Microbial agent as well as preparation method and application thereof

Abstract

The invention provides a microbial agent as well as a preparation method and application thereof. The microbial agent comprises an artificial strain, namely a bacillus velezensis P43-DegQ strain, which is obtained by carrying out genetic engineering oriented modification on bacillus velezensis XY40-1 serving as an engineering bacterium. The method comprises the following steps: replacing an original promoter of a DegQ gene in bacillus velezensis XY40-1 with a P43 promoter, connecting the DegQ gene in the XY40-1 with a PBE-P43 vector to construct a P43-DegQ recombinant expression vector, and introducing the P43-DegQ recombinant expression vector into the bacillus velezensis to obtain a bacillus velezensis P43-DegQ strain. According to the invention, the yield of the bacillus velezensis abinogen is improved through genetic engineering oriented modification, so that the microbial control effect of a microbial agent containing the strain is improved. A resonance biopesticide suspending agent and a resonance microbial seed coating agent prepared from the microbial agent are subjected to resonance treatment, the effects of plant epidemic disease prevention and control and seed germination are greatly improved compared with the prior art, and the microbial agent has a very strong application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to a microbial inoculum, a preparation method thereof, and an application thereof. Background Art

[0002] In recent years, in agricultural activities, for crop pest and disease resistance, chemical agriculture and chemical seed coating agents are still mainly used. However, chemical control has problems such as overuse and environmental pollution, and the large-scale use of chemical pesticides will also make pathogens develop drug resistance, which not only increases the cost of agricultural production, but also may brew greater harm. Microbial control is to use bacteria, fungi, viruses, and their metabolites to inhibit epidemic pests and diseases in agricultural production. Microbial control has the characteristics of being green, efficient, and continuously controlling pests and diseases, and is an important research direction in the current field of agricultural control.

[0003] Bacillus velezensis is a strain of the genus Bacillus, which has the characteristics of strong enzyme production ability, rich secondary metabolites, strong stress resistance, and high antibacterial activity. Bacillus velezensis can effectively inhibit a variety of plant pathogens, such as Phytophthora capsici, Fusarium solani, Fusarium oxysporum, Rhizoctonia solani, and several pathogenic fungi on leafy vegetables, including Cercospora leaf spot pathogen, Phoma sp., Botrytis cinerea var. dahliae, and Sclerotinia sclerotiorum, and effectively prevent and control a variety of plant diseases.

[0004] Genetic engineering is based on molecular genetics theory. By using DNA recombination technology, the structure or composition of a biological genome is artificially modified, transformed, or recombined in vivo or in vitro, and then transferred into another cell through a vector to change the original genetic characteristics of the organism and obtain the target gene product or a new biological species. Through the technology of genetic engineering, we can directionally modify the traits of microbial strains and obtain the microbial strains that meet our needs.

[0005] At present, there are relatively few microbial preparations developed for biological pesticides and seed coating agents in China. Most of them are developed based on wild strains, and the research on developing microbial preparations using genetically engineered artificially constructed strains lags behind. Summary of the Invention

[0006] One of the purposes of the present invention is to provide a microbial inoculum and a preparation method thereof. The strain in the microbial inoculum is a new strain obtained by directionally modifying Bacillus velezensis through genetic engineering technology to specifically improve the production of fengycin, and the anti-phytophthora effect of the microbial inoculum is improved by increasing the content of metabolites in the original bacterial liquid of the new strain.

[0007] Another purpose of the present invention is to provide the application of the microbial preparation in the direction of microbial control.

[0008] The present invention is implemented as follows:

[0009] The present invention provides a microbial inoculum, which is a fermentation broth containing Bacillus velezensis P43-DegQ strain. The fermentation broth contains P43-DegQ strain and one of its metabolites, fengycin. The Bacillus velezensis P43-DegQ strain is genetically engineered and directed modified from Bacillus velezensis XY40-1.

[0010] The present invention genetically engineers and directionally modifies Bacillus velezensis XY40-1 to obtain Bacillus velezensis P43-DegQ. By increasing the yield of the metabolite fengycin of Bacillus velezensis P43-DegQ, the microbial control effect of the microbial inoculum containing this strain is improved.

[0011] The microbial inoculum is an unconcentrated original bacterial liquid.

[0012] Further, in the microbial inoculum, the effective viable count of Bacillus velezensis P43-DegQ is 2.81x10 9 ~2.97x10 9 CFU / mL, and the fengycin content is 1450.34 - 1653.46 ng / ml.

[0013] Further, the genetic engineering directional modification includes the following steps:

[0014] (1) Extract the genome of wild-type Bacillus velezensis XY40-1;

[0015] (2) Using PCR amplification technology, with the genome of wild-type Bacillus velezensis XY40-1 as a template, design primers to amplify the DegQ gene;

[0016] (3) Use restriction enzymes and ligases to ligate the DegQ gene with the PBE-P43 expression vector plasmid, incubate at room temperature for 20 - 30 min, and purify by electrophoresis to obtain the expression plasmid P43-DegQ containing the DegQ gene;

[0017] (4) Transform the expression plasmid P43-DegQ into Escherichia coli DH5α, randomly pick monoclonal colonies after culturing, extract the plasmid and verify by enzyme digestion to confirm successful construction, and obtain the recombinant plasmid P43-DegQ;

[0018] (5) Prepare competent bacteria of Bacillus velezensis XY40-1, then transform the recombinant plasmid P43-DegQ into it, randomly pick monoclonal colonies after culturing, and perform colony PCR verification. After confirming successful construction, obtain the P43-DegQ strain.

[0019] In the present invention, the original promoter of the DegQ gene in XY40-1 is replaced with the P43 promoter, the DegQ gene in XY40-1 is ligated with the PBE-P43 vector, a P43-DegQ recombinant expression vector is constructed and introduced into Bacillus velezensis XY40-1 to obtain the Bacillus velezensis P43-DegQ strain.

[0020] The nucleotide sequence of the DegQ gene is shown in SEQ ID NO: 1.

[0021] The nucleotide sequence of the PBE-P43 expression vector plasmid is SEQ ID NO: 2.

[0022] Furthermore, in step (1), the Bacillus velezensis XY40-1 was deposited at the China Center for Type Culture Collection on March 29, 2022. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: M 2022342.

[0023] The Bacillus velezensis P43-DegQ constructed by genetic engineering in the present invention greatly improves the production of fengycin in the metabolic secretions of Bacillus velezensis. Fengycin can interact with the cell phospholipid bilayer and penetrate the phospholipid bilayer, disrupting the orderliness of the cell membrane lipid layer, thereby killing cells and having a good inhibitory effect on pathogenic microorganisms such as fungi and bacteria.

[0024] The present invention provides a method for preparing the microbial inoculant, including the following steps:

[0025] 1) Directionally transform Bacillus velezensis XY40-1 by genetic engineering to obtain the artificially constructed Bacillus velezensis P43-DegQ strain;

[0026] 2) Inoculate the P43-DegQ strain obtained in step 1) on an LB solid medium and culture it at 28-30 °C for 1-2 days to obtain the activated P43-DegQ strain;

[0027] 3) Inoculate the activated P43-DegQ strain into an LB liquid medium and culture it in a shaker at 26-30 °C with a shaking speed of 160-200 rpm for 24-36 hours to prepare a seed liquid;

[0028] 4) Inoculate the seed liquid into the fermentation medium at an inoculation amount of 0.5%-1.5% and culture it in a shaker at 36-39 °C with a shaking speed of 160-200 rpm for 56-80 hours to prepare the microbial inoculant.

[0029] Further, in step 2), the formula of the LB solid medium is: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, agar 15 g / L, and the pH is 7.2 - 7.3.

[0030] Further, in step 3), the formula of the LB liquid medium is: peptone 20 g / L, sodium chloride 10 g / L, yeast extract powder 10 g / L, zinc sulfate 50 mmol / L, PQQ (pyrroloquinoline quinone) 1000 nmol / L, and the pH is 7.2 - 7.3.

[0031] Further, in step 4), the formula of the fermentation medium is: soybean meal 20 g / L, glucose 10 g / L, ammonium sulfate 10 g / L, starch 15 g / L, magnesium sulfate 10 g / L, zinc sulfate 50 mmol / L, yeast extract powder 10 g / L, sodium chloride 15 g / L, potassium dihydrogen phosphate 5 g / L, PQQ 1000 nmol / L, and the pH in the fermenter is 7.2 - 7.3.

[0032] The application of the microbial inoculant of the present invention in inhibiting the growth of pathogenic bacteria or in preparing an inhibitor for the growth of pathogenic bacteria.

[0033] Further, the pathogenic bacteria are at least one of Phytophthora pathogenic bacteria, Sclerotium rolfsii pathogenic bacteria, Ralstonia solanacearum pathogenic bacteria, Colletotrichum pathogenic bacteria, Alternaria alternata pathogenic bacteria, Fusarium oxysporum pathogenic bacteria, and Rhizoctonia solani pathogenic bacteria.

[0034] The application of the microbial inoculant of the present invention in preparing a medicament for preventing and treating at least one of Phytophthora capsici, Sclerotium rolfsii of pepper, Fusarium wilt of cucumber, Colletotrichum capsici of pepper, Alternaria alternata of tobacco, Fusarium wilt of cucumber, and Rhizoctonia solani of tomato.

[0035] The present invention also provides a resonance biological pesticide suspension, the raw materials of which include the above-mentioned microbial inoculant.

[0036] Further, the raw materials of the resonance biological pesticide suspension also include the following components, calculated by mass percentage of the microbial inoculant: wetting and dispersing agent 4.2% - 4.5%, thickening agent 9% - 11%, preservative 0.25% - 0.31%, antifreeze 6% - 7%, ultraviolet protecting agent 0.7% - 0.8%, penetrant 0.3 - 0.4%, synergist 7.2 - 7.6%, defoaming agent 0.6% - 0.9%; and the following components in molar concentration: PQQ 900 - 1100 nmol / L.

[0037] Further preferably, the raw materials of the resonance biological pesticide suspension agent further comprise the following components, calculated as the mass percentage of the microbial inoculum: wetting and dispersing agent 4.1%, thickening agent 9%, preservative 0.21%, antifreeze 5%, ultraviolet protective agent 0.7%, penetrant 0.4%, synergist 6.9%, defoaming agent 0.3%, and the following components in molar concentration: PQQ 1000 nmol / L.

[0038] Furthermore, the wetting and dispersing agent comprises Tween + sodium lignosulfonate, wherein the mass ratio of Tween to sodium lignosulfonate is 1:(0.9 - 1.15); the thickening agent comprises 3% xanthan gum mother liquor; the preservative comprises Kathon; the antifreeze comprises ethylene glycol; the ultraviolet protective agent comprises skimmed milk powder; the penetrant comprises orange peel essential oil; the synergist comprises lactopeptide + butyl butyrate, wherein the mass ratio of lactopeptide to butyl butyrate is 1:20; the defoaming agent comprises dimethyl silicone oil.

[0039] Furthermore, the main components of the lactopeptide are organic acids, free amino acids, potassium, phosphorus, etc., wherein the concentration of organic acids is 250 - 300 g / L, the concentration of free amino acids is 150 - 180 g / L, and the molecular weights are all < 300, the potassium content is 85 - 100 g / L, and the phosphorus content is 17 - 22 g / L. It is a natural mixture specifically extracted by corn fermentation.

[0040] Further, the preparation method of the resonance pesticide suspension agent comprises: subjecting the above raw material components to resonance treatment, and after treatment, mixing them evenly to obtain the resonance microbial suspension agent.

[0041] Furthermore, the specific equipment used for the resonance treatment is an electromagnetic vibration device, whose frequency is 144 - 216 KHz, and the treatment time is 11 - 15 min. The maximum power consumption of the electromagnetic vibration device for the resonance treatment ≤ 20 w, the adapter input is AC100 - 24V 1.5A, and the output is DC12V4A5A.

[0042] In the present invention, the electromagnetic vibration device is provided by Guangdong Suisen Industrial Co., Ltd., and the original supplier is Japan Refine Wave Corp (Japan Refining Wave Company). The photo of the electromagnetic vibration device is shown in Figure 7 as shown.

[0043] When this equipment is in use, by generating an instantaneous high voltage (up to 12000V), it forms an electromagnetic field with a certain frequency. After circulating and treating the liquid product for a certain time, it can break some easily broken covalent bonds or peptide bonds, or break the mixed proteins into polypeptides, or break some covalent bonds of high molecular polysaccharides into low molecular polysaccharides. At the same time, it promotes the chelation between biological chemical components and promotes the chelation effect. Its working principle is as shown in Figure 8 as shown.

[0044] When the resonance biological pesticide suspending agent described in the present invention is applied to control Sclerotium rolfsii of peppers, it is first diluted 300 - 400 times and then sprayed.

[0045] The present invention also provides a resonance microbial seed coating agent, the raw materials of which include the microbial inoculum.

[0046] Furthermore, the raw materials of the resonance microbial seed coating agent further include the following components, calculated by mass percentage of the microbial inoculum: wetting and dispersing agent 4.2% - 4.5%, thickening agent 9% - 11%, preservative 0.25% - 0.31%, antifreezing agent 6% - 7%, ultraviolet protecting agent 0.7% - 0.8%, penetrant 0.3 - 0.4%, synergist 7.2 - 7.6%, defoaming agent 0.6% - 0.9%, film-forming agent 7% - 12%, warning color 0.3% - 1%, synergist 0.15 - 0.25%, and the following components in molar concentration: PQQ 40 - 60 nmol / L.

[0047] More preferably, the raw materials of the resonance microbial seed coating agent further include the following components, calculated by mass percentage of the microbial inoculum: wetting and dispersing agent 4.3%, thickening agent 10%, preservative 0.3%, antifreezing agent 6%, ultraviolet protecting agent 0.8%, defoaming agent 0.7%, film-forming agent 8%, warning color 0.75%, synergist 0.25%, and the following components in molar concentration: PQQ 50 nmol / L.

[0048] Even further, the wetting and dispersing agent includes Tween + sodium lignosulfonate, where the mass ratio of Tween to sodium lignosulfonate is 1:(0.9 - 1.15); the thickening agent includes 3% xanthan gum mother liquor; the preservative includes Kathon; the antifreezing agent includes ethylene glycol; the ultraviolet protecting agent includes skimmed milk powder; the defoaming agent includes dimethyl silicone oil; the film-forming agent includes polyvinylpyrrolidone; the warning color includes basic fuchsin; the synergist includes gibberellin.

[0049] Furthermore, the preparation method of the resonance microbial seed coating agent includes: subjecting each raw material component except the microbial inoculum in the raw materials to resonance treatment, and after treatment, mixing with the microbial inoculum to obtain the resonance microbial seed coating agent.

[0050] Even further, the equipment used for the resonance treatment is an electromagnetic vibration device, with a frequency of 146 - 220 KHz and a treatment time of 11 - 15 min.

[0051] The application of the microbial seed coating agent in pepper, eggplant, and Chinese cabbage seeds.

[0052] Preferably, the weight ratio of the microbial seed coating agent to the seeds is 1:(100 - 150).

[0053] Application of the microbial inoculum in the preparation of a preservative.

[0054] Advantages of the present invention:

[0055] Compared with the prior art, the microbial inoculum provided by the present invention has a significant improvement in the control effects against Sclerotium rolfsii, Colletotrichum gloeosporioides, and Fusarium oxysporum. The resonance biological agriculture suspension agent and the resonance microbial seed coating agent prepared with this microbial inoculum have significantly improved effects in the control of plant diseases and seed germination respectively, and have extremely strong application prospects. Description of the drawings

[0056] Figure 1 In the figure, a is a schematic diagram of designing primers to construct a defective gene fragment in Example 1, b is a gel electrophoresis diagram when constructing the DegQ-Cm vector, c is a colony map of the DegQ-Cm vector transferred into the wild-type strain of Bacillus velezensis XY40-1 and the verification of the transformed DNA sequence;

[0057] Figure 2 It is a comparison diagram of the antagonistic effects of the wild-type strain of Bacillus velezensis XY40-1 and the Bacillus velezensis ΔDegQ strain against Colletotrichum capsici, Phytophthora infestans, and Geotrichum candidum;

[0058] Figure 3 It is a process flow diagram for constructing the P43-DegQ plasmid expression vector;

[0059] Figure 4 It is an electrophoresis result diagram during the construction of the Bacillus velezensis P43-DegQ strain in Example 3;

[0060] Figure 5 It is a comparison diagram of the antagonistic effects of the Bacillus velezensis P43-DegQ strain, the wild-type strain of Bacillus velezensis XY40-1, and the Bacillus velezensis ΔDegQ strain against Sclerotium rolfsii, Colletotrichum capsici, and Fusarium oxysporum f. sp. cucumerinum.

[0061] Figure 6 It is an HPLC-MS image of fengycin in the microbial inoculum containing the Bacillus velezensis P43-DegQ strain in Example 5.

[0062] Figure 7 It is a photo of the electromagnetic vibration device.

[0063] Figure 8 It is a working principle diagram of the electromagnetic vibration device. Detailed implementation manners

[0064] To make the objectives, technical solutions, and advantages of the present invention clearer, the following will, in conjunction with the embodiments of the present invention, clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts fall within the scope of protection of the present invention.

[0065] The Bacillus velezensis XY40-1 involved in the present invention was deposited at the China Center for Type Culture Collection on March 29, 2022. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: M2022342.

[0066] The culture media of the strains used in the following examples are as follows:

[0067] LB solid medium (g / L): Tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, agar 15 g / L. Dissolve in water and finally make up the volume to 1000 mL, pH 7.2, autoclave (121 °C, 30 min).

[0068] LB liquid medium (g / L): Peptone 20 g / L, sodium chloride 10 g / L, yeast extract powder 10 g / L, zinc sulfate 50 mmol / L, PQQ 1000 nmol / L. Finally make up the volume to 1000 mL, pH 7.2, autoclave (121 °C, 30 min).

[0069] Fermentation medium (g / L): Soybean meal 20 g / L, glucose 14 g / L, magnesium sulfate 10 g / L, zinc sulfate 50 mmol / L, peptone 20 g / L, yeast extract powder 10 g / L, sodium chloride 10 g / L, potassium dihydrogen phosphate 10 g / L, PQQ 1000 nmol / L. Finally make up the volume to 1000 mL, pH 7.2, autoclave (121 °C, 30 min).

[0070] In the following examples, the specific equipment used for resonance treatment is an electromagnetic vibration device provided by Guangdong Suisen Industrial Co., Ltd. The original supplier is Japan Refine Wave Corp. A photo of the electromagnetic vibration device is shown in Figure 7 as follows.

[0071] Example 1: Construction of the Bacillus velezensis defective strain ΔDegQ strain

[0072] 1. Primer design

[0073] Using the genome of wild-type Bacillus velezensis XY40-1 as a template, sequences of 1500 bp upstream and downstream of the DegQ gene were downloaded. Primers 1F and 2R were designed within the 1500 bp nucleotide sequence before the start codon, and primers 3F and 4R were designed within the 1500 bp after the stop codon. At the same time, homologous arms of the resistance gene Cm were added before 2R and 3F respectively, as shown in Figure 1 a below. The primer design is as follows:

[0074] DegQ-1F:ATTATGGCGCGCAAGTATCAGC

[0075] DegQ-2R:CGATCAACGTCTCATTTTCGCCATCGGTGAACATGTAAGAAAGCGG

[0076] Cm-F:CCGCTTTCTTACATGTTCACCGATGGCGAAAATGAGACGTTGATCG

[0077] Cm-R:TTTTTAGGTTAAATGCTCCTGATTACGCCCCGCCCTGCCA

[0078] DegQ-3F:AGAGGGGAGAGAGGACATATGCCATTGGAGAACACTGTTTATTC

[0079] DegQ-4R:GATTGTAAGGATATTTCTGGTGCC

[0080] DegQ-1F-new:CCAAGCTTGGATTATGGCGCGCAAGTATCAGC

[0081] DegQ-4R-new:GCTCTAGAGCCTGGTGCCGCATAACAGACAG

[0082] 2. Amplification of the target gene DegQ

[0083] When knocking out the gene, using the genome of wild-type Bacillus velezensis XY40-1 as a template, the upstream and downstream fragments of the DegQ gene (referred to as fragments A and B) were amplified using primers DegQ-1F + DegQ-2R and DegQ-3F + DegQ-4R respectively. Using the pkd3 plasmid as a template, the chloramphenicol Cm resistance gene was amplified using primers Cm-F and Cm-R.

[0084] The nucleotide sequence of the pkd3 plasmid is SEQ ID NO: 3.

[0085] The nucleotide sequence of the chloramphenicol Cm resistance gene is SEQ ID NO: 4.

[0086] 3. Fragment recovery and overlap

[0087] Electrophoretically detect the amplified target gene fragment and the Cm resistance gene fragment in a 1% (m / v) agarose gel. If it is a single band, directly recover the fragment of the PCR product; if there are smeared bands, cut the gel to recover, as shown in b below. After obtaining the purified gene fragments, perform two-step overlap of fragments A and B with the chloramphenicol Cm resistance gene respectively. The overlap system and procedure are as follows: Figure 1 After obtaining the purified gene fragments, perform two-step overlap of fragments A and B with the chloramphenicol Cm resistance gene respectively. The overlap system and procedure are as follows:

[0088] The first step:

[0089] Table 1 Overlap PCR system

[0090] DNA template 1 μL DegQ-1F 0.4 μL Cm-2R 0.4 μL 2× Taq enzyme 10 μL Water 8.2 μL

[0091] The total volume is 20 μl. Pre-denature at 94 °C for 2 min, denature at 94 °C for 30 s, anneal at 62 °C for 30 s, extend at 72 °C for 30 s, for 14 cycles, finally extend at 72 °C for 5 min, and cool at 16 °C for 5 min. After the first-step reaction is completed, add the second-step reaction solution to the first-step reaction solution and mix well. For the second overlap, use DegQ-1F and DegQ-4R as forward and reverse primers, and the PCR system and steps are the same as in Table 1, for 32 cycles.

[0092] 4. Transform the overlapping fragment into Escherichia coli DH5α

[0093] First, ligate the overlapping fragment with the pMD19-T vector plasmid, genetically transform it into Escherichia coli DH5α, culture it on an LB agar plate medium containing X-Gal, IPTG, Amp, and Cm to form blue and white single colonies. Select white single colonies, and use the primers DegQ-1F / DegQ-4R to perform colony PCR to confirm the length of the inserted fragment in the vector (the method is the same as the second step of overlap). After verification, extract the plasmid to obtain the recombinant plasmid DegQ-Cm.

[0094] The nucleotide sequence of the pMD19-T vector plasmid is SEQ ID NO: 5.

[0095] 5. Prepare competent cells of Bacillus velezensis

[0096] (1) Pick a single colony of Bacillus velezensis and inoculate it into LB liquid medium, then shake and culture it; the next day, transfer the bacterial liquid to GM liquid medium and culture it until the OD value reaches 0.9 - 1.2, then ice-bath for 20 - 30 min to stop the growth of bacteria. The preparation method of the LB medium is as follows: Mix 10 g of peptone, 5 g of yeast extract, 10 g of NaCl and distilled water thoroughly, and make up the volume to 100 mL with distilled water. The preparation method of the GM medium is as follows: Mix 10 g of peptone, 5 g of yeast extract, 10 g of NaCl, 0.5 mol of sorbitol, 1% glycine and distilled water thoroughly, and make up the volume to 1000 mL with distilled water.

[0097] (2) Centrifuge at 5000 rpm for 8 min at 4 °C to collect the bacterial cells, and try to suck out as much residual culture medium as possible.

[0098] (3) Add pre-cooled electrotransformation buffer ETM to wash the bacterial cells, gently pipette back and forth to resuspend them, centrifuge and discard the supernatant, and repeat washing the bacterial cells more than 4 times. The electrotransformation buffer ETM: 0.5 M sorbitol, 0.5 M mannitol, 10% glycerol, made up the volume to 1000 mL with deionized water.

[0099] (4) Suspend the precipitated bacterial cells with 1 mL of 40% PEG4000.

[0100] (5) Aliquot the competent cells, 80 μL per tube, and transfer them to a -80 °C refrigerator for storage.

[0101] 6. Electrotransform the recombinant plasmid into the competent cells of Bacillus velezensis

[0102] (1) Take 100 - 200 ng of the recombinant plasmid DegQ-Cm and add it to the prepared competent cells. Gently pipette up and down on ice to thoroughly mix the plasmid DNA and the competent cells, and then ice-bath and let it stand for 15 min.

[0103] (2) Transfer the system completed in step (1) to a pre-cooled electroporation cuvette (1 mm) at 0 °C, and perform electroporation using an electroporator (voltage 1.8 kV, capacitance 25 μF, resistance 200 Ω, electroporate once, time constant = 4.5 - 5 ms).

[0104] (3) After completing step (2), immediately add 1 mL of RM medium (recovery medium) to the electroporation cuvette, and gently pipette back and forth repeatedly to mix evenly. The preparation method of the RM medium is as follows: Mix 10 g of peptone, 5 g of yeast extract, 10 g of NaCl, 0.5 mol of sorbitol, 0.38 M mannitol and distilled water thoroughly, and make up the volume to 1000 mL with distilled water.

[0105] (4) After completing step 3, aspirate all the bacterial liquid in the electroporation cuvette into a centrifuge tube, and culture it at 37 °C with shaking at 200 r / min for 5 hours.

[0106] (5) Spread the culture system in step (4) on an LB solid medium plate containing ampicillin at a final concentration of 50 μg / mL, and incubate overnight at 37°C.

[0107] (6) Randomly pick the grown monoclonal colonies, extract plasmid DNA, and use the primers DegQ-1F / DegQ-4R to perform bacterial liquid PCR to verify the length of the inserted fragment in the vector (the method is the same as the second step of overlap). The correct transformant is the DegQ gene mutant of Bacillus velezensis, named ΔDegQ strain, as Figure 1 shown in c.

[0108] Example 2: Detection of the antibacterial activity of Bacillus velezensis ΔDegQ strain

[0109] The plate confrontation method is adopted: inoculate Colletotrichum capsici, Phytophthora infestans, and Geotrichum candidum on the center of a PDA plate, and then spot-inoculate the Bacillus velezensis ΔDegQ strain at a position 2 cm away from the center of the medium by the cross method; the wild-type control group is inoculated with the wild-type Bacillus velezensis XY40-1 after inoculating the pathogen in the same way, and the blank control group is not inoculated with other strains after inoculating the pathogen; incubate the experimental group and the control group at a constant temperature of 28°C. After the pathogen in the blank control group fills the plate, measure the width of the antibacterial zone, and each treatment has 6 replicates. Antibacterial rate (%) = (control colony diameter - treated colony diameter) / control colony diameter * 100%; the results are shown in Figure 2 and Table 1.

[0110] Table 2 Inhibitory effects of wild-type and ΔDegQ strains of Bacillus velezensis on pathogens

[0111]

[0112] From Figure 2 the experimental results in and Table 2 show that the antibacterial rate of the gene-deficient strain ΔDegQ of Bacillus velezensis is much lower than that of the wild-type, verifying that the gene DegQ plays an important role in the antibacterial activity of Bacillus velezensis.

[0113] Example 3: Construction of Bacillus velezensis P43-DegQ strain

[0114] Using the PCR amplification technique, with the genome of the wild-type Bacillus velezensis XY40-1 as the template, design primers to amplify the DegQ gene, and use an agarose gel kit for purification and recovery to obtain the DegQ gene. The designed primer sequences are as follows:

[0115] DegQ-F:TTTGGATCCGTGGAAAACAAATTAGAAGA

[0116] DegQ-R: TTTGAATTCTTAAGAAATTTTCATTGCAT

[0117] The PBE-P43 expression vector plasmid and the DegQ gene were digested with EcoRⅠ and BamHⅠ, and then purified by electrophoresis to obtain a purified DegQ gene fragment and a linearized PBE-P43 expression vector plasmid.

[0118] The purified DegQ gene fragment and the linearized PBE-P43 expression vector plasmid were ligated using T4 ligase, incubated at room temperature for 20 min, and then purified by electrophoresis to obtain the expression plasmid P43-DegQ containing the DegQ gene.

[0119] The expression plasmid P43-DegQ was transformed into Escherichia coli DH5α, and monoclonal colonies were randomly selected. The plasmid was extracted and verified by digestion to obtain the recombinant plasmid P43-DegQ after successful construction was confirmed.

[0120] Competent cells of Bacillus velezensis were prepared, and the recombinant plasmid P43-DegQ was transformed into them. Monoclonal colonies were randomly selected and verified by colony PCR. After successful construction was confirmed, the P43-DegQ strain was obtained.

[0121] The results of purification electrophoresis during the process are as Figure 4 shown.

[0122] Example 4: Detection of the antibacterial activity of Bacillus velezensis P43-DegQ strain

[0123] Using the method flow described in Example 2, the antibacterial activities of Bacillus velezensis P43-DegQ strain and Bacillus velezensis ΔdegQ mutant strain against Colletotrichum capsici, Fusarium oxysporum f. sp. cucumerinum, and Sclerotium rolfsii were detected. The results are shown in Figure 5 and Table 3.

[0124] Table 3 Inhibitory effects of wild-type, ΔDegQ, and P43-DegQ strains of Bacillus velezensis on pathogenic bacteria

[0125]

[0126] From Figure 5 and the experimental results in Table 3, it can be seen that the inhibitory effects of the artificially constructed Bacillus velezensis P43-DegQ strain on Colletotrichum capsici, Fusarium oxysporum f. sp. cucumerinum, and Sclerotium rolfsii are significantly improved compared with the wild type.

[0127] Example 5: Preparation of microbial inoculum

[0128] The specific preparation process is as follows:

[0129] 1) Strain activation: Inoculate the Bacillus velezensis P43-DegQ strain obtained in Example 3 onto an LB solid medium and culture it at 30 °C for 1 day to obtain the activated strain;

[0130] 2) Fermentation seed culture: Inoculate the activated strain into an LB liquid medium and culture it in a shaker at 160 rpm at 28 °C for 24 hours to prepare the Bacillus velezensis P43-DegQ seed solution;

[0131] 3) Fermentation: Inoculate the Bacillus velezensis P43-DegQ seed solution into a fermentation tank fermentation medium at an inoculation amount of 1% and culture it in a shaker at 190 rpm at 37 °C for 72 hours to prepare a microbial inoculum containing the Bacillus velezensis P43-DegQ strain.

[0132] At the same time, ferment the wild-type Bacillus velezensis XY40-1 and the ΔdegQ mutant, and use the methods of acid precipitation and methanol extraction to roughly extract the fengycin in the fermentation broth, and then detect it by HPLC-MS. The content of fengycin in the fermentation broth of each strain is shown in Table 4, and the HPLC-MS analysis of the fengycin of the P43-DegQ strain is as Figure 6 shown.

[0133] Table 4 Fengycin content of each strain

[0134]

[0135] Comparative Example 1

[0136] Tween-80, sodium lignin sulfonate, 3% xanthan gum, ethylene glycol, kason, skim milk powder, orange peel essential oil, lactose peptide, butanol fat and dimethyl silicone oil were added to the microbial agent containing Bacillus Velez P43-DegQ strain prepared in Example 5, wherein the amount of Tween-80 was 3% of the mass of the microbial agent, the amount of sodium lignin sulfonate was 2.8% of the mass of the microbial agent, the amount of 3% xanthan gum was 10% of the mass of the microbial agent, and the amount of ethylene glycol was The amount of the microbial agent is 4.2%, the amount of the kason is 0.25%, the amount of the skim milk powder is 0.6%, the amount of the orange peel essential oil is 0.25%, the amount of the lactose peptide is 0.4%, the amount of the butanol lipid is 8.0%, the amount of the dimethyl silicone oil is 0.3%, the amount of the microbial agent is fully stirred and mixed, and finally PQQ is added, stirred and mixed to obtain a biological pesticide suspension. In the biological pesticide suspension, the concentration of PQQ is 1000nmol / L. Lactopeptide can be purchased through commercial channels (Zhucheng Haotian Pharmaceutical Co., Ltd.), and its main components are organic acid, free amino acid, potassium, phosphorus, etc., wherein the organic acid concentration is 250-300g / L, the free amino acid concentration is 150-180g / L, and the molecular weight is <300, the potassium content is 85-100g / L, and the phosphorus content is 17-22g / L, specifically a natural mixture extracted from corn fermentation. Finally, a biological pesticide suspension containing the P43-DegQ strain is obtained.

[0137] Comparative Example 2

[0138] Compared with Comparative Example 1, the only difference of this comparative example is that the microbial agent containing the Bacillus Velez subtilis P43-DegQ strain is replaced by a fermentation broth containing the wild-type Bacillus Velez subtilis XY40-1, thereby obtaining a biological pesticide suspension containing the wild-type XY40-1.

[0139] Example 6: Preparation of resonance biopesticide suspension

[0140] Compared with Comparative Example 1, the only difference of this comparative example is that the components are mixed to obtain a mixed solution, and then the mixed solution is subjected to resonance treatment, the frequency of the resonance treatment is 180KHz, the treatment time is 15min, and then the microbial agent containing the Bacillus Velez P43-DegQ strain is compounded with the auxiliary agent mixture to obtain a resonance biological pesticide suspension.

[0141] Example 7: Control of pepper blight by using resonance biopesticide suspension

[0142] The field effect of the resonance biological pesticide suspension prepared in Example 6 on the biocontrol of pepper phytophthora was verified. The resonance biological pesticide suspension was diluted 300 times with water, and the pepper of the variety Xingshu 215 was irrigated with roots, 330 square meters for each treatment, and the medicine was used twice before the onset and at the early stage of the disease, respectively. Clean water, the biological pesticide suspension obtained in Comparative Examples 1 and 2 diluted 300 times, and the chemical pesticide 20% pyraclostrobin suspension (diluted 2000 times, used twice before the onset and at the early stage of the disease, respectively) were used as the control group. The results are shown in Table 5.

[0143] Table 5 Control effect of pesticide suspension on pepper phytophthora

[0144]

[0145] Comparative Example 3

[0146] Tween-80, sodium lignin sulfonate, 3% xanthan gum, ethylene glycol, kason, skim milk powder, dimethyl silicone oil, basic fuchsin, gibberellin, and polyvinyl pyrrolidone were added to the microbial agent containing the Bacillus Velezii P43-DegQ strain prepared in Example 5, wherein the amount of Tween-80 was 3% of the mass of the microbial agent, the amount of sodium lignin sulfonate was 2.8% of the mass of the microbial agent, the amount of 3% xanthan gum was 10% of the mass of the microbial agent, and the amount of ethylene glycol was The amount of 4.2% of the mass of the microbial agent, the amount of Kathon is 0.25% of the mass of the microbial agent, the amount of skimmed milk powder is 0.6% of the mass of the microbial agent, the amount of dimethyl silicone oil is 0.3% of the mass of the microbial agent, the amount of basic fuchsin is 0.75% of the mass of the microbial agent, the amount of gibberellin is 0.15% of the mass of the microbial agent (dissolved in 2 ml of anhydrous ethanol), the amount of polyvinyl pyrrolidone is 7% of the mass of the microbial agent, stir and mix thoroughly, and finally add 50nmol / L PQQ, stir and mix thoroughly to obtain a microbial seed coating agent containing the P43-DegQ strain.

[0147] Comparative Example 4

[0148] Compared with Comparative Example 3, the only difference of this comparative example is that the microbial agent containing the Bacillus Velez subtilis P43-DegQ strain is replaced with a fermentation broth containing the wild type of Bacillus Velez subtilis XY40-1 to obtain a microbial seed coating agent containing the wild bacteria XY40-1.

[0149] Example 8: Preparation of resonance microbial seed coating agent

[0150] Compared with Comparative Example 3, the difference in this comparative example is only that the components of the auxiliary agent are mixed evenly to obtain a mixed solution, and then the mixed solution is subjected to resonance treatment. The frequency of the resonance treatment is 180 KHz, and the treatment time is 15 min. Then, the auxiliary agent mixed solution after resonance treatment is mixed with the microbial inoculant containing Bacillus velezensis P43-DegQ strain to obtain a resonance microbial seed coating agent.

[0151] Example 9: Determination of the effect of resonance microbial seed coating agent on the germination of crops

[0152] 1. Effect of microbial seed coating agent on the germination rate of pepper seeds

[0153] Take the resonance microbial seed coating agent of Example 8, mix it with pepper seeds according to the ratio of medicine to seed weight of 1:100 for coating. After coating, dry it in the shade, take it out and place it in a petri dish with moist filter paper for sowing. Add 3 mL of sterilized water, and then add 1 mL of sterilized water every day. Use the seeds soaked in clear water as CK, and the microbial seed coating agents prepared in Comparative Examples 3 and 4 as controls. Place them in an incubator at 28 °C for cultivation. After 4 days, count the seed germination potential, count the number of germinated seeds every day, and after 7 days, count the germination rate of pepper seeds. The experimental results are shown in Table 6.

[0154] Germination potential (%) = (Number of germinated seeds at 4 days / Total number of tested seeds) × 100

[0155] Germination rate (%) = (Number of germinated seeds at 7 days / Total number of tested seeds) × 100

[0156] Table 6 Effect of microbial seed coating agent on the germination of pepper seeds

[0157]

[0158] 2. Effect of microbial seed coating agent on the germination rate of eggplant seeds

[0159] Take the resonance microbial seed coating agent of Example 8, mix it with eggplant seeds according to the ratio of medicine to seed weight of 1:120 for coating. After coating, dry it in the shade, take it out and place it in a petri dish with moist filter paper for sowing. Add 3 mL of sterilized water, and then add 1 mL of sterilized water every day. Use the seeds soaked in clear water as CK, and the microbial seed coating agents prepared in Comparative Examples 3 and 4 as controls. Place them in an incubator at 28 °C for cultivation. After 4 days, count the seed germination potential, count the number of germinated seeds every day, and after 7 days, count the germination rate of pepper seeds. The experimental results are shown in Table 7.

[0160] Germination potential (%) = (Number of germinated seeds at 4 days / Total number of tested seeds) × 100

[0161] Germination rate (%) = (Number of germinated seeds at 7 days / Total number of tested seeds) × 100

[0162] Table 7 Effect of microbial seed coating agent on the germination of eggplant seeds

[0163]

[0164] 3. Influence of microbial seed coating agents on the germination rate of Chinese cabbage seeds

[0165] Take the resonance microbial seed coating agent of Example 8, mix it with Chinese cabbage seeds at a ratio of 1:150 by weight of the medicine to the seeds for coating. After coating, dry it in the shade, take it out and sow it in a petri dish with moist filter paper, add 3 mL of sterilized water, and then add 1 mL of sterilized water every day. Use the seeds soaked in clear water as CK and the microbial seed coating agents prepared in Comparative Examples 3 and 4 as controls, place them in an incubator at 28°C for cultivation, and count the seed germination rate after 2 days. The experimental results are shown in Table 8.

[0166] Table 8 Influence of microbial seed coating agents on the germination of Chinese cabbage seeds

[0167]

Claims

1. A microbial inoculant, characterized in that, The microbial inoculant is a fermentation broth containing Bacillus velezensis strain P43-DegQ; the fermentation broth contains strain P43-DegQ and fengycin, one of its metabolites; Bacillus velezensis strain P43-DegQ is obtained by genetically engineering and orienting the modification of Bacillus velezensis XY40-1.

2. The microbial inoculant according to claim 1, wherein In the microbial inoculum, the effective viable count of Bacillus velezensis P43-DegQ is 2.81*10 9 ~2.97*10 9 CFU / mL, and the fengycin content is 1450.34 - 1653.46 ng / ml.

3. The microbial inoculant according to claim 1, characterized in that, The genetic engineering and orientation modification includes the following steps: (1) Extract the genome of wild-type Bacillus velezensis XY40-1; (2) Using PCR amplification technology, with the genome of wild-type Bacillus velezensis XY40-1 as a template, design primers for amplification to obtain the DegQ gene; (3) Use restriction enzymes and ligases to ligate the DegQ gene with the PBE-P43 expression vector plasmid, incubate at room temperature for 20 - 30 min, and purify by electrophoresis to obtain the expression plasmid P43-DegQ containing the DegQ gene; (4) Transform the expression plasmid P43-DegQ into Escherichia coli DH5α, randomly pick monoclonal colonies after cultivation, extract the plasmid and verify by restriction enzyme digestion to confirm successful construction and obtain the recombinant plasmid P43-DegQ; (5) Prepare competent bacteria of Bacillus velezensis XY40-1, then transform the recombinant plasmid P43-DegQ into it, randomly pick monoclonal colonies after cultivation, and perform colony PCR verification. After confirming successful construction, obtain strain P43-DegQ.

4. A preparation method of the microbial inoculant according to any one of claims 1 - 3, comprising the following steps: 1) Genetically engineer and orient the modification of Bacillus velezensis XY40-1 to obtain Bacillus velezensis strain P43-DegQ; 2) Inoculate the P43-DegQ strain obtained in step 1) on an LB solid medium and culture at 28 - 30 °C for 1 - 2 days to obtain the activated P43-DegQ strain; 3) Inoculate the activated P43-DegQ strain into an LB liquid medium and culture it at 26 - 30 °C in a shaker at 160 - 200 rpm for 24 - 36 hours to prepare a seed liquid; 4) Inoculate the seed liquid into a fermentation medium at an inoculation amount of 0.5% - 1.5% and culture it in a shaker at 160 - 200 rpm at 36 - 39 °C for 56 - 80 hours to prepare the microbial inoculant.

5. The preparation method according to claim 4, characterized in that, Bacillus velezensis XY40-1 was deposited at the China Center for Type Culture Collection on March 29, 2022. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: M 2022342; The formula of the LB solid medium is: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar, and the pH is 7.2 - 7.3; The formula of the LB liquid medium is: 20 g / L peptone, 10 g / L sodium chloride, 10 g / L yeast extract powder, 50 mmol / L zinc sulfate, 1000 nmol / L PQQ (pyrroloquinoline quinone), and the pH is 7.2 - 7.3; The formula of the fermentation medium is as follows: 20 g / L soybean meal, 10 g / L glucose, 10 g / L ammonium sulfate, 15 g / L starch, 10 g / L magnesium sulfate, 50 mmol / L zinc sulfate, 10 g / L yeast extract powder, 15 g / L sodium chloride, 5 g / L potassium dihydrogen phosphate, 1000 nmol / L PQQ, and the pH of the fermenter is 7.2 - 7.

3.

6. Use of the microbial inoculant according to any one of claims 1 - 3 in inhibiting the growth of pathogenic bacteria or in preparing an inhibitor for the growth of pathogenic bacteria.

7. The application according to claim 6, characterized in that, The pathogenic bacteria are at least one of Phytophthora pathogenic bacteria, Sclerotium rolfsii pathogenic bacteria, Ralstonia solanacearum pathogenic bacteria, Colletotrichum pathogenic bacteria, Alternaria alternata pathogenic bacteria, Fusarium oxysporum pathogenic bacteria, and Rhizoctonia solani pathogenic bacteria.

8. Use of the microbial inoculant according to any one of claims 1 - 3 in preparing a medicament for controlling at least one of Phytophthora capsici, Sclerotium rolfsii of pepper, Fusarium oxysporum of cucumber, Colletotrichum capsici of pepper, Alternaria alternata of tobacco, Fusarium oxysporum of cucumber, and Rhizoctonia solani of tomato.

9. A suspension concentrate of a resonance biological pesticide, characterized in that, Its raw materials include the microbial inoculant according to any one of claims 1 - 3.

10. The resonant biological pesticide suspension concentrate according to claim 9, wherein, The raw materials of the resonance biological pesticide suspension also include the following components, calculated by mass percentage of the microbial inoculant: wetting and dispersing agent 4.2% - 4.5%, thickening agent 9% - 11%, preservative 0.25% - 0.31%, antifreeze 6% - 7%, ultraviolet protection agent 0.7% - 0.8%, penetrant 0.3 - 0.4%, synergist 7.2 - 7.6%, defoaming agent 0.6% - 0.9%; and the following components in molar concentration: PQQ 900 - 1100 nmol / L.

11. The resonance biological pesticide suspension according to claim 10, characterized in that, The wetting and dispersing agent is Tween + sodium lignosulfonate, and the mass ratio of Tween to sodium lignosulfonate is 1:(0.9 - 1.15); the thickening agent includes 3% xanthan gum mother liquor; the preservative includes Kathon; the antifreeze includes ethylene glycol; the ultraviolet protection agent includes skimmed milk powder; the penetrant includes orange peel essential oil; the synergist includes lactoferrin + butyl ester, and the mass ratio of lactoferrin to butyl ester is 1:20; the defoaming agent includes dimethyl silicone oil.

12. The resonance biological pesticide suspension agent according to claim 11, wherein The preparation method of the resonance biological pesticide suspension includes: subjecting each component of the raw materials to resonance treatment, and after treatment, mixing with the microbial inoculant to obtain the resonance microbial suspension.

13. The resonance biological pesticide suspension agent according to claim 12, characterized in that, The device for resonance treatment is an electromagnetic vibration device, with a frequency of 146 - 220 KHz and a treatment time of 11 - 15 min.

14. A resonance microbial seed coating agent, comprising the microbial inoculant according to any one of claims 1 - 3.

15. The resonance microbial seed coating agent according to claim 14, characterized in that, The raw materials of the resonance microbial seed coating agent also include the following components, calculated by mass percentage of the microbial inoculant: wetting and dispersing agent 4.2% - 4.5%, thickening agent 9% - 11%, preservative 0.25% - 0.31%, antifreeze 6% - 7%, ultraviolet protection agent 0.7% - 0.8%, penetrant 0.3 - 0.4%, synergist 7.2 - 7.6%, defoaming agent 0.6% - 0.9%, film-forming agent 7% - 12%, warning color 0.3% - 1%, synergist 0.15 - 0.25%, and the following components in molar concentration: PQQ 40 - 60 nmol / L.

16. The resonance microbial seed coating agent according to claim 15, wherein The wetting dispersant is Tween + sodium lignosulfonate, wherein the mass ratio of Tween to sodium lignosulfonate is 1:(0.9 - 1.15); the thickener includes 3% xanthan gum mother liquor; the preservative includes Kathon; the antifreeze includes ethylene glycol; the ultraviolet protectant includes skimmed milk powder; the defoamer includes dimethyl silicone oil; the film-forming agent includes polyvinylpyrrolidone; the warning color includes basic fuchsin; the synergist includes gibberellin.

17. The resonance microbial seed coating agent according to claim 16, wherein The preparation method of the resonance microbial seed coating agent includes: subjecting each raw material component except the microbial agent in the raw materials to resonance treatment, and after treatment, mixing it with the microbial agent to obtain the resonance microbial seed coating agent.

18. The resonance microbial seed coating agent according to claim 17, wherein The equipment for the resonance treatment is an electromagnetic vibration device, with a frequency of 146 - 220 KHz and a treatment time of 11 - 15 min.

19. Application of a resonance microbial seed coating agent according to any one of claims 14 - 18 in pepper, eggplant or Chinese cabbage seeds.

20. The application according to claim 19, wherein The weight ratio of the resonance microbial seed coating agent to the seeds is 1:(100 - 150).

21. Application of a microbial agent according to any one of claims 1 - 3 in the preparation of a preservative.

Images