Application of talaromyces sp. DFHJ2 and fermentation product of talaromyces sp. DFHJ2 in strawberry growth promotion and pathogenic bacterium inhibition

Abstract

The invention discloses talaromyces sp. DFHJ2 and application of a fermentation product of the talaromyces sp. DFHJ2 in strawberry growth promotion and pathogenic bacterium inhibition, and relates to the technical field of microbiology. The talarospora scabra is preserved in the China General Microbiological Culture Collection Center on February 17, 2025, the preservation address is No.3, No.1 yard, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC No.41813. The talarospora scabra is named as talarospora scabra. According to the invention, a talaromyces scabra strain is separated from the root of 'Zhongjiang Junjun' strawberry, and the talaromyces scabra strain has a good antagonistic effect on strawberry anthracnose and other types of strawberry pathogenic bacteria which are seriously harmful in the current production, and can be used for efficiently preventing and treating strawberry anthracnose and other strawberry diseases. In addition, the strain is moderate in growth speed, large in sporulation quantity, easy to ferment and high in adaptability to the pH value of the environment, has a certain growth promoting effect on strawberry seedlings, and has the huge potential of being developed into an efficient biocontrol microbial agent.

Description

Technical Field

[0001] The invention relates to the technical field of microbiology, and in particular to application of a strain of Bacillaceae DFHJ2 and a fermentation product thereof in promoting strawberry growth and inhibiting pathogenic bacteria. Background Art

[0002] Strawberry is an important economic crop. At present, the strawberry planting area in my country is constantly expanding. Fungal diseases represented by strawberry anthracnose have caused great losses to strawberry production in these production areas. In recent years, with the increase in temperature and rainfall in the north, various diseases such as strawberry anthracnose have become increasingly serious in the main strawberry production areas in my country. The pathogens of strawberry anthracnose can survive in strawberry soil for a long time. Chemical pesticides are not very effective and can easily lead to increased drug resistance in pathogens. Their large-scale application also has adverse effects on biodiversity, human and animal health, and the safety of strawberry products. Therefore, the development of green, efficient, and pollution-free biological pesticides has become an important research direction for the prevention and control of diseases such as strawberry anthracnose.

[0003] Microorganisms and their metabolites effectively inhibit the growth of pathogens, thereby controlling the occurrence of diseases. Currently, there are many microbial agents used for the prevention and control of plant diseases. For diseases such as strawberry anthracnose, the microbial agents currently developed are mostly Bacillus.

[0004] At present, most commercial microbial agents have problems such as single source of strains, short effective period, high fermentation cost, insufficient concentration of active bacteria and unstable prevention effect. It is urgent to further explore the antagonistic microbial resources of strawberry and develop efficient and green microbial agents on this basis to effectively control the occurrence of strawberry diseases. Summary of the invention

[0005] The purpose of the present invention is to provide a strain of tularemia DFHJ2 and its fermentation product for use in promoting strawberry growth and inhibiting pathogens, so as to solve the problems existing in the above-mentioned prior art. The bacterium can effectively prevent and treat strawberry anthracnose and other strawberry diseases, and has a certain growth-promoting effect on strawberry seedlings, and has great potential for development as an efficient biocontrol microbial agent.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a strain of Talaromyces trachyspermus, which was deposited in the General Microbiology Center of China Microorganism Culture Collection Committee on February 17, 2025, with the deposit address being No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number being CGMCC No.41813.

[0008] The present invention also provides the use of the above-mentioned Talaromyces crassosporus or its fermentation product in the preparation of a microbial agent for preventing and controlling strawberry diseases and / or promoting the growth of strawberry plants.

[0009] Furthermore, the strawberry disease is strawberry anthracnose.

[0010] Furthermore, the pathogen of the strawberry anthracnose is Colletotrichum siamense.

[0011] The present invention also provides a microbial inoculant for preventing and controlling strawberry diseases and / or promoting the growth of strawberry plants, and the active ingredient comprises the above-mentioned Trichocladium asperum or its fermentation product.

[0012] The present invention also provides a preparation method of the above-mentioned microbial inoculant, which includes the steps of performing fermentation culture on the above-mentioned Trichocladium asperum, separating to obtain spores, and then resuspending the spores to obtain the microbial inoculant.

[0013] The present invention also provides the application of the above-mentioned Trichocladium asperum in the preparation of an antibacterial agent against Colletotrichum siamense.

[0014] The present invention also provides an antibacterial agent against Colletotrichum siamense, and the active ingredient comprises the fermentation broth of the above-mentioned Trichocladium asperum.

[0015] The present invention also provides the application of the above-mentioned Trichocladium asperum, microbial inoculant or antibacterial agent in the prevention and control of strawberry anthracnose.

[0016] The present invention also provides the application of the above-mentioned Trichocladium asperum or microbial inoculant in promoting the growth of strawberry plants.

[0017] The present invention also provides a method for preventing and controlling strawberry anthracnose, which includes the step of applying the above-mentioned microbial inoculant or antibacterial agent to strawberry plants.

[0018] The present invention discloses the following technical effects:

[0019] The present invention isolates a strain of Trichocladium asperum from the roots of "Zhongmei Huajun" strawberries. This strain shows good antagonistic effects against Colletotrichum siamense, which seriously endangers current production, and several other types of strawberry pathogens, and can effectively prevent and control strawberry anthracnose and other strawberry diseases. In addition, this strain has a moderate growth rate, a large spore production amount, is easy to ferment, has a strong adaptability to environmental pH, and has a certain growth-promoting effect on strawberry seedlings, and has great potential for developing into an efficient biocontrol microbial inoculant. Description of the Drawings

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0021] Figure 1 It is the result diagram of the confrontation experiment on the Petri dish of strain DFHJ2; among them, A is the result diagram of the confrontation on the Petri dish; B is the statistical chart of the colony diameter of the pathogenic bacterium;

[0022] Figure 2 It is the colony morphology diagram of strain DFHJ2; among them, A - D are respectively the front of the colony; the back of the colony; the hypha morphology; the spore morphology;

[0023] Figure 3 It is the phylogenetic tree diagram based on the ITS rDNA sequence;

[0024] Figure 4 It is the result diagram of the confrontation experiment on the Petri dish of strain DFHJ2 with various strawberry pathogenic bacteria; among them, 1 - 24 represent in sequence the pathogenic bacteria Colletotrichum siamense ZG2, Colletotrichum siamense ZG3, Colletotrichum siamense ZG4, Colletotrichum siamense ZG5, Colletotrichum siamense ZG6, Colletotrichum siamense ZG7, Fusarium oxysporum, Cladosporium cladosporioides, Talaromyces oumae - annae, Phytophthora nicotianae, Fusarium annulatum, Fusarium sp., Neopestalotiopsis clavispora X1, Fusarium proliferatum, Alternaria tenuissima, Nigrospora lacticolonia, Botrytis cinerea, Neopestalotiopsis clavispora X2, Alternaria alstroemeriae, Pilidium lythri, Pilidium sp, Pilidium concavum P1, Pilidium concavum P2 and Pilidium sp N1;

[0025] Figure 5 It is the test result diagram of various enzymes secreted by strain DFHJ2; among them, A - J are respectively the test results of cellulase, CAS siderophore, H2S gas, protease, amylase, potassium - releasing, chitinase, inorganic phosphatase, organic phosphatase and nitrogen - fixing enzyme;

[0026] Figure 6 Statistical chart of the colony diameter of DFHJ2 strain under different pH conditions;

[0027] Figure 7 Statistical chart of the colony diameter of DFHJ2 strain under different temperature conditions;

[0028] Figure 8 Detection result chart of the inhibitory activity of the supernatant of DFHJ2 strain culture solution against Colletotrichum siamense on strawberries; among them, A is the result chart of the plate confrontation experiment; B is the statistical chart of the colony diameter of Colletotrichum siamense on strawberries; C is the statistical chart of the inhibition rate;

[0029] Figure 9 Experimental result chart of DFHJ2 strain inhibiting the infection of anthracnose pathogen on detached strawberry leaves; among them, A is the leaf observation chart; B is the statistical chart of the percentage of leaf lesion area;

[0030] Figure 10 Detection result chart of the disease resistance control effect of DFHJ2 strain on potted strawberries;

[0031] Figure 11 Result chart of the experiment for promoting the growth of strawberry seedlings; among them, A is the side view of strawberry seedlings; B is the top view of strawberry seedlings. Detailed implementation manners

[0032] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0034] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0035] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the specification of the present invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0036] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0037] The Colletotrichum siamense ZG-2 used in the present invention was provided by the strawberry germplasm resource research group of Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences. Various other strawberry pathogens were isolated from diseased strawberry plants.

[0038] The present invention collected from the roots of the strawberry variety 'Zhongmei Huajun' with excellent disease resistance effect. Through isolation, purification and screening, a strain of fungus was obtained. It was found that this strain has an antagonistic effect on strawberry anthracnose. Through colony morphology, physiological and biochemical analysis and ITS sequencing analysis, it was found that the homology of this strain with Talaromyces trachyspermus is more than 98%. Combining physiological and biochemical characteristics, this strain was determined to belong to Talaromyces trachyspermus and was named Talaromyces trachyspermus DFHJ2.

[0039] The Talaromyces trachyspermus DFHJ2 of the present invention has a good promoting effect on the growth of strawberry seedlings and a good disease prevention effect on strawberry anthracnose, providing a theoretical basis for the subsequent development of biological bacterial agents.

[0040] The following will detail the Talaromyces trachyspermus DFHJ2 of the present invention and its application in combination with examples and experimental data.

[0041] Example 1 Isolation, purification, identification and preservation of the strain

[0042] 1. Isolation and purification of microorganisms from strawberry plants

[0043] The culture media used in this example are as follows:

[0044] PDA medium: 27 g of potato dextrose agar (PDA), made up to 1000 mL and autoclaved at 121 °C for 15 - 20 min.

[0045] 1.1 Isolation of antagonistic strains

[0046] The strawberry samples were plant tissues of the new strawberry variety 'Zhongmei Huajun' collected from the new variety breeding demonstration base in Dengfeng, Henan.

[0047] Collect various parts of healthy strawberry varieties, disinfect them with 75% alcohol and 2% sodium hypochlorite in a sterile environment. Use a sterile scalpel to take 3 g of the sample and place it in a 2 mL centrifuge tube. Add 1 mL of sterile water and soak for 3 min, then grind it. Centrifuge at 12,000 rpm and take the supernatant and place it on a PDA medium. Culture it in the dark at 28 °C for 5 d. After colonies grow on the plate, purify them and number and store them. Observe and record the growth of colonies on the medium respectively. A total of 86 isolates were obtained.

[0048] 1.2 Screening of antagonistic bacteria

[0049] Prepare PDA medium plates, inoculate a 5 mm diameter Colletotrichum siamense agar disc in the center as the indicator bacterium, and the tested strains are parallel on both sides 25 mm away from the center. Place it in an incubator at 28 °C and culture for 7 d, then observe the antibacterial effect. All experiments are carried out 3 times, with 3 replicates each time. Measure the width of the antibacterial zone and select the antagonistic bacteria strains with good antibacterial effects for screening.

[0050] A total of 42 strains with antagonistic effects against strawberry anthracnose were screened from 86 strains.

[0051] 1.3 Re-screening of antagonistic bacteria

[0052] Conduct an antagonistic test on the 42 initially screened antagonistic bacteria strains again to confirm their antagonistic effects. The remaining operations for re-screening are the same as those for the initial screening. 8 strains with inhibitory effects on strawberry anthracnose were screened from the 42 antagonistic bacteria strains through re-screening, and their antibacterial effects are above 50%.

[0053] The antibacterial effect of strain DFHJ2 is stable, and the antibacterial effects of the initial screening and re-screening reach more than 70% ( Figure 1 ), and it has a good antagonistic effect against strawberry anthracnose. The pure colony of strain DFHJ2 was obtained through multiple streak purifications.

[0054] 2. Identification of strain DFHJ2

[0055] As Figure 2 shown, the front of the colony of strain DFHJ2 on the PDA medium is round, white, opaque, with an irregular edge, and there are granular spore heaps on the surface. The center of the back of the colony is light yellow and the surface of the colony is white. The hyphae are transparent and are septate hyphae. The spores are grain-shaped and the spores are present between the hyphal tissues.

[0056] Using the DNA of DFHJ2 strain as a template, the ITS1 / ITS4 gene fragment was amplified with universal fungal ITS-DNA primers, and the amplified product was sent to Shangya Bioengineering Co., Ltd. for sequencing. The amplification primers were: ITS1 / ITS4: TCCGTAGGTGAACCTGCGG (SEQ ID NO.1) and TCCTCCGCTTATTGATATGC (SEQ ID NO.2).

[0057] The PCR amplification system (50 μL) was: 2×PCR buffer 25 μL, DNA template 2 μL, upstream and downstream primers 1 μL each, and made up to 50 μL with ddH2O.

[0058] The PCR amplification conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 90 s, 30 cycles; extension at 72°C for 10 min.

[0059] The ITS rDNA sequence obtained by sequencing is shown in SEQ ID NO.3.

[0060] SEQ ID NO.3:

[0061] cggaaggatcattaccgagtgcgggcccgctctgggcccaacctcccacccgtgtctcttgcgtactttgttgctttggcgggcccactgggtcactccggtcgccggggagcgctatgctcccgggcccgtgcccgccagagcgcccctgtgaaccctgatgaagagaggctgtctgagtcccacgataatcgttaaaactttcaacaatggatctcttggttccggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattccgtgaatcatcgaatctttgaacgcacattgcgccccctggcattccggggggcatgcctgtccgagcgtcatttctgccctcaagcgcggcttgtgtgttgggcgtggtccccctggctttggcggggacctgcccgaaaggcagcggcgacgtcccgcctagtcctcgagcgtatggggctctgtcacgcgctcgggagggactggtgggcgttggtcaccccttattctttctacggttgacctcggatcaggtaggagttacccgctgaacttaagca。

[0062] The obtained ITS rDNA sequence was subjected to BLAST homology alignment in the NCBI database. The sequence similarity of this strain with Talaromyces trachyspermus exceeded 98%, showing a high degree of homology. Analyzed with the software MEGA11 to determine the taxonomic status of this strain, and a phylogenetic tree ( Figure 3 ) was constructed using the MEGA software. The DFHJ2 strain clustered with Talaromyces trachyspermus.

[0063] Combined with colony morphological characteristics and molecular biological analysis, the DFHJ2 strain was identified as Talaromyces trachyspermus and named Talaromyces trachyspermus DFHJ2.

[0064] 3. Biological preservation

[0065] Talaromyces trachyspermus DFHJ2 was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on February 17, 2025. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 41813.

[0066] Example 2: Test on the inhibitory effect of strain DFHJ2 on various strawberry pathogens

[0067] Prepare PDA medium plates according to the method of Example 1. Inoculate different strawberry pathogen discs with a diameter of 5 mm as indicator bacteria in the center, and the tested strains are parallel on both sides 25 mm away from the center. After culturing in a constant temperature incubator at 28 °C for 7 days, observe the antibacterial effect. All experiments are carried out 3 times, with 3 replicates each time. Measure the width of the antibacterial zone and calculate the inhibition percentage.

[0068] Inhibition rate (%) = (radius of control colony - radius of treated colony) / radius of control colony × 100%.

[0069] The results of the antibacterial test are shown in Table 1 and Figure 4 as follows. The results show that strain DFHJ2 has inhibitory effects on different degrees on the 24 tested pathogens, showing an obvious broad-spectrum inhibitory effect, and the inhibition rate is between 50% and 80%.

[0070] Table 1 Inhibition rate of strain DFHJ2 on various strawberry pathogens

[0071]

[0072] Example 3: Test on multiple enzyme activities of strain DFHJ2

[0073] Inoculate the activated strain DFHJ2 onto the detection media for cellulase, CAS siderophore, H2S gas, protease, amylase, potassium solubilization, chitinase, inorganic phosphatase, organic phosphatase, and nitrogenase, and observe whether there is a clear zone to judge whether it has the corresponding hydrolase activity.

[0074] Formulation of the detection medium:

[0075] For cellulase detection, use carboxymethyl cellulose sodium medium: CMC 10 g / L, peptone 5 g / L, yeast extract 1 g / L, agar 15 g / L, pH 7.0.

[0076] For CAS siderophore detection, use chrome azurol S medium: CAS 0.06 g / L, iron (III) solution 0.01 g / L, peptone 5 g / L, yeast extract 1 g / L, agar 15 g / L, pH 7.0.

[0077] The detection of H2S gas uses Kligler iron agar: peptone 20 g / L, lactose 10 g / L, glucose 1 g / L, ferrous sulfate 0.2 g / L, sodium thiosulfate 0.2 g / L, phenol red 0.025 g / L, agar 15 g / L, pH 7.4.

[0078] The detection of protease activity uses skim milk agar: skim milk 100 g / L, peptone 5 g / L, yeast extract 1 g / L, agar 15 g / L, pH 7.0.

[0079] The detection of amylase uses starch agar: soluble starch 10 g / L, peptone 5 g / L, yeast extract 1 g / L, agar 15 g / L, pH 7.0.

[0080] The detection of potassium-solubilizing ability uses potassium mineral medium: potassium feldspar 10 g / L, glucose 10 g / L, ammonium sulfate 1 g / L, dipotassium hydrogen phosphate 1 g / L, magnesium sulfate 0.5 g / L, agar 15 g / L, pH 7.0.

[0081] The detection of chitinase uses chitin agar: chitin 10 g / L, peptone 5 g / L, yeast extract 1 g / L, agar 15 g / L, pH 7.0.

[0082] The detection of inorganic phosphatase and organic phosphatase uses inorganic phosphorus medium: calcium phosphate 10 g / L, glucose 10 g / L, ammonium sulfate 1 g / L, magnesium sulfate 0.5 g / L, agar 15 g / L, pH 7.0; organic phosphorus medium: lecithin 10 g / L, glucose 10 g / L, ammonium sulfate 1 g / L, magnesium sulfate 0.5 g / L, agar 15 g / L, pH 7.0.

[0083] The detection of nitrogenase activity uses nitrogen-free medium: glucose 10 g / L, dipotassium hydrogen phosphate 1 g / L, magnesium sulfate 0.5 g / L, calcium sulfate 0.1 g / L, agar 15 g / L, pH 7.0. The above media are applicable to the specific detection of the corresponding enzyme activities or metabolites.

[0084] The result graph of the multiple enzyme activity tests of strain DFHJ2 can be seen in Figure 5 . The results show that strain DFHJ2 can produce decolorized circles or transparent circles on 4 detection media of cellulase ( Figure 5 in A), siderophore ( Figure 5 in B), chitinase ( Figure 5 in G) and nitrogenase ( Figure 5 in J), indicating that this strain can secrete cellulase, siderophore, chitinase and nitrogenase, has strong metabolic activity, is easy to be fermented and cultured in large quantities, and is also conducive to its colonization in the soil and exerting its biocontrol effect.

[0085] Example 4 Biological characteristics of DFHJ2 strain

[0086] The pH of the PDA medium was adjusted to 4, 5, 6, 7, 8, 9 and 10, and the DFHJ2 strain was inoculated respectively to explore the effect of different pH on the DFHJ2 strain. The DFHJ2 strain was inoculated into the PDA medium and placed in a constant temperature incubator at 4, 20, 25, 28 and 37 °C, respectively, and cultured in the dark to explore the effect of different temperatures on the DFHJ2 strain.

[0087] The statistical graph of colony diameter under different culture conditions is shown in Figure 6 and Figure 7 .like Figure 6 As shown in the figure, the growth state of DFHJ2 strain in the pH range of 4-10 is significantly different, among which the growth effect is higher when the pH is 7, and the other values are all above 40mm, which shows that it has strong adaptability to acidic and alkaline environments. Figure 7 As shown, different temperatures have a significant effect on the DFHJ2 strain. The strain growth stops at 4°C, the strain diameter continues to increase between 4-28°C, and the diameter decreases within the range of 28-37°C.

[0088] Example 5 Inhibitory Effect of Active Metabolites from the Supernatant of DFHJ2 Strain Culture on Strawberry Anthracnose

[0089] The DFHJ2 strain was inoculated on PDA plates and cultured for 5 days. The bacterial blocks were picked and inoculated into PDB liquid culture medium. The culture was shaken at 28°C and 180r / min for 10 days. The supernatant was filtered through 4 layers of gauze and centrifuged at 12000r / min for 10 minutes. The supernatant was filtered through 0.45μm and 0.22μm filters and transferred into a sterile centrifuge tube to obtain the fermentation supernatant. PDA culture medium with fermentation supernatant content of 1%, 5%, 10%, 15%, and 20% (volume percentage) was configured. Strawberry Siamese Anthrax ZG-2 was inoculated on the culture medium. After culturing at 28°C for 5 days, the supernatant inhibition of pathogen diameter was observed and recorded. The results are shown in Figure 8 .

[0090] like Figure 8 As shown, the PDA medium prepared with 1-20% different volumes of fermentation supernatant of DFHJ2 strain has different antibacterial effects on strawberry Siamese anthracnose. The supernatant can have a more obvious inhibitory effect on strawberry Siamese anthracnose, and with the increase of supernatant volume, the antibacterial effect gradually increases. Among them, 20% volume of supernatant has the best inhibitory effect on strawberry Siamese anthracnose, and the pathogen diameter is 0 cm.

[0091] Example 6: DFHJ2 strain inhibits anthracnose infection on detached strawberry leaves

[0092] The detached strawberry leaves were treated as follows:

[0093] (1) Control group: Sprayed with sterile water and then inoculated with blank PDA medium, divided into non-injured (Water-No injury) and stabbed (Water-Injury);

[0094] (2) Biocontrol experimental group: Sprayed with DFHJ2 spore suspension (1×10 6 spores / mL) and then inoculated with PDA medium of Colletotrichum siamense on strawberry, divided into non-injured (DFHJ2-No injury) and stabbed (DFHJ2-Injury).

[0095] Three leaves were used for each treatment, with 3 replicates, and the disease diameter, area, disease index, etc. were counted.

[0096] As Figure 9 shown, for the two groups of materials treated with sterile water and DFHJ2 spore suspension, after being stabbed respectively, the disease area was larger than that of the non-injured treatment, and the endophyte DFHJ2 had no pathogenicity to detached strawberry leaves. For the stabbed part treated with sterile water, the number of ZG-2 sporophores was large and relatively plump, and the sporophores were bright egg-yellow; for the non-injured part treated with sterile water, the number of ZG-2 spores was less than that of the stabbed part. After treatment with DFHJ2 spore suspension, for the stabbed part, compared with the treatment with sterile water (injured or non-injured), the number of ZG-2 sporophores was small and not plump, and the sporophores were black; for the non-injured part treated with DFHJ2 spore suspension, the ZG-2 sporophores hardly existed, and the ZG-2 sporophores were inhibited by DFHJ2.

[0097] Example 7 Control effect of DFHJ2 strain on disease resistance of potted strawberries

[0098] For potted strawberries, 'Hongyan' seedlings with consistent growth conditions were selected for the experiment. Four treatments (root irrigation method 50 mL / plant) were set as follows:

[0099] (1) Control group (Water-treat): Sterile water;

[0100] (2) Biocontrol single control group (DFHJ2-treat): DFHJ2 (1×10 6 spores / mL);

[0101] (3) Pathogen experimental group (ZG-2-treat): ZG-2 (1×10 6 spores / mL);

[0102] (4) Biocontrol and pathogen co-treatment group (ZG-2+DFHJ2-treat): DFHJ2 (1×10 6 spores / mL) + ZG-2 (1×10 6(spores / mL). Each treatment included 6 potted plants, and each potted plant was replicated 3 times. The strawberry seedlings were placed in transparent plastic bags to prevent the spread of pathogens and watered with sterile water as needed. The growth cycle (temperature 20 - 28°C, humidity 50%) was maintained for 30 days. The disease severity of strawberry seedlings was recorded, and the inhibition rate was calculated.

[0103] The control effect was as Figure 10 shown. After 30 days of inoculation, the incidence of strawberry anthracnose in each treatment was investigated. The results showed that strain DFHJ2 had a strong control effect on strawberry anthracnose. The disease index of the pathogen experimental group inoculated only with the pathogen was 81.67 ± 2.58, while the disease indices of the biocontrol and pathogen co-treatment groups were 27.5 ± 2.75%, respectively, and the biocontrol efficiency against strawberry anthracnose was 66.33 ± 0.17%. The strawberry plants in the sterile water treatment group grew well without disease symptoms. The results indicated that strain DFHJ2 effectively controlled the occurrence of anthracnose in potted strawberries.

[0104] Combining Examples 6 and 7, after treatment and observation, strain DFHJ2 had a disease-resistant effect on strawberry plants, and was significantly effective in resisting pathogen infection. The combination treated with DFHJ2 and anthracnose pathogen had a significantly lower incidence percentage than the combination treated with anthracnose pathogen alone, and the plants were healthier.

[0105] Example 8 Promotion of strawberry seedling growth by strain DFHJ2

[0106] 'Hongyan' strawberry seedlings with consistent growth status were selected for a potted experiment. Two treatments (root irrigation method, 10 mL / plant) were set as follows:

[0107] (1) Control group: sterile water;

[0108] (2) Biocontrol single control group: DFHJ2 (1×10 6 spores / mL).

[0109] The strawberry seedlings were watered with sterile water as needed and cultured in a light incubator for 30 days under the cycle (temperature 28°C, humidity 50%). Their height, root length, fresh weight, dry weight, and chlorophyll content were measured.

[0110] Table 2 Plant height, root length, aboveground fresh weight, underground fresh weight, aboveground dry weight, and underground dry weight of each treatment group

[0111]

[0112] Compared with the control, after 30 days of treatment with strain DFHJ2, the plant height, root length, aboveground fresh weight, underground fresh weight, aboveground dry weight, and underground dry weight of strawberry seedlings were significantly increased ( Figure 11 and Table 2). Compared with the control group, the chlorophyll content in the strawberry leaves of the DFHJ2 group increased by 9.31%.

[0113] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A strain of Talaromyces trachyspermus, characterized in that, It was deposited on February 17, 2025 at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, with the deposit address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number being CGMCC No. 41813.

2. Use of a Trichocladium asperum as claimed in claim 1 or its fermentation product in the preparation of a microbial agent for preventing and treating strawberry diseases and / or promoting the growth of strawberry plants.

3. The application according to claim 2, wherein The strawberry disease is strawberry anthracnose.

4. A microbial inoculant for preventing and controlling strawberry diseases and / or promoting the growth of strawberry plants, characterized in that, The active ingredient comprises the Trichocladium asperum as claimed in claim 1 or its fermentation product.

5. A preparation method of the microbial inoculum according to claim 4, characterized in that, It includes the steps of fermenting and culturing the Trichocladium asperum as claimed in claim 1, separating to obtain spores, and then resuspending the spores to obtain the microbial agent.

6. Use of a Trichocladium asperum as claimed in claim 1 in the preparation of an antibacterial agent against Colletotrichum siamense of strawberries.

7. An antibacterial agent against Colletotrichum siamense of strawberries, characterized in that, The active ingredient comprises the fermentation broth of the Trichocladium asperum as claimed in claim 1.

8. Use of a Trichocladium asperum as claimed in claim 1, the microbial agent as claimed in claim 4 or the antibacterial agent as claimed in claim 7 in the prevention and treatment of strawberry anthracnose.

9. Use of a Trichocladium asperum as claimed in claim 1 or the microbial agent as claimed in claim 4 in promoting the growth of strawberry plants.

10. A method for preventing and controlling strawberry anthracnose, characterized in that, It includes the step of applying the microbial agent as claimed in claim 4 or the antibacterial agent as claimed in claim 7 to strawberry plants.

Images