAGG (target sequence) -3', as shown in SEQ ID NO. 1;

[0059] crRNA upstream primer (SPAG-crRNA-F): 5'-GATTTAGACTACCCCAAAAACGAAGGGGACTAAAACAAATCATCTCCAAAATTCTTTAGTTTTATCAGG-3' (underlined is T7 promoter), as shown in SEQ ID NO. 2; GAAATTAATACGACTCACTATAGGG

[0060] crRNA downstream primer (SPAG-crRNA-R): 5'-CCTGATAAAACTAAAGAATTTTGGAGATGATTTGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC-3', as shown in SEQ ID NO. 3;

[0061] Reporter (LF-PolyU): 5'-6-FAM-UUUUUUUUUUUUUU-Biotin-3'.

[0062] 4. The preparation method of the crRNA is as follows:

[0063] (1) The crRNA upstream primer and the crRNA downstream primer are diluted into 50 μM using enzyme-free sterile water;

[0064] (2) The following annealing reaction system is operated:

[0065] Enzyme-free water, 40 μL;

[0066] DNA oligonucleotide annealing buffer (5×), 20 μL;

[0067] Forward primer (50 μM), 20 μL;

[0068] Reverse primer (50 μM), 20 μL;

[0069] (3) The following annealing conditions of the PCR instrument are as follows:

[0070] 95℃ 2 min Oligo denaturation;

[0071] ​Drop 0.1℃ every 8s, to 25℃;

[0072] 4℃ short-term storage;

[0073] (4) Using 2% agarose nucleic acid gel electrophoresis, the brightest position of the band was cut and recovered;

[0074] (5) Using T7 transcription kit, the annealed DNA double chain was transcribed into RNA, and the following system was prepared:

[0075] Enzyme-free water, supplemented to 30μL;

[0076] NTP Buffer Mix, 10μL;

[0077] DNA template, 1μg;

[0078] DTT (0.1M), 1.5μL;

[0079] T7 RNA Polymerase Mix, 2μL;

[0080] The prepared system was placed in a 37℃ constant temperature incubator for overnight incubation for 16h;

[0081] (6) Using DNase I (from T7 transcription kit), remove the DNA template: add 30μL enzyme-free water to each 20μL reaction, then add 2μL DNase I mixture, incubate at 37℃ for 15min;

[0082] (7) Using RNA purification kit according to the instruction steps, purify the RNA product, measure the concentration and store at -80℃ for standby.

[0083] 5. Preparation of RPA reaction product

[0084] RPA reaction system and procedure as follows:

[0085] The upstream primer of Theileria annulata (10μM), 2.4μl;

[0086] The downstream primer of Theileria annulata (10μM), 2.4μl;

[0087] Primer Free Rehydration Buffer, 29.5μl;

[0088] Genomic DNA, 1μl;

[0089] Enzyme-free water, supplemented to 47.5μl;

[0090] The above substances were added into the dry powder tube provided with the RPA kit, mixed, 2.5 μL of 280 mM MgOAc was added on the tube cover, and after centrifugation, the reaction was carried out at 37°C for 20 min.

[0091] 6. CRISPR / Cas13a detection method

[0092] Detection system: RPA reaction product, 5 μL; crRNA 10 μM, 1 μL; Cas13a protein 166 μg / ml, 1 μL; RNase inhibitor, 2 μL; LF-PolyU, 2 μL; T7 RNA polymerase Mix, 0.6 μL; NTP Buffer Mix, 2.5 μL; DTT (0.1 M), 2 μL; enzyme-free water, 33.9 μL;

[0093] The prepared system was incubated at 37°C for 1 h.

[0094] 7. Paper strip observation results (Milenia HybriDetect 1 was used):

[0095] 20 μL of the reaction product was removed and added to 100 μL of Dipstick Assay Buffer, and the test paper strip was inserted and incubated for 3-5 min to observe the results. The test paper strip is shown in Figure 1 .

[0096] 8. Specificity test

[0097] The established system was used to amplify Theileria annulata, T. sergenti, T. sinensis, Babesia bovis, B. bigemina and negative bovine blood genome, and the results are shown in Figure 2 , except for T. annulata, T. sergenti, T. sinensis, B. bovis, B. bigemina and negative bovine blood genome did not appear positive band, indicating that the method described in the application can specifically detect bovine T. annulata.

[0098] 9. Sensitivity test

[0099] The constructed pET30a(+)-SPAG plasmid was determined for concentration, and the copy number was 1.42×10 10 copies / μL, which was diluted 10 times to 1.42×10 -1 copies / μL, and the sensitivity of the method was determined using the established CRISPR / Cas13a visualization detection method, and the results are shown in Figure 3 , the lower limit of detection by naked eye observation was 1.42×10 0 copies / μL.

[0100] 10. Sample detection

[0101] The 30 collected blood samples were detected by the established CRISPR / Cas13a visual detection method, and the positive sample was 76.67%

[0102] (23 / 30), 20 positive samples (20 / 30) were detected by the national standard PCR method, and the detection rate was 66.67%.

[0103] In summary, the present application designs a plurality of crRNA groups for the surface antigen of the bovine Theileria annulata sporozoite, wherein only the crRNA sequence of one group (shown as SEQ ID NO. 1) is applied to the CRISPR / Cas13a detection system, which can be used for specific detection of the bovine Theileria annulata, has high sensitivity and high specificity, and can be used for specific detection of the bovine Theileria annulata.

[0104] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A kit for the differential diagnosis of *Theileria annulare* under isothermal conditions, characterized in that, The kit includes RPA reaction product, crRNA, Cas13a protein, RNase inhibitor, reporter molecule, T7 RNA polymerase, NTP, and NTT; the RPA reaction product is obtained by amplification using the primer pair shown in SEQ ID NO. 4 and 5; the crRNA sequence is shown in SEQ ID NO. 1; the reporter molecule sequence is 5'-6-FAM-UUUUUUUUUUUUU-Biotin-3'.

2. The kit according to claim 1, characterized in that, The crRNA primers were obtained by amplification using the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.

3.

3. The application of the kit as described in any one of claims 1-2 in the detection of *Theileria annulata* in bovine cells for non-diagnostic and non-therapeutic purposes.

4. A method for detecting *Theileria annulata* in bovine annulare for non-diagnostic and non-therapeutic purposes, characterized in that, The method includes: mixing and isothermally incubating RPA reaction product, crRNA, Cas13a protein, RNase inhibitor, reporter molecule, T7 RNA polymerase, NTP, and NTT; transferring the incubation product into a detection buffer, inserting a test strip, and observing the results after incubation; the RPA reaction product is obtained by amplification using the primer pairs shown in SEQ ID NO. 4 and 5; the crRNA primers are obtained by annealing and purification using the forward primer shown in SEQ ID NO. 2 and the reverse primer shown in SEQ ID NO. 3; the reporter molecule is LF-PolyU, with the sequence 5'-6-FAM-UUUUUUUUUUUUU-Biotin-3'.

5. The detection method as described in claim 4, characterized in that, The isothermal incubation conditions are as follows: Detection system: RPA reaction product, 5 μL; crRNA 10 μM, 1 μL; Cas13a protein 166 μg / ml, 1 μL; RNase inhibitor, 2 μL; LF-PolyU, 2 μL; T7 RNA polymerase Mix, 0.6 μL; NTP Buffer Mix, 2.5 μL; 0.1 M DTT, 2 μL; enzyme-free water, 33.9 μL; Incubate the prepared system at 37℃ for 1 h.

Citation Information

Patent Citations

  • On-site visual kit for detecting listeria monocytogenes based on SHERLOCK and application

    CN114075607A