Application of SNP molecular marker of MLANA gene in marker-assisted breeding of Wucheng chicken

By screening for the black color of Silkie chicken muscle using MLANA gene SNP molecular markers and screening for the dominant CT genotype using genotyping technology, the problem of slow progress in the breeding of Silkie chicken muscle black color was solved, and early selection and efficient breeding were achieved.

CN120330349BActive Publication Date: 2026-06-26JIANGSU INST OF POULTRY SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510666866.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-22
Publication Date
2026-06-26
Estimated Expiration
2045-05-22

AI Technical Summary

Technical Problem

The breeding of black-boned chicken muscles has progressed slowly. Current technology requires post-slaughter observation, which is costly and results in slow generational genetic progress.

Method used

Using MLANA gene SNP molecular markers, DNA was extracted from blood collected from the subwing vein for genotyping. The CT genotype of the SNP locus that was significantly associated with muscle brightness L* value was screened out for use in the breeding of live chickens, eliminating individuals with inferior genotypes and retaining those with superior genotypes.

Benefits of technology

This has accelerated the generational breeding progress of black-boned chicken muscle coloration, simplified the breeding process, reduced costs, and improved breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330349B_ABST
    Figure CN120330349B_ABST
Patent Text Reader

Abstract

The application discloses a kind of MLANA The application discloses application of gene SNP molecular marker in black-bone chicken molecular marker assisted breeding MLANA The application discloses application of gene SNP molecular marker in black-bone chicken molecular marker assisted breeding The application discloses application of gene SNP molecular marker in black-bone chicken molecular marker assisted breeding
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, specifically, to... MLANA Application of gene SNP molecular markers in molecular marker-assisted breeding of black-boned chicken muscle color. Background Technology

[0002] Silkie chickens are characterized by their black skin and black meat, and are highly favored by consumers for their high melanin content and unique nourishing and medicinal value. In the research and development of Silkie chickens, "black skin, black meat, and black bones" have been the main research objectives, with "black skin and black meat" being the most prominent characteristics. Melanin deposition is the main reason for the black color of Silkie chickens, and consumers often judge their quality based on the depth of this blackness. Melanin deposition is a complex regulatory system, regulated by multiple genes and signaling pathways. The melanin A gene... MLANA (melan-A, MLANA) is involved in melanocyte differentiation, melanosome transport, developmental pigmentation, and melanin biosynthesis.

[0003] Studies have shown that muscle brightness (L*) reflects the brightness of the muscle surface; the lower the L* value, the darker the muscle color, the higher the muscle blackness, and the higher the melanin content. This establishes the L* value as a reference indicator for selecting for the blackness trait. Currently, in the breeding process, Silkie chickens are usually slaughtered first, and then the blackness of the muscles after slaughter is observed visually for selection. Slaughtered Silkie chickens cannot undergo further growth and development, and blackness observation is not possible, which is costly and results in slow generational genetic progress. Therefore, finding molecular markers significantly related to muscle blackness, eliminating the need for slaughtering Silkie chickens, and directly using molecular markers for early selection of live chicken muscle blackness, is of great significance for improving the generational selection progress of Silkie chicken muscle blackness. Summary of the Invention

[0004] To address the slow progress in breeding black-colored muscles in Silkie chickens, this invention provides a... MLANA Application of gene SNP molecular markers in marker-assisted breeding of black-boned chicken muscle color. MLANA The relevant information about gene SNP molecular markers is as follows:

[0005]

[0006] The nucleotide sequences of the primers for the SNP molecular markers are as follows:

[0007]

[0008] The screening method for the SNP molecular markers is as follows:

[0009] Genotyping of 60 SNP loci related to melanin deposition genes was performed using the MassARRAY platform based on time-of-flight mass spectrometry, excluding SNP loci without polymorphism. Univariate ANOVA in a general linear model using SPSS 16.0 software was used to analyze the association between polymorphic loci genotypes and flesh-colored lightness L* values. After analysis, SNPs were selected... MLANA One SNP locus of the gene is polymorphic. The correlation between this SNP marker and the color brightness L* value of the pectoral and leg muscles was then analyzed. The color brightness L* value of the thigh muscles of the CT genotype at this SNP locus was significantly lower than that of the TT genotype, indicating that individuals with the CT genotype have a higher degree of darkness in their thigh muscles.

[0010] Specifically, the above MLANA The application of gene SNP molecular markers in marker-assisted breeding of black-boned chicken muscle color includes the following steps:

[0011] (1) Extract total genomic DNA from the chickens to be bred;

[0012] Preferably, the genomic DNA of the chicken to be bred is obtained by collecting blood from the wing vein of an individual of the breed.

[0013] (2) Method for determining the brightness L* value of thigh muscle and the brightness L* value of breast meat: After slaughtering the live chicken, 4cm of the thigh skin and breast skin were removed. 2 A 2cm x 2cm section of skin was cut open to expose the thigh and chest muscles. The L* value of the thigh and chest muscles was then measured using a TC.PIIG fully automatic colorimeter. All flesh color measurements were performed by the same person, and the measured areas were basically the same.

[0014] (3) Design primers based on SNP sites, perform PCR amplification, and then perform sequencing verification and genotyping;

[0015] The PCR products were sent to a biotechnology company for sequencing. The resulting sequences were compared with the chicken reference genome to identify polymorphic sites. The nucleotide sequences of the SNP site PCR products are shown below:

[0016] MLANA -rs315623285 (mutation site T / C), PCR product: 215 bp.

[0017] TGGTTCTGGACAGGGATAGGATCTCAAAATGCCCAGAAGAAGCCACTAK(T / C)GAAGATGGAAACTTCTTTAGAGGAAAAGGACGCACCTATTTCACAGCAGAAGAGTAAGCATAAAGCAAAACCTATTTTAGCATGTATGTAGAAAAAAACTTAGACTGAAAAGGAAATTCACAGAGTAGTACAAAAATAAAAATAAAAATCAGGGCCGTACAAAGAA.

[0018] Note: K marked in the above sequence is the mutation site, and the bases in parentheses are the mutated bases, which are allele mutations.

[0019] (4) Based on the genotype results, select individuals with the dominant genotype CT that have higher muscle darkness and eliminate individuals with the inferior genotype that have lower darkness.

[0020] The specific method for determining the dominant genotype is as follows: the SNP (rs315623285) locus has two genotypes, CT and TT. The L* value of thigh muscle brightness of the CT genotype is significantly lower than that of the TT genotype (P<0.05), indicating that the CT genotype is the dominant genotype for thigh muscle darkness.

[0021] Through the above technical solution, the present invention achieves the following beneficial effects:

[0022] use MLANA In marker-assisted breeding of black-boned chicken muscle color, gene SNP molecular markers can be used to select for the L* value of thigh meat brightness by using the dominant CT allele as an important molecular marker. By selecting individuals with the dominant CT genotype and eliminating individuals with other genotypes, the breeding of thigh muscle color can be improved and the generational selection of thigh muscle color can be accelerated. Attached Figure Description

[0023] Figure 1 This is an embodiment of the present invention. MLANA Mass spectrometry typing of gene SNP sites. Detailed Implementation

[0024] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0025] Example 1: Screening for molecular markers significantly associated with the black coloration of Silkie chicken muscle.

[0026] 1. Materials and Methods

[0027] Ninety-two Silkie chickens (half male and half female) were randomly selected, their leg numbers were recorded, and 1 mL of blood was collected from the subwing vein. The blood was anticoagulated with ACD, mixed thoroughly, and stored at -20 °C for later use. DNA was extracted using the standard phenol-chloroform method. DNA samples from all 192 individuals were sent to a biotechnology company for further investigation of melanin-related factors in Silkie chickens. MLANA Genes were detected by mass spectrometry using the MassARRAY time-of-flight mass spectrometry platform, data were collected, and SNP loci were genotyped.

[0028] 2. Measurement of L* value of chest and thigh muscles

[0029] After slaughtering the live chicken, cut 4cm incisions in the skin of the thigh and breast. 2 (2cm x 2cm) Thigh and chest muscles were exposed, and the L* values ​​of the thigh and chest muscles were measured using a TC.PIIG fully automatic colorimeter. All flesh color measurements were performed by the same person, and the measured areas were basically the same.

[0030] 3. Genotyping and its correlation with muscle brightness L* value

[0031] 3.1 SNP locus genotyping

[0032] Genotyping of 192 individuals at 60 SNP loci related to melanin deposition genes was performed using the MassARRAY platform based on time-of-flight mass spectrometry, after removing SNP loci without polymorphism. MLANA The gene has one polymorphic SNP site, the information of which is shown in Table 1. This SNP site has two genotypes, the results of which are shown in the mass spectrometry analysis results. Figure 1 . Figure 1 This is the mass spectrometry typing of SNP (rs315623285 T>C), NO call (0), CC (0), CT (14), TT (178), CC=0, CT=0.07, TT=0.93.

[0033] Table 1 MLANA SNP information on gene polymorphism

[0034]

[0035] 3.2 MLANA Genetic polymorphism analysis of SNP loci

[0036] Haploview 4.1 was used to detect whether the SNP sites were in Hardy-Weinberg (HW) equilibrium, and the genotype frequency, allele frequency, and heterozygosity (He) of the above SNP sites were statistically analyzed. The results are shown in Table 2.

[0037] Table 2 shows that there are two genotypes at the SNP locus. HW equilibrium was then determined. MLANA The gene SNP is in HW equilibrium (P>0.05). This locus... He =0.073, Ho =0.07, indicating low genetic diversity ( PIC <0.25).

[0038] Table 2 MLANA Gene SNP locus genetic polymorphism and Hardy-Weinberg equilibrium test

[0039]

[0040] 3.3 Correlation analysis of SNP markers with the L* value of pectoral and leg muscle color intensity traits

[0041] Association analysis between polymorphic locus genotypes and flesh color brightness L* values ​​was performed using univariate ANOVA in a general linear model within SPSS 16.0 software. Fixed factors: different genotypes of the SNP marker; dependent variable: flesh color brightness L* value. The LSD method was used for multiple comparisons to determine the significance of differences in flesh color brightness L* values ​​among different marker genotypes; P < 0.05 was considered statistically significant.

[0042] Correlation analysis of SNP markers with the L* value traits of pectoral and leg muscles revealed... MLANA The SNP loci of the gene were significantly correlated with the L* value of thigh muscle brightness, but not with the L* value of chest muscle brightness (see Table 3). The L* value of thigh muscle brightness for the CT genotype at the SNP (rs315623285) locus was significantly lower than that for the TT genotype (P < 0.05), indicating that the CT genotype is the dominant genotype for thigh muscle darkness. In breeding, this can be... MLANA The CT dominant allele at the SNP (rs315623285) locus serves as an important molecular marker for selecting the L* value of thigh meat. By retaining individuals with the CT genotype and eliminating individuals with other genotypes, we can assist in improving the dark color of thigh muscle and accelerate the generational selection process for dark thigh muscle.

[0043] Table 3. Association analysis between gene loci and the L* value of chest and leg muscle color intensity.

[0044] (mean ± standard deviation)

[0045]

[0046] Note: Different lowercase letters in the same column at the same locus indicate significant differences in the L* value of flesh color brightness between different genotypes. P<0.05), the absence of a letter indicates that the difference in flesh color brightness L* values ​​between different genotypes is not significant ( P >0.05).

[0047] Example 2: Molecular marker-assisted breeding of black muscle color in Silkie chickens

[0048] By using molecular marker-assisted breeding based on genes related to the blackness of Silkie chicken muscle, the L* value of muscle brightness in strain B of Silkie chicken breeding lines was selected to improve the blackness of the breeder chicken muscle.

[0049] At 4 weeks of age, genotyping was performed on chickens in the Silkie B strain, retaining individuals with the dominant genotype showing higher muscle black coloration. The specific protocol is as follows:

[0050] (1) At 4 weeks of age, blood was collected from the wing veins of 800 Silkie chickens (half male and half female) using disposable syringes. DNA was extracted using the phenol-chloroform method, and total genomic DNA of the chickens to be selected for breeding was extracted. Related genes were designed and synthesized. MLANA The primers for (rs315623285) are shown in Table 4.

[0051] Table 4 Primer sequence related information

[0052]

[0053] (2) PCR amplification, electrophoresis and sequencing genotyping: PCR amplification products were analyzed by 1.5% agarose gel electrophoresis and sequenced for genotyping. Genotyping was performed on male and female Silkie chickens, and individuals with the dominant genotype of higher muscle black color were retained.

[0054] PCR total reaction volume 50 μL: DNA template 4 μL, dNTP (2 mmol / L) 2 μL, Mg 2+ (3 mmol·L) -1 0.6 μL, 5 μL of 1×PCR reaction buffer, and upstream and downstream primers (10 μmol·L⁻¹) -1 1 μL each of Taq polymerase (1 U·μL) -1 Add 2.5 μL of ultrapure water to a final volume of 50 μL.

[0055] PCR reaction procedure: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 5 min. The PCR amplified target fragment was detected by 1.5% agarose gel electrophoresis.

[0056] The PCR products were sent to a biotechnology company for sequencing. The resulting sequences were compared with the chicken reference genome to identify polymorphic sites. The nucleotide sequences of the SNP site PCR products are shown below:

[0057] MLANA -rs315623285 (mutation site T / C), PCR product: 215 bp.

[0058] TGGTTCTGGACAGGGATAGGATCTCAAAATGCCCAGAAGAAGCCACTAK(T / C)GAAGATGGAAACTTCTTTAGAGGAAAAGGACGCACCTATTTCACAGCAGAAGAGTAAGCATAAAGCAAAACCTATTTTAGCATGTATGTAGAAAAAAACTTAGACTGAAAAGGAAATTCACAGAGTAGTACAAAAATAAAAATAAAAATCAGGGCCGTACAAAGAA.

[0059] Note: K marked in the sequence is the mutation site, and the mutated base in parentheses is the allele mutation.

[0060] (3) Method for determining muscle brightness L* value at 10 weeks of age: After slaughtering live chickens, cut 4cm of skin on the thigh and chest. 2 (2cm x 2cm) Thigh and chest muscles were exposed, and the L* values ​​of the thigh and chest muscles were measured using a TC.PIIG fully automatic colorimeter. All flesh color measurements were taken by the same person, and the measured areas were basically consistent.

[0061] (4) Molecular marker-assisted breeding of black-boned chicken muscle blackness

[0062] The CT genotype at the SNP (rs315623285) locus is the dominant genotype for the brightness L* value of thigh meat. By selecting individuals with the dominant CT genotype and eliminating individuals with other genotypes, the breeding process can be used to help improve the dark color of thigh muscles.

[0063] Molecular marker-assisted breeding was used to improve the dark color of the thigh meat in the 6th and 7th generations of Silkie chicken strain B. This method is simple to implement and can more quickly improve the dark color of the thigh muscle. As shown in Table 5, after two generations of molecular marker-assisted breeding, the L* value of the thigh meat in both male and female chickens decreased by an average of about 2 compared to the previous generation in the 6th and 7th generations, and by an average of about 1 per generation compared to the L* values ​​in the 3rd to 5th generations. The significant reduction in L* value and the significant improvement in the dark color of the thigh muscle accelerated the breeding process. After two generations of molecular marker-assisted breeding, the L* value of the breast muscle also decreased accordingly, and the dark color also improved.

[0064] Table 5. Results of L* value determination of thigh muscle brightness in different generations of Silkie chicken strain B

[0065]

[0066] Age determined: 70 days

[0067] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0068] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0069] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A detection method MLANA The application of a reagent for SNP genotyping in assisted breeding of dark brown color in the thigh muscle of 10-week-old Silkie chickens, characterized by: The SNP is numbered rs315623285, and the chickens to be selected with the CT dominant genotype are individuals with a higher degree of dark coloration in the thigh muscles.

2. The application according to claim 1, characterized in that, The method for assisted breeding of black thigh muscle color in 10-week-old Silkie chickens includes the following steps: (1) Extract total genomic DNA from the chickens to be bred; (2) The target sequence was amplified by PCR using the following primer pair: F: 5' TGGTTCTGGACAGGGATAGG 3' R: 5'TTCTTTGTACGGCCCTGATT 3'; (3) Sequencing the PCR amplification products to determine the genotype of the SNP described in claim 1; (4) Based on the genotype results, individuals with the dominant genotype CT with higher dark coloration of the thigh muscles were selected.

3. The application according to claim 2, characterized in that, In step (3), the nucleotide sequence of the PCR amplification product is shown in SEQ ID No.1 or SEQ ID No.2, and the length of the PCR product is 215bp.

Citation Information

Patent Citations

  • Application of EDNRB2 gene SNP (Single Nucleotide Polymorphism) molecular marker in black-bone chicken molecular assisted breeding

    CN117004740A