Feed additive for reducing carcass fat of fattening bulls as well as preparation method and application of feed additive

Abstract

The invention belongs to the technical field of feed additives, and particularly relates to a feed additive for reducing carcass fat of fattening bulls as well as a preparation method and application of the feed additive. The feed additive for reducing the carcass fat of the fattening bulls is prepared from the following raw materials in parts by weight: 10 to 35 parts of coated polysaccharide cinnamyl aldehyde, 2 to 5 parts of recombinant alphas2-casein, 0.5 to 2 parts of glaucocalyxin B, 1 to 15 parts of creatine phosphate, 5 to 25 parts of guanidinoacetic acid, 5 to 25 parts of methionine, 5 to 25 parts of vitamin B1 and 15 to 60 parts of wheat bran. Wherein the mass fraction of the polysaccharide cinnamyl aldehyde in the coated polysaccharide cinnamyl aldehyde is 45-50%; the amino acid sequence of the recombinant alpha s2-casein is as shown in SEQ ID NO. 1. When the feed additive is added into the feed, the cattle body weight can be obviously increased, the cattle carcass fat deposition and the feed-gain ratio are reduced, the fattening feed conversion efficiency is improved, and the feed additive has important significance in improving the economic value of the fattening cattle.

Description

Technical Field

[0001] The present invention belongs to the technical field of feed additives, and particularly relates to a feed additive for reducing carcass fat of fattening bulls, a preparation method thereof, and an application thereof. Background Art

[0002] During the fattening and feeding process of beef cattle, high-concentrate diets are often used to obtain higher daily weight gains and slaughter weights, but this also leads to excessive carcass fat deposition and the occurrence of rumen acidosis. The carcass fat of fattening cattle is first deposited in the internal organs and under the skin, and the economic value of the fat in these two parts is extremely low, directly affecting the economic benefits of slaughterhouses and fattening farms. Abroad, hormonal additives such as clenbuterol hydrochloride, ractopamine, and salbutamol, commonly known as "lean meat powder" in China, are added to the diet, or estrogen capsules are embedded behind the ear to achieve the purpose of rapid weight gain and reduced carcass fat in beef cattle. However, the use of "lean meat powder" and feed containing "lean meat powder" is currently prohibited, and the use of hormonal drugs or hormonal additives is strictly prohibited during the fattening process of beef cattle. Therefore, new additives need to be developed to improve the economic value of beef cattle.

[0003] Creatine is an important substance for synthesizing muscle proteins, but pure plant diets do not contain creatine, and animals need to synthesize creatine themselves to meet the growth needs. Guanidinoacetic acid (GAA) is the only precursor for synthesizing creatine, and creatine is synthesized in the liver with the participation of methyl donors and methyltransferases. However, studies have found that when the GAA addition amount reaches 0.08%, the synthesized creatine content will gradually decrease with the increase in the addition amount. Therefore, relying on GAA to improve the creatine synthesis ability of beef cattle has certain limitations. Due to the poor stability of creatine, it is not suitable to be directly added to the feed. Digestive diseases such as rumen acidosis are prone to occur during the fattening process of beef cattle, affecting feed nutrition digestion and metabolism.

[0004] α-Casein is one of the main proteins in mammalian growth and development. The amino acid composition of α-casein is similar to the amino acid ratio required in animals, which means it is easily absorbed and utilized by animals. α-Casein has two different subtypes, namely αs1-casein and αs2-casein. In recent years, studies have shown that αs1-casein may produce β-casomorphin-7 (BCM-7) during digestion, and this substance is associated with various health problems such as abdominal distension, abdominal pain, and diarrhea. Therefore, more and more people are starting to pay attention to αs2-casein in milk. For fattening cattle, choosing αs2-casein means higher feed conversion rates and faster weight gain.

[0005] In summary, developing a feed additive for fattening cattle, improving the rumen health of fattening cattle, increasing feed conversion efficiency and weight gain levels, and reducing carcass fat deposition in fattening cattle are of great significance for improving the production efficiency and breeding economic benefits of fattening cattle. Summary of the Invention

[0006] In order to overcome the deficiencies of the prior art, the primary object of the present invention is to provide a feed additive for reducing the carcass fat of fattening bulls. This feed additive can improve the feed conversion efficiency and weight gain level of fattening cattle, and at the same time reduce the deposition of carcass fat.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] A feed additive for reducing the carcass fat of fattening bulls, the feed additive for reducing the carcass fat of fattening bulls comprises the following raw materials in parts by weight: coated polysaccharide cinnamaldehyde 10 - 35 parts, recombinant αs2-casein 2 - 5 parts, glaucocalyxin B 0.5 - 2 parts, creatine phosphate 1 - 15 parts, guanidinoacetic acid 5 - 25 parts, methionine 5 - 25 parts, vitamin B1 5 - 25 parts, wheat bran 15 - 60 parts; wherein, the mass fraction of polysaccharide cinnamaldehyde in the coated polysaccharide cinnamaldehyde is 45 - 50%; the amino acid sequence of the recombinant αs2-casein is as shown in SEQ ID NO.1.

[0009] Furthermore, the nucleotide sequence encoding the recombinant αs2-casein is as shown in SEQ ID NO.2.

[0010] Furthermore, the specific preparation process of the recombinant αs2-casein is as follows:

[0011] (1) Based on the amino acid sequence of bovine full-length αs2-casein, functional fragments were truncated and designed to obtain the amino acid sequence of recombinant αs2-casein as shown in SEQ ID NO.1;

[0012] (2) According to the amino acid sequence SEQ ID NO.1 of the recombinant αs2-casein, the gene sequence was designed in reverse and codon optimization was carried out to obtain the nucleotide sequence SEQ ID NO.2 encoding the recombinant αs2-casein;

[0013] (3) The nucleotide sequence encoding the recombinant αs2-casein was ligated with the vector pET28a to obtain a recombinant plasmid;

[0014] (4) The recombinant plasmid was transformed into the E.coli BL21(DE3) engineering bacteria, and the recombinant strain was named pET28a-αs2-casein / BL21;

[0015] (5) The recombinant strain constructed in step (4) was inoculated into an LB medium containing kanamycin and shaken overnight at 37°C, and IPTG was added to induce the expression of recombinant αs2-casein;

[0016] (6) The recombinant αs2-casein was purified by affinity chromatography.

[0017] Further, the kanamycin concentration in step (5) is 50 - 100 μg / mL.

[0018] Further, the induction expression concentration of IPTG in step (5) is 0.4 - 0.6 mmol / L, and the induction expression time of IPTG is 5 - 10 h.

[0019] Another object of the present invention is to provide a preparation method of a feed additive for reducing the carcass fat of fattening bulls.

[0020] The object of the present invention is achieved by the following technical solutions:

[0021] The above-mentioned preparation method of the feed additive for reducing the carcass fat of fattening bulls specifically includes: weighing coated polysaccharide cinnamaldehyde, recombinant αs2-casein, glaucocalyxin B, creatine phosphate, guanidinoacetic acid, methionine, vitamins, and wheat bran according to the above-mentioned weight parts, and stirring and mixing evenly to obtain.

[0022] The third object of the present invention is to provide an application of a feed additive for reducing the carcass fat of fattening bulls in the preparation of cattle feed.

[0023] The object of the present invention is achieved by the following technical solutions:

[0024] The above-mentioned application of the feed additive for reducing the carcass fat of fattening bulls in the preparation of cattle feed.

[0025] Further, based on the total weight of the diet, the dosage of the feed additive for reducing the carcass fat of fattening bulls is 0.45 - 1.2% of the diet weight.

[0026] The present invention has the following effects compared with the prior art: The present invention constructs and expresses a recombinant αs2-casein by gene recombination technology. Adding the feed additive for reducing the carcass fat of fattening bulls containing αs2-casein to the feed can significantly increase the body weight, reduce the carcass fat deposition and feed-to-weight ratio, improve the conversion efficiency of the fattening feed, and has good application prospects. Description of the Drawings

[0027] Figure 1 It is the expression diagram of the purified αs2-casein prepared by the present invention. Detailed Embodiments

[0028] The present invention will be further described in detail below in conjunction with embodiments, but the implementation manners of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field. The test methods without specific experimental conditions in the following embodiments are usually carried out according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the present invention can be obtained commercially.

[0029] The coated polysaccharide cinnamaldehyde used in Example 1 and Comparative Examples 1-5 was purchased from Beijing Zhonglian Huakang Technology Co., Ltd., and creatine phosphate was purchased from Beijing Zhonglian Huakang Technology Co., Ltd.

[0030] Example 1

[0031] A feed additive for reducing the carcass fat of fattening bulls, the feed additive for reducing the carcass fat of fattening bulls comprises the following raw materials in parts by weight: 23 parts of coated polysaccharide cinnamaldehyde, 4 parts of recombinant αs2-casein, 1.2 parts of glaucocalyxin B, 8 parts of creatine phosphate, 15 parts of guanidinoacetic acid, 15 parts of methionine, 15 parts of vitamin B1, 38 parts of wheat bran; wherein, the mass fraction of polysaccharide cinnamaldehyde in the coated polysaccharide cinnamaldehyde is 47%.

[0032] The preparation method of the recombinant αs2-casein specifically comprises the following steps.

[0033] (1) Based on the full-length bovine αs2-casein amino acid sequence, functional fragment truncation and design were carried out to obtain the amino acid sequence of recombinant αs2-casein as shown in SEQ ID NO.1;

[0034] (2) Reverse design the gene sequence according to the recombinant αs2-casein sequence SEQ ID NO.1, and optimize the corresponding base sequence according to the codon preference of Escherichia coli for expressing heterologous proteins to obtain the nucleotide sequence SEQ ID NO.2 encoding recombinant αs2-casein; design upstream and downstream primers for amplifying recombinant αs2-casein according to the optimized sequence, the upstream primer is CATATGAAACTGTTCATTTTTACTTGTCTGC, containing the Nde I restriction enzyme site CATATG, and the downstream primer is CTCGAGCGGTTTCATCGGTTTTTGGTGCTGA, containing the Xho I restriction enzyme site CTCGAG. The gene was amplified by PCR method, and the target fragment was purified by a gel recovery kit.

[0035] Table 1 Sequence Listing

[0036]

[0037] (3) The plasmid pET28a was digested with restriction endonucleases Nde I and Xho I, and the double digestion reaction system is shown in Table 2. The amplified and recovered recombinant αs2-casein gene fragment was ligated to the target fragment of the expression vector pET28a using T4 DNA ligase, and the T4 DNA ligase reaction system is shown in Table 3. The recombinant plasmid pET28a-αs2 casein was obtained through identification and sequencing.

[0038] Table 2 Double digestion reaction system

[0039] Reagent Dosage Plasmid pET28a 200 ng Nde I 0.5 μL Xho I 0.5 μL 10×FastDigest Green Buffer 1.0 μL <![CDATA[ddH2O]]> Make up to 10 μL

[0040] Table 3 T4 DNA ligase reaction system

[0041] Component Dosage <![CDATA[ddH2O]]> Make up to 10 μL 10×Ligase Buffer 1 μL αs2-casein gene fragment 2 μL Vector pET28a 3 μL T4 DNA Ligase 1 μL

[0042] (4) The recombinant plasmid constructed in step (3) was transformed into the engineering bacteria E. coli BL21(DE3). The recombinant bacteria were evenly spread on an LB culture dish containing 100 μg / mL kanamycin and incubated overnight in an inverted position in a 37°C incubator to obtain recombinant strains, named pET28a-αs2 casein / BL21;

[0043] (5) Positive monoclonal colonies were selected and inoculated into an LB culture medium containing 100 μg / mL kanamycin, cultured overnight with shaking at 37°C, and 0.5 mmol / L IPTG was added to induce the expression of recombinant αs2-casein.

[0044] (6) The recombinant αs2-casein was purified by affinity chromatography to obtain recombinant αs2-casein. The purified recombinant αs2-casein was detected by SDS-PAGE gel, and the results are as Figure 1 shown, where M represents protein Marker and band 1 represents the expression result of the purified recombinant αs2-casein.

[0045] This example also provides a preparation method of a feed additive for reducing the carcass fat of fattening bulls, specifically including the following steps: Weigh 23 parts of coated polysaccharide cinnamaldehyde, 4 parts of recombinant αs2-casein, 1.2 parts of glaucocalyxin B, 8 parts of creatine phosphate, 15 parts of guanidinoacetic acid, 15 parts of methionine, 15 parts of vitamin B1, and 38 parts of wheat bran according to the following weight parts; among them, the mass fraction of polysaccharide cinnamaldehyde in the coated polysaccharide cinnamaldehyde is 47%; stir and mix evenly to obtain.

[0046] Example 2

[0047] A feed additive for reducing the carcass fat of fattening bulls, wherein the feed additive for reducing the carcass fat of fattening bulls comprises the following raw materials in parts by weight: 10 parts of coated polysaccharide cinnamaldehyde, 2 parts of recombinant αs2-casein, 0.5 part of glaucocalyxin B, 1 part of creatine phosphate, 5 parts of guanidinoacetic acid, 5 parts of methionine, 5 parts of vitamin B1, and 15 parts of wheat bran; wherein, the mass fraction of polysaccharide cinnamaldehyde in the coated polysaccharide cinnamaldehyde is 45%.

[0048] The preparation method of the recombinant αs2-casein is the same as that in Example 1;

[0049] This example also provides a preparation method of a feed additive for reducing the carcass fat of fattening bulls, which specifically includes the following steps: Weigh 10 parts of coated polysaccharide cinnamaldehyde, 2 parts of recombinant αs2-casein, 0.5 part of glaucocalyxin B, 1 part of creatine phosphate, 5 parts of guanidinoacetic acid, 5 parts of methionine, 5 parts of vitamin B1, and 15 parts of wheat bran according to the following parts by weight; wherein, the mass fraction of polysaccharide cinnamaldehyde in the coated polysaccharide cinnamaldehyde is 45%; Stir and mix evenly to obtain.

[0050] Example 3

[0051] A feed additive for reducing the carcass fat of fattening bulls, wherein the feed additive for reducing the carcass fat of fattening bulls comprises the following raw materials in parts by weight: 35 parts of coated polysaccharide cinnamaldehyde, 5 parts of recombinant αs2-casein, 2 parts of glaucocalyxin B, 15 parts of creatine phosphate, 25 parts of guanidinoacetic acid, 25 parts of methionine, 25 parts of vitamin B1, and 60 parts of wheat bran; wherein, the mass fraction of polysaccharide cinnamaldehyde in the coated polysaccharide cinnamaldehyde is 50%.

[0052] The preparation method of the recombinant αs2-casein is the same as that in Example 1;

[0053] This example also provides a preparation method of a feed additive for reducing the carcass fat of fattening bulls, which specifically includes the following steps: Weigh 35 parts of coated polysaccharide cinnamaldehyde, 5 parts of recombinant αs2-casein, 2 parts of glaucocalyxin B, 15 parts of creatine phosphate, 25 parts of guanidinoacetic acid, 25 parts of methionine, 25 parts of vitamin B1, and 60 parts of wheat bran according to the following parts by weight; wherein, the mass fraction of polysaccharide cinnamaldehyde in the coated polysaccharide cinnamaldehyde is 50%; Stir and mix evenly to obtain.

[0054] Comparative Example 1

[0055] Comparative Example 1 provides a feed additive for reducing the carcass fat of fattening bulls. The difference from Example 1 is that the recombinant αs2-casein in the components of the feed additive for reducing the carcass fat of fattening bulls is replaced with commercially available αs2-casein, and the others are the same as those in Example 1.

[0056] Comparative Example 2

[0057] Comparative Example 2 provides a feed additive for reducing the carcass fat of fattening bulls. The difference from Example 1 is that eupatilin is omitted from the composition of the feed additive for reducing the carcass fat of fattening bulls, and the others are the same as in Example 1.

[0058] Comparative Example 3

[0059] Comparative Example 3 provides a feed additive for reducing the carcass fat of fattening bulls. The difference from Example 1 is that creatine phosphate is replaced by creatine phosphate ester in the composition of the feed additive for reducing the carcass fat of fattening bulls, and the others are the same as in Example 1.

[0060] Test Example 1

[0061] The following is the effect test of the feed additives for reducing the carcass fat of fattening bulls obtained in Examples 1-3 and Comparative Examples 1-3:

[0062] Select 105 Simmental bulls at 14 months old in the fattening farm of Ruite Animal Husbandry Co., Ltd. in Boli County, and divide them into a control group, an Example 1 group, an Example 2 group, an Example 3 group, a Comparative Example 1 group, a Comparative Example 2 group, and a Comparative Example 3 group. Example 1 group: Add the feed additive for reducing the carcass fat of fattening bulls prepared in Example 1 at 0.5% of the weight of the diet to the diet. The difference between the control group and the Example 1 group is that the feed additive for reducing the carcass fat of fattening bulls prepared in Example 1 is not added to the diet during the feeding process, and the others are the same as the Example 1 group; the other groups add the corresponding additives at 0.5% of the diet dosage to the diet, and the diet formula is shown in Table 4.

[0063] Feed continuously for 90 days, weigh, and calculate the average daily gain, average dry matter intake per head (kg / d), average feed-to-gain ratio (F / G), slaughter rate (%), kidney fat as a percentage of live weight (%), and reduction in kidney fat (%). The results are shown in Table 5. In the fattening and feeding production of Simmental cattle, the daily gain is an important indicator reflecting the fattening effect of Simmental cattle. The average dry matter intake per head refers to the sum of all components of the diet eaten by each cow converted into absolute dry matter; the average feed-to-gain ratio is the average dry matter intake per cow per day ÷ average daily gain, which is a key indicator for measuring the feed cost per kilogram of weight gain of beef cattle. The slaughter rate is carcass weight (excluding head, hooves, skin, internal organs, tail, genital organs) ÷ live weight × 100%; the percentage of kidney fat in live weight is the weight of fat around the kidneys ÷ live weight × 100%; the percentage reduction in kidney fat is (kidney fat in the test group - kidney fat in the control) / kidney fat in the control × 100%.

[0064] Table 4 Diet composition (dry matter basis, %) and nutritional level

[0065]

[0066] Table 5 Important indicators of the fattening effect of each group of cattle

[0067]

[0068]

[0069] The results are shown in Table 5, which are important indicators of the fattening effect of each group of cattle. As can be seen from the table, by adding the feed additives for reducing the carcass fat of fattening bulls prepared in Examples 1-3 to the diet, during the entire feeding period, compared with the control group, the total weight gain and average daily weight gain of Simmental fattening bulls in Examples 1-3 increased, the average feed-to-weight ratio decreased, and the kidney fat as a percentage of live weight and the reduction of kidney fat were significant. It shows that the feed additives for reducing the carcass fat of fattening bulls prepared in Examples 1-3 effectively increased the daily weight gain, reduced the deposition of kidney fat and the feed-to-weight ratio, improved the feed utilization efficiency, effectively promoted the growth and development ability of Simmental cattle, and were of great significance for improving the economic value of fattening cattle. There were no significant differences in the important indicators of the fattening effect of cattle in Example 1 group, Example 2 group and Example 3 group.

[0070] Compared with the Example 1 group, in the Comparative Example 1 group, the recombinant αs2-casein in the feed additive component for reducing the carcass fat of fattening bulls was replaced with commercially available αs2-casein. The total weight gain and average daily weight gain of Simmental fattening bulls decreased, the average feed-to-weight ratio increased, and the kidney fat as a percentage of live weight increased. It shows that compared with the commercially available αs2-casein, the recombinant αs2-casein of the present invention can effectively promote the growth and development ability of Simmental cattle.

[0071] Compared with the Example 1 group, in the Comparative Example 2 group, eupatilin was omitted from the feed additive component for reducing the carcass fat of fattening bulls. The total weight gain and average daily weight gain of Simmental fattening bulls decreased, the average feed-to-weight ratio increased, and the kidney fat as a percentage of live weight increased. It shows that using eupatilin as a feed additive for reducing the carcass fat of fattening bulls helps to improve the overall quality of the feed and further promote the growth and development ability of Simmental cattle.

[0072] Compared with the Example 1 group, in the Comparative Example 3 group, creatine phosphate ester in the feed additive component for reducing the carcass fat of fattening bulls was replaced with creatine phosphate. The total weight gain and average daily weight gain of Simmental fattening bulls decreased, the average feed-to-weight ratio increased, and the kidney fat as a percentage of live weight increased. It may be because creatine phosphate has problems such as instability when used as a feed additive component, and creatine phosphate ester can solve this problem, which helps to improve the overall quality of the feed and further promote the growth and development ability of Simmental cattle.

[0073] In summary, the feed additive for reducing carcass fat of fattening bulls prepared in this embodiment can be added to cattle feed, which can significantly increase body weight, reduce carcass fat deposition and feed-to-weight ratio, improve the conversion efficiency of fattening feed, and has good application prospects.

[0074] The above embodiments are only preferred embodiments of the present invention, and the scope of protection of the present invention cannot be limited thereby. Any non-substantive changes and substitutions made by those skilled in the art based on the present invention fall within the scope of protection required by the present invention.

Claims

1. A feed additive for reducing carcass fat in fattening bulls, characterized in that, The feed additive for reducing carcass fat of fattening bulls comprises the following raw materials in parts by weight: 10-35 parts of coated polysaccharide cinnamaldehyde, 2-5 parts of recombinant αs2-casein, 0.5-2 parts of glaucocalyxin B, 1-15 parts of creatine phosphate, 5-25 parts of guanidinoacetic acid, 5-25 parts of methionine, 5-25 parts of vitamin B1, and 15-60 parts of wheat bran; wherein, the mass fraction of polysaccharide cinnamaldehyde in the coated polysaccharide cinnamaldehyde is 45-50%; the amino acid sequence of the recombinant αs2-casein is as shown in SEQ ID NO.

1.

2. The feed additive for reducing carcass fat of fattening bulls according to claim 1, characterized in that, The nucleotide sequence encoding the recombinant αs2-casein is as shown in SEQ ID NO.

2.

3. The feed additive for reducing carcass fat of finishing bulls according to claim 2, characterized in that, The specific preparation process of the recombinant αs2-casein is as follows: (1) Based on the full-length bovine αs2-casein amino acid sequence, functional fragment truncation and design are carried out to obtain the amino acid sequence of the recombinant αs2-casein as shown in SEQ ID NO.1; (2) According to the amino acid sequence SEQ ID NO.1 of the recombinant αs2-casein, the gene sequence is reversely designed and codon-optimized to obtain the nucleotide sequence SEQ ID NO.2 encoding the recombinant αs2-casein; (3) The nucleotide sequence encoding the recombinant αs2-casein is ligated with the vector pET28a to obtain a recombinant plasmid; (4) The recombinant plasmid is transformed into the E.coli BL21(DE3) engineering bacteria, and the recombinant strain is named pET28a-αs2-casein / BL21; (5) The recombinant strain constructed in step (4) is inoculated into the LB medium containing kanamycin and shaken overnight at 37°C, and IPTG is added to induce the expression of the recombinant αs2-casein; (6) The recombinant αs2-casein is purified by affinity chromatography.

4. The feed additive for reducing carcass fat of fattening bulls according to claim 3, characterized in that, The concentration of kanamycin in step (5) is 50-100 μg / mL.

5. The feed additive for reducing carcass fat of fattening bulls according to claim 3, characterized in that, The induction expression concentration of IPTG in step (5) is 0.4-0.6 mmol / L, and the induction expression time of IPTG is 5-10 h.

6. The preparation method of the feed additive for reducing carcass fat of finishing bulls according to any one of claims 1-5, characterized in that, The specific steps include: weighing the coated polysaccharide cinnamaldehyde, recombinant αs2-casein, glaucocalyxin B, creatine phosphate, guanidinoacetic acid, methionine, vitamin, and wheat bran according to the parts by weight described in claim 1, and stirring and mixing evenly to obtain the product.

7. Use of the feed additive for reducing carcass fat of fattening bulls according to any one of claims 1-5 in the preparation of cattle feed.

8. Use of the feed additive for reducing carcass fat of fattening bulls according to claim 7 in the preparation of cattle feed, characterized in that, Based on the total weight of the diet, the dosage of the feed additive for reducing carcass fat of fattening bulls is 0.45-1.2% of the diet weight.

Images