A wheat Fusarium head blight resistance site and molecular breeding method
Five Fusarium head blight resistance loci were identified through genome-wide association analysis and KASP molecular marker screening, establishing a molecular design breeding system. This solved the problem of low breeding efficiency in existing technologies, enabling efficient screening of disease-resistant wheat materials and improving breeding effectiveness and environmentally friendly control methods.
Patent Information
- Application Number
- CN202510139623.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-08
- Publication Date
- 2026-05-26
- Estimated Expiration
- 2045-02-08
Smart Images

Figure CN120193110B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of wheat breeding, specifically relating to a wheat scab resistance locus and molecular breeding method. Background Technology
[0002] Fusarium head blight (FHB) is a global wheat spike disease caused by Fusarium spp., resulting not only in yield loss but also in the serious health risks posed by its fungal toxins. With global warming and changes in farming practices, the frequency of large-scale FHB outbreaks is increasing. Changing farming practices and cultivation techniques is insufficient to control the infection and spread of FHB. While chemical control has achieved some success in controlling large-scale outbreaks and pandemics, it inevitably leads to increased costs and environmental pollution. Therefore, developing resistant varieties has become the primary way to mitigate the damage caused by FHB.
[0003] Extensive research has been conducted both domestically and internationally on the genetics of resistance to Fusarium head blight (FHB). Multiple resistance QTLs have been discovered, nine resistance genes have been named, and the Fhb1 and Fhb7 loci have been successfully cloned. Fhb1 is currently recognized as the most stable and potent resistance locus, and it has been the most widely and successfully used in wheat resistance breeding (Zhang X, Rouse MN, Nava IC, Yue J, Anderson JA. 2016. Development and Verification of Wheat Germplasm Containing Both Sr2 and Fhb1. Molecular Breeding, 36, 85; Zhang Hongjun, Su Zhenqi, Bai Guihua, Zhang Xu, Ma Hongxiang, Li Teng, Deng Yun, Mai Chunyan, Yu Liqiang, Liu Hongwei, Yang Li, Li Hongjie, Zhou Yang. 2018. Using fhb1 gene functional markers to improve the resistance of wheat varieties to FHB in the Huang-Huai winter wheat region. Acta Agronomica Sinica, 44, 505-511). The wheat-thinopyrum ponticum Fhb7 substitution line has been used by several breeding units both domestically and internationally. By introducing Fhb7 into different wheat varieties through molecular marker selection, the offspring lines showed significantly improved resistance to Fusarium head blight (Li X, Li D, Xuan Y, He Z, Zhao L, Hao Y, Ge W, Xu S, Hou B, Wang B, Guo J, Liu W, Li M, Har Y, Bo C, Bao Y, Qi Z, Xu SS, Bai G, Wang H, Kong L. 2023. Elimination of the Yellow Pigment Gene Psy-E2 Tightly Linked to the Fusarium Head Blight Resistance Gene Fhb7 from Thinopyrum ponticum. The Crop Journal, 11, 957-962; Li Zhengling, Zhang Yu, Han Liupeng, Wang Yongxia, Fang Yuhui, Hu Lin, Xu Weigang. 2022. Optimization of wheat scab resistance breeding technology system in southern Huang-Huai wheat region. Henan Agricultural Sciences, 51, 28-36. Fusarium head blight resistance is a quantitative trait regulated by multiple genes. Although some progress has been made in selection based on single markers, the application of single genes is not conducive to coping with the complex diseases and the impact of climate change. Molecular marker-assisted selection to aggregate different Fusarium head blight resistance genes is an effective way to breed varieties with durable and stable resistance.
[0004] The wheat-growing region in the middle and lower reaches of the Yangtze River was one of the earliest areas to conduct breeding for resistance to Fusarium head blight. Representative varieties such as Ningmai, Yangmai, and Zhenmai all exhibit good resistance to Fusarium head blight and carry multiple resistance loci, such as Fhb1, QFhb.yas-2DL, and QFhb-5A. Further exploration of these resistance loci in the varieties from this region, along with effect evaluation, and the establishment of a molecular breeding system integrating multiple loci for Fusarium head blight resistance, are of great significance for wheat breeding for resistance to Fusarium head blight. Summary of the Invention
[0005] The purpose of this invention is to provide a wheat resistance locus and molecular breeding method, which can efficiently screen out new wheat materials carrying multiple resistance loci and excellent agronomic traits, significantly improving breeding efficiency and the selection effect of disease-resistant varieties, and providing new ideas and approaches for the prevention and control of wheat diseases.
[0006] The objective of this invention is achieved through the following technical solution:
[0007] This invention provides a wheat resistance locus against Fusarium head blight, comprising five loci, as shown in the table below:
[0008]
[0009] The present invention also provides primers and probes for the wheat resistance site against Fusarium head blight, wherein primers F1 and F2 of Qfhb.jaas-2D are shown in SEQ ID NO.1-2, and probe R is shown in SEQ ID NO.3;
[0010] The primers F1 and F2 of Qfhb.jaas-3A are shown in SEQ ID NO.4-5, and the probe R is shown in SEQ ID NO.6;
[0011] Primers F1 and F2 of Qfhb.jaas-3B.1 are shown in SEQ ID NO.7-8, and probe R is shown in SEQ ID NO.9;
[0012] Primers F1 and F2 of Qfhb.jaas-5A.2 are shown in SEQ ID NO.10-11, and probe R is shown in SEQ ID NO.12;
[0013] The primers F1 and F2 of Qfhb.jaas-6D are shown in SEQ ID NO.13-14, and the probe R is shown in SEQ ID NO.15.
[0014] Furthermore, primer F1 is further modified with a specific sequence GAAGGTGACCAAGTTCATGCT that can bind to FAM fluorescence, and primer F2 is further modified with a specific sequence GAAGGTCGGAGTCAACGGATT that can bind to HEX fluorescence.
[0015] The present invention also provides a molecular breeding method, which includes the step of screening using the wheat Fusarium head blight resistance loci or the primers and probes described above.
[0016] Furthermore, the specific steps include:
[0017] (1) Using wheat materials carrying the aforementioned wheat resistance loci as parents, hybridize them with the materials to be improved;
[0018] (2) After hybridization as described in step (1), F1 generation seeds are mixed and harvested, F2 generation seeds are sown and planted in a single plot with a population size of more than 300. Seedling DNA is extracted, and genotyping is performed using molecular markers of wheat resistance to Fusarium head blight loci. Individual plants with homozygous resistance genotypes and superior agronomic traits are selected for harvesting. F3 generation is planted in 3-row plots, and individual plants with superior agronomic traits are selected for harvesting. F4 generation is planted in 3-row plots again, and plots with superior agronomic traits are selected for harvesting.
[0019] (3) The F5 generation was used to identify resistance to Fusarium head blight using the single-flower drip method, and the dominant offspring were entered into the yield evaluation garden.
[0020] Furthermore, in step (1), if the material to be improved is wheat material from other ecological areas outside the wheat-growing areas of the middle and lower reaches of the Yangtze River, it can be backcrossed with the material to be improved again.
[0021] Beneficial effects:
[0022] This invention identified five stable Fusarium head blight (FHB) resistance loci on chromosomes 2A, 2D, 3A, 5A, and 6D using genome-wide association analysis (GWAS) with the GAPIT software package and the BLINK method. The discovery of these loci provides important genetic resources for breeding wheat HBHB resistance. For the identified resistance loci, this invention designed KASP molecular markers. These markers have high specificity and sensitivity, enabling accurate and rapid detection of resistance genotypes in wheat materials, providing a powerful tool for marker-assisted selection (MAS). The effectiveness of the screened resistance loci was verified through genotyping and resistance identification in large-scale breeding materials. The results showed that five loci—Qfhb.jaas-2D, Qfhb.jaas-3A, Qfhb.jaas-3B.1, Qfhb.jaas-5A.2, and Qfhbjaas-6D—were significantly associated with HBHB resistance, providing a reliable basis for breeding resistant varieties.
[0023] This invention is the first to apply identified disease resistance loci to molecular design breeding of wheat scab resistance, establishing a complete molecular design breeding system. This system allows for the efficient screening of new wheat materials carrying multiple disease resistance loci and exhibiting excellent agronomic traits, significantly improving breeding efficiency and the speed of selecting disease-resistant varieties. Materials screened using the molecular design breeding method provided by this invention show significantly better scab resistance than materials screened using conventional breeding methods. This indicates that this invention not only improves wheat's resistance to scab but also provides new ideas and approaches for wheat disease control. Attached Figure Description
[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0025] Figure 1 This is an association analysis diagram of relevant sites in Embodiment 1 of the present invention;
[0026] Figure 2 This is a correlation diagram between relevant sites and Fusarium head blight resistance in Example 2 of the present invention;
[0027] Figure 3 This is a flowchart of the molecular design breeding process for wheat resistance to Fusarium head blight in Example 3 of the present invention;
[0028] Figure 4 This is a comparison chart showing the selection effect of the molecular design breeding method for wheat resistance to Fusarium head blight in Example 3 of the present invention with that of conventional breeding methods. Detailed Implementation
[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0030] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0031] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0032] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0033] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0034] Unless otherwise specified, all chemical reagents, biochemical reagents and materials used in this invention are commercially available.
[0035] Example 1: Discovery of disease resistance sites
[0036] 103 wheat varieties approved in the middle and lower reaches of the Yangtze River wheat-growing region between 1972 and 2016 were used as materials. The materials were planted in two environments—the Jiangsu Academy of Agricultural Sciences' internal experimental base and the Liuhe base—for two consecutive growing seasons (2017-2018 and 2018-2019). These environments were designated as E1, E2, E3, and E4, respectively. Single-row plots were used with 60 seeds per row, a row length of 1.6 m, and a row spacing of 0.25 m. The plants were replicated twice and managed using conventional cultivation methods. Fusarium head blight resistance was assessed using a single-flower drip method. At the initial flowering stage, each line was inoculated with 10 ears, and each ear was inoculated with 10 μL of Fusarium head blight spore solution at a spore concentration of 1 × 10⁻⁶. 6 mL -1 After bagging and moisturizing for 72 hours, the plants continued to grow under misting and moisturizing conditions. The number of diseased spikelets and the total number of spikelets were investigated 21 days after inoculation, and the diseased spikelet rate was calculated as an indicator for evaluating resistance to Fusarium head blight.
[0037] Genomic DNA was extracted using the CTAB method (Porebski S, Bailey L, Baum B (1997) Modification of CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Molecular Biology Reporter 15: 8-15). Genotypes were obtained using an Affymetrix 50K gene chip (Beijing Bio-Tech Co., Ltd., Beijing). Quality control of the genotype data was performed using TASSEL V5.2.13 software, deleting marker sites with a minimum gene frequency ≤5% and a deletion rate exceeding 10%.
[0038] Association analysis was conducted using the GAPIT software package in R (Lipka A, Tian F, Wang Q, Peiffer J, Li M, Bradbury p, Gore M, Buckler E, Zhang Z (2012) GAPIT: Genome Association and Prediction Integrated Tool. Bioinformatics 28: 2397-2399). The BLINK (Bayesian-information and linkage-disequilibrium iteratively nested keyway) method was selected (Huang M, Liu X, Yao Z, Summers R, Zhang Z (2018) BLINK: A package for the next level of genome-wide association studies with both individuals and markers in the millions. GigaScience 8). Principal components were used as covariates to reduce the false positive rate, and the screening threshold was set to 1×10⁻⁶. -3 Five stable associated loci were identified on chromosomes 2A, 2D, 3A, 5A, and 6D. Figure 1 (and Table 1).
[0039] Table 1. Association analysis results of relevant sites
[0040]
[0041] Example 2
[0042] Disease resistance loci Qfhb-2A, Qfhb-2D, Qfhb-3B.1, QFhb-3B.2, Qfhb-5A, and Qfhb-6D were collected from the important parent wheat varieties Ningmai 9 and Yangmai 158 in the middle and lower reaches of the Yangtze River. Among them, Qfhb-2D and Qfhb-6D overlap with the loci on chromosome 2D and 6D in Example 1, and the disease resistance locus Qfhb-3B.1 overlaps with the major-effect locus Fhb1. After sorting and renaming according to chromosome position, a total of 9 candidate loci were obtained, as shown in Table 2.
[0043] Table 2. Detailed information on relevant loci
[0044]
[0045]
[0046] KASP molecular markers were developed by designing PCR amplification primers based on SNP sites and flanking sequences. For each marker, two SNP-specific primers (F1 / F2) and one universal primer (R) were designed. The F1 primer was tailed with a specific sequence GAAGGTGACCAAGTTCATGCT that binds to FAM fluorescence, and the F2 primer was tailed with a specific sequence GAAGGTCGGAGTCAACGGATT that binds to HEX fluorescence (Table 3). KASP primers were designed using Polymarker (http: / / www.polymarker.info / ) and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer sequences of Qfhb.jaas-3B.1 and Qfhb.jaas-5A.2 were derived from reported literature (Su Z, Jin S, Zhang D, BaiG. Development and validation of diagnostic markers for Fhb1 region, a majorQTL fbr Fusarium head blight resistance in wheat. Theoretical and AppliedGenetics, 2018, 131: 2371-2380; Jiang P, Zhang X, Wu L, He Y, Zhuang W, Cheng X, Ge W, Ma H, Kong LA novel QTL on chromosome 5AL of Yangmai 158 increases resistance to Fusarium head blight in wheat. Plant Pathology, 2020, 69: 249-258).
[0047] Table 3. KASP primers corresponding to relevant sites.
[0048]
[0049]
[0050] The total KASP reaction volume was 5 μL, containing 2.5 μL of 2×KASP Master Mix, 0.07 μL of KASPassay Mix (primer mixing working solution), and 20 ng / μL of [unclear - possibly a specific reagent or solution]. -12.43 μL of template DNA was used. The KASP reaction program was as follows: Step 1: 94℃, 15 min; Step 2: 94℃, 20 s, 61–55℃, 1 min, decreasing the temperature by 0.6℃ per cycle, for a total of 10 cycles; Step 3: 94℃, 20 s, 55℃, 1 min, for a total of 26 cycles. PCR was performed using a Hydrocycler PCR machine purchased from LGC. 16 The PCR was performed in a water bath PCR instrument. The PCR results were analyzed using a KASP fluorescence analyzer (LGC Pherastar plus model).
[0051] Genotypic analysis was performed on 611 F6 generation breeding materials using KASP primers at 9 loci. Simultaneously, disease resistance was assessed during the 2021-2022 growing season using the Fusarium head blight identification method described in Example 1. The correlation between these 9 loci and Fusarium head blight resistance was analyzed using a single-marker model with IciMapping V4.1 software. Five loci, Qfhb.jaas-2D, Qfhb.jaas-3A, Qfhb.jaas-3B.1, Qfhb.jaas-5A.2, and Qfhb.jaas-6D, were significantly correlated with Fusarium head blight resistance. Figure 2 ).
[0052] Example 3
[0053] Molecular design breeding of wheat scab resistance was carried out using the five disease resistance loci screened in Example 2, as follows: Figure 3 As shown:
[0054] 1. Use wheat materials carrying 5 disease resistance loci as parents to cross with the material to be improved. If the material to be improved is a wheat material from other ecological areas outside the wheat-growing areas of the middle and lower reaches of the Yangtze River, it can be backcrossed with the material to be improved.
[0055] 2. F1 generation seeds were mixed and harvested, F2 generation seeds were sown and planted in groups of more than 300. Seedling DNA was extracted and genotyping was performed using molecular markers for resistance to Fusarium head blight loci. Individual plants with homozygous disease-resistant genotypes at all 5 loci and superior agronomic traits were selected for harvesting. F3 generation plants were planted in plots of 3 rows, and individual plants with superior agronomic traits were selected for harvesting. F4 generation plants were planted in plots of 3 rows, and plants with superior agronomic traits were selected for plot harvesting.
[0056] 3. The F5 generation was used to identify Fusarium head blight resistance using the single-flower drip method, and the dominant progeny were then placed in the yield evaluation nursery.
[0057] Materials screened using this molecular design breeding method exhibit significantly better resistance to Fusarium head blight than those screened using conventional breeding methods (specifically, for example...). Figure 4 (As shown).
[0058] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A primer for detecting wheat resistance sites against Fusarium head blight, characterized in that, The wheat resistance sites against Fusarium head blight are shown in the table below: ; The Qfhb.jaas-2D Primers F1 and F2 are shown in SEQ ID NO.1-2, and primer R is shown in SEQ ID NO.3; The Qfhb.jaas-3A Primers F1 and F2 are shown in SEQ ID NO.4-5, and primer R is shown in SEQ ID NO.6; The Qfhb.jaas-3B.1 Primers F1 and F2 are shown in SEQ ID NO.7-8, and primer R is shown in SEQ ID NO.9; The Qfhb.jaas-5A.2 Primers F1 and F2 are shown in SEQ ID NO. 10-11, and primer R is shown in SEQ ID NO. 12; and the... Qfhb.jaas-6D Primers F1 and F2 are shown in SEQ ID NO.13-14, and primer R is shown in SEQ ID NO.
15.
2. A molecular breeding method, characterized in that, The molecular breeding method includes the step of screening using the primers described in claim 1; The molecular breeding method described above is used to breed wheat for resistance to Fusarium head blight.
3. The molecular breeding method as described in claim 2, characterized in that, Specifically, the following steps are included: (1) Using wheat materials carrying the wheat resistance site described in claim 1 as parents, hybridize with the material to be improved; (2) After hybridization in step (1), the F1 generation seeds are mixed and harvested, and the F2 generation is planted by spot sowing. The population size is more than 300. The seedling DNA is extracted, and the genotype is detected using primers for the wheat resistance to Fusarium head blight loci. Individual plants with homozygous resistance genotypes and excellent agronomic traits are selected for harvesting. The F3 generation is planted in 3-row plots, and individual plants with excellent agronomic traits are selected for harvesting. The F4 generation is planted in 3-row plots again, and plots with relatively good agronomic traits are selected for harvesting. (3) The F5 generation was used to identify resistance to Fusarium head blight using the single-flower drip method, and the dominant offspring were entered into the yield evaluation garden.
4. The molecular breeding method as described in claim 3, characterized in that, In step (1), if the material to be improved is wheat material from other ecological areas outside the wheat-growing areas of the middle and lower reaches of the Yangtze River, it is backcrossed with the material to be improved again.
Citation Information
Patent Citations
Rapid and efficient wheat gibberellic disease-resistant molecular design breeding method
CN114277175A
KASP primer group for wheat scab resistance detection and application of KASP primer group
CN118064633A