Rape BnaA09.SCL28 gene as well as promoter and application thereof

Abstract

The invention discloses an oilseed rape BnaA09.SCL28 gene and a promoter and application thereof. The sequence of the oilseed rape BnaA09.SCL28 gene is shown as SEQ ID No.6, and the sequence of the promoter of the oilseed rape BnaA09.SCL28 gene is shown as SEQ ID No.5. Overexpression of the oilseed rape BnaA09.SCL28 gene can increase the size of oilseed rape seeds, increase the seed yield of an oilseed rape single plant, increase the number of effective siliques of oilseed rape, increase the number of seeds per silique of oilseed rape, and increase the height and branching number of oilseed rape plants. The BnaA09.SCL28 gene promoter can drive a target gene to be specifically expressed in buds, siliques or seeds in the early stage of a plant, which indicates that BnaA09.SCL28 can positively regulate longitudinal growth, branch development and reproductive organ formation of the plant, and provides theoretical support for increasing the yield of a single rape plant.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, specifically to the Brassica napus BnaA09.SCL28 gene and its promoter, and also to the application of the Brassica napus BnaA09.SCL28 gene in improving the seed yield or the number of effective pods of Brassica napus, etc. Background Art

[0002] The research on rapeseed yield is an important research direction. Seed size is one of the important traits affecting the yield per plant, providing a practical research direction for improving the yield per plant. In the early stage of this project, with the aim of increasing yield, candidate genes regulating seed size were screened for subsequent research. We sampled seeds of six Brassica species with extremely large and small seeds at 7 developmental stages respectively, and performed high-throughput transcriptome sequencing on fresh seed samples; constructed a WGCNA co-expression network based on the transcriptome sequencing data; analyzed the correlation between gene modules and phenotypic data, screened out key genes highly correlated with the seed size trait, and constructed a co-expression network centered on this gene. According to the constructed transcriptional regulatory network related to seed development and closely related to seed size, we discovered the GRAS family gene BnaA09.SCL28 (SCARECROW-LIKE28) closely related to seed size. There are 5 copies of this gene in Brassica napus, and in Brassica napus ZS11, they are: BnaA09G0131100ZS, BnaA09G0151600ZS, BnaC09G0139000ZS, BnaC09G0164700ZS, and BnaC09G0285400ZS. SCL28 has been proven to be involved in cell cycle regulation, and the research on rapeseed yield and seed traits has not been involved. Therefore, the present invention aims to reveal the molecular mechanism of the Brassica napus BnaA09.SCL28 and its promoter regulating seed size, providing theoretical support for improving the yield of single rapeseed plants. Summary of the Invention

[0003] In view of this, one of the objectives of the present invention is to provide a separated rapeseed BnaA09.SCL28 gene; another objective of the present invention is to provide a promoter of the rapeseed BnaA09.SCL28 gene; a third objective of the present invention is to provide a plant overexpression vector containing the rapeseed BnaA09.SCL28 gene; a fourth objective of the present invention is to provide a plant expression vector containing the promoter of the rapeseed BnaA09.SCL28 gene; a fifth objective of the present invention is to provide the application of the rapeseed BnaA09.SCL28 gene or a plant overexpression vector containing the rapeseed BnaA09.SCL28 gene in uses such as increasing rapeseed seed yield; a sixth objective of the present invention is to provide the application of a plant expression vector containing the promoter of the rapeseed BnaA09.SCL28 gene in driving the specific expression of a target gene in the early-stage flower buds, siliques or seeds of a plant; a seventh objective of the present invention is to provide a method for increasing the seed yield of Brassica napus.

[0004] To achieve the above objectives, the present invention provides the following technical solutions:

[0005] 1. A separated rapeseed BnaA09.SCL28 gene, the nucleotide sequence of the rapeseed BnaA09.SCL28 gene is as shown in SEQ ID No.6.

[0006] 2. The promoter of the rapeseed BnaA09.SCL28 gene, its nucleotide sequence is as shown in SEQ ID No.5.

[0007] 3. A plant overexpression vector containing the rapeseed BnaA09.SCL28 gene, comprising the nucleic acid sequence shown in SEQ ID No.6, and operably linked to a plant promoter, the vector is used for transforming plant cells to overexpress the BnaA09.SCL28 protein, and the plant is Arabidopsis thaliana or rapeseed.

[0008] 4. A plant expression vector containing the promoter of the rapeseed BnaA09.SCL28 gene, comprising the nucleic acid sequence shown in SEQ ID No.5, the vector is used for driving the specific expression of a target gene in the flower buds, early-stage siliques or seeds of a plant, and the plant is Arabidopsis thaliana or rapeseed.

[0009] 5. The rapeseed BnaA09.SCL28 gene or a plant overexpression vector containing the rapeseed BnaA09.SCL28 gene is applied in any of the following uses:

[0010] (1) Increasing the size of rapeseed seeds;

[0011] (2) Increasing the seed yield per plant of rapeseed;

[0012] (3) Increase the number of effective siliques of rapeseed;

[0013] (4) Increase the number of seeds per silique of rapeseed;

[0014] (5) Increase the plant height of rapeseed;

[0015] (6) Increase the number of branches of rapeseed plants.

[0016] 6. Application of a plant expression vector containing the promoter of the rapeseed BnaA09.SCL28 gene in driving the specific expression of a target gene in the early-stage flower buds, siliques or seeds of plants, wherein the plants are Arabidopsis thaliana or rapeseed.

[0017] 7. A method for increasing the seed yield of Brassica napus, comprising the following steps:

[0018] (1) Construct a plant overexpression vector containing the rapeseed BnaA09.SCL28 gene;

[0019] (2) Transform the hypocotyls of rapeseed through Agrobacterium-mediated transformation;

[0020] (3) Screen and obtain transgenic plants with stable overexpression of the BnaA09.SCL28 gene;

[0021] (4) Evaluate the yield improvement effect through 1000-seed weight, the number of siliques per plant or the number of seeds per silique.

[0022] The beneficial effects of the present invention are as follows: The GUS gene vector driven by the BnaA09.SCL28 promoter of the present invention was transferred into Arabidopsis thaliana, and the results showed that the GUS gene had a high expression level in the siliques and seeds on the 5th and 12th days after flowering, indicating that BnaA09.SCL28 has tissue expression specificity in plants. The subcellular localization of the BnaA09.SCL28 protein is in the nucleus.

[0023] To explore the biological function of BnaA09.SCL28, we obtained T-DNA insertion mutant atscl28, Arabidopsis thaliana plants with heterologous overexpression of BnaA09.SCL28 and gene-edited plants. Through phenotypic observation of transgenic Arabidopsis thaliana, we found that compared with Col-0, the seeds of the atscl28 plant line were smaller, the root system did not change significantly, but the number of effective siliques per plant decreased significantly; while the seeds of the heterologous overexpression Arabidopsis thaliana plants were larger, the number of effective siliques per plant increased, and the root system grew significantly. After entering the reproductive growth period, the mutant showed obvious developmental defect phenotypes, including reduced plant height and number of branches; on the contrary, the plant height and number of branches of the overexpression line increased. The above phenotypic results indicate that BnaA09.SCL28 may also positively regulate the longitudinal growth, branch development and reproductive organ formation of plants.

[0024] To explore whether the biological function of BnaA09.SCL28 in rapeseed is consistent with that in Arabidopsis thaliana, the agronomic traits of transgenic rapeseed plants were investigated. Through the analysis of integrated data results, we found that the plant height of overexpressing transgenic rapeseed increased, the 1000-seed weight increased, the number of seeds per silique increased, and the seeds became larger; the gene-edited plants showed reverse phenotypes such as shorter plant height, shorter silique length, smaller seeds, lower 1000-seed weight, and fewer effective siliques per plant, further confirming that BnaA09.SCL28 positively regulates seed size. At the same time, we investigated the other traits of rapeseed and found that the number of seeds per silique increased and the number of effective siliques per plant increased in overexpressing rapeseed, while the siliques of gene-edited plants became shorter and the number of effective siliques per plant decreased significantly, indicating that BnaA09.SCL28 also positively regulates silique development, providing a new idea for subsequent research on improving silique development and increasing yield per unit area. Brief Description of the Drawings

[0025] To make the objectives, technical solutions, and beneficial effects of the present invention clearer, the present invention provides the following drawings for description:

[0026] Figure 1 Analysis of BnaA09.SCL28 gene expression level; A: Detection of the expression of BnaA09.SCL28 in Brassica napus by qRT-PCR; Note: silique-2d and silique-4d are siliques at 2 days and 4 days after flowering; seed-24 and seed-28 are seeds at 24 days and 28 days after flowering; leaf-16d is the leaf at 16 days; Bud is the bud at the bud stage; root is the root; silique-wall-14d and silique-wall-21d are silique walls at 14 days and 21 days after flowering; B: Prediction of the expression pattern by the BrassicaBnIR website.

[0027] Figure 2 Construction of the BnaA09.SCL28 promoter vector; A: Cloning of the BnaA09.SCL28 promoter; B: Detection of the pCambia1305.1-proBnaA09.SCL28 bacterial solution.

[0028] Figure 3 PCR identification of positive proBnaA09.SCL28 transgenic Arabidopsis thaliana plants; M13p-F + proBnaA09.SCL28-R (upper), proBnaA09.SCL28-F + M13p-R (lower).

[0029] Figure 4 Tissue expression specificity of BnaA09.SCL28 pro::GUS; A: Young whole plant; B: Young root; C: Inflorescence; D-F: Early siliques and seeds; H: Early seed pods; I: Mature seeds.

[0030] Figure 5 For the construction of the pYLCRISPR / Cas9-BnaA09.SCL28 vector; A: Detection of sgRNA expression cassette amplification by electrophoresis; B: Detection of the pYLCRISPR / Cas9-BnaA09.SCL28 vector bacterial liquid (PB-L + PB-R).

[0031] Figure 6 For the detection of the expression level of BnaA09.SCL28 in overexpressing Arabidopsis plants (A) and mutants (B).

[0032] Figure 7 For the observation of the seed phenotypes of Arabidopsis plants; A: Observation of the seed phenotypes of Arabidopsis mutants atscl28 (i.e., cr-scl28) and overexpressing Arabidopsis OV-SCL28; B: Comparison of the areas of Col with atscl28 and 0V-SCL28; p < 0.0001, indicated by "****".

[0033] Figure 8 For the observation of the phenotypes of Arabidopsis plants; A: Comparison of root development between Arabidopsis Col and OV-SCL28; B: Mature plants of the Arabidopsis atscl28 mutant; C: Mature plants of overexpressing Arabidopsis; D: Comparison of the number of effective siliques per plant of Col-0, atscl28, and OV-SCL28; p < 0.0002, indicated by "***"; p < 0.01, indicated by "**"; p < 0.05, indicated by "*".

[0034] Figure 9 For the process of genetic transformation of overexpressing BnaA09.SCL28 into rapeseed; A: Sowing of rapeseed; B: Agrobacterium infection of hypocotyls; C: Formation of callus from hypocotyls; D: Seedling formation of overexpressing plants; E: Hydroponic rapeseed; F: Transplanting to the transgenic material field.

[0035] Figure 10 For the analysis of the gene expression level of BnaA09.SCL28 in overexpressing rapeseed plants (A) and the analysis of the knockout sites in knockout transgenic rapeseed (B).

[0036] Figure 11 For the observation of the phenotypes of overexpressing rapeseed lines; A: Phenotypes of OV-SCL28 and ZS11 at the bolting stage; B: Statistics of 1000-seed weight phenotypes; C: Statistics of the number of seeds per silique; D: Observation of the seed size phenotypes of overexpressing rapeseed; p < 0.0001, indicated by "****", p < 0.0002, indicated by "***", p < 0.01, indicated by "**", p < 0.05, indicated by "*".

[0037] Figure 12Phenotypic observation of rapeseed knockout lines; A: Phenotypic observation of CRI-SCL28 and ZS11 at the bolting stage; B: Phenotypic observation of silique length; C: Phenotypic observation of seed size in knockout rapeseed; D: Thousand-seed weight phenotypic statistics; E: Silique number per plant statistics; F: Silique length phenotypic statistics; p < 0.0001 is indicated by "****", p < 0.0002 is indicated by "***", p < 0.01 is indicated by "**", and p < 0.05 is indicated by "*". Detailed implementation manners

[0038] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the exemplified embodiments are not intended to limit the present invention.

[0039] Example 1. Analysis of BnaA09.SCL28 expression pattern

[0040] In order to accurately explore the spatio-temporal expression pattern of BnaA09.SCL28, the expression of the BnaA09.SCL28 gene in different growth stages and different tissue parts of Brassica napus ZS11 was first detected. qPCR used the pre-mixed system of real-time fluorescence quantitative PCR by the dye method (SYBR Green) of Green qPCR MasterM (Bomai De, Beijing).

[0041] Forward Primer: GTAGCTGTCGTTATTGCGGAAC (SEQ ID NO.1);

[0042] Reverse Primer: ACCTCCTCGATCTTAACCCTCA (SEQ ID NO.2).

[0043] The reaction solution system is as shown in Table 1 below:

[0044] Table 1 qRT-PCR reaction system

[0045]

[0046] The above mixture was placed in a CFX96 Touch fluorescence quantitative PCR instrument (Bio-Rad, USA).

[0047] The reaction program is as shown in Table 2 below (when the Tm of most primers is 60 °C, a two-step rapid amplification method can be used, that is, melting curve analysis is not performed):

[0048] Table 2 qRT-PCR setting program

[0049]

[0050] According to the qRT-PCR results, BnaA09.SCL28 was highly expressed in early flower buds, siliques and seeds, and had low or no expression in other parts ( Figure 1 , A). The qRT-PCR results were consistent with the expression of BnaA09.SCL28 in different tissues of ZS11 at different stages in Brassica BnIR (http: / / cbi.hzau.edu.cn / bnapus / ), and it was expressed in early pods, seeds and flower buds at the budding stage ( Figure 1 , B).

[0051] Example 2. Construction of BnaA09.SCL28 promoter vector

[0052] Using the whole genome DNA of rapeseed ZS11 as a template, and proBnaA09.SCL28-F: gagctcggtacccggggatccACTAAGCCCATTAGTTTTGAAACTTC (SEQ ID No.3) and proBnaA09.SCL28-R: taccctcagatctaccatggCCTCTACAAAAATATCTACCCACCC (SEQ IDNo.4) as primers to amplify the promoter sequence (SEQ ID No.5) about 2000bp upstream of BnaA09.SCL28, and a target band of about 2000bp was obtained ( Figure 2 , A), and the band size was consistent with the expectation. Subsequently, the pCambia1305.1 vector was treated by double digestion with HindIII and NcoI, and the linearized vector was recovered by gel electrophoresis. The recovered promoter fragment was recombined with the digested vector, and the recombinant product was transformed into Escherichia coli competent cells. The transformed strains were screened using primer pairs M13p-F + proBnaA09.SCL28-R and proBnaA09.SCL28-F + M13p-R, and 12 clones verified to be correct by bacterial inspection were obtained ( Figure 2 , B). Subsequently, the confirmed correct strains were sent to BGI for sequencing, and the sequencing results were compared using Geneious software. It was found that the homology between the cloned gene sequence and the expected target fragment was as high as 99.7%, indicating that the pCambia1305.1-proBnaA09.SCL28 promoter vector had been successfully constructed, hereinafter referred to as the BnaA09.SCL28 pro::GUS vector.

[0053] Example 3. Obtaining and identification of positive Arabidopsis plants transformed with the promoter vector

[0054] In this invention, Arabidopsis thaliana plants at the flowering stage were transformed with Agrobacterium carrying the BnaA09.SCL28 pro::GUS vector, and T0 generation seeds were obtained by the floral dip method. After sowing, the seeds were placed on 1 / 2MS solid medium containing Hyg (25 mg / mL) to screen for positive plants. After the plant roots developed well and grew normally, they were transplanted into nutrient soil. Subsequently, leaf DNA was extracted using a kit, and two pairs of primers, M13p-F+proBnaA09.SCL28-R and proBnaA09.SCL28-F+M13p-R, were used to perform PCR identification on the plants. Plants with corresponding bands were positive. The results showed that 15 positive plants ( Figure 3 ) were successfully screened out, and these positive lines would continue to be used for subsequent GUS staining experiments.

[0055] After screening for promoter-positive plants and multiplying them to the T3 generation, different tissue parts of the positive plants at different developmental stages were subjected to GUS staining using the prepared GUS staining solution (without X-Gluc) as follows:

[0056] (1) Place the plants in centrifuge tubes, add 90% acetone to submerge the plant tissues, fix for 20 min, and then discard the acetone (pour carefully to prevent damage to the plants);

[0057] (2) Rinse the materials with GUS staining solution without X-Gluc;

[0058] (3) Add GUS staining solution (containing X-Gluc), and under a dark environment, subject the materials to vacuum treatment for 20 min;

[0059] (4) Carefully wrap the centrifuge tubes, incubate the plant tissues at 37°C in the dark for 24 h, then pour out the GUS staining solution, add 75% ethanol to elute the materials (the ethanol can be replaced as needed to better remove chlorophyll), and soak at room temperature for 24 h (note to cover to prevent ethanol evaporation);

[0060] (5) After the elution is completed, observe and photograph the GUS histochemical staining results of Arabidopsis thaliana using a ZS61 stereomicroscope.

[0061] The experimental results showed that in the siliques and seeds at 3 days, 6 days, and 8 days after flowering, the GUS gene showed a relatively high expression level, while at the four true leaf stage, the GUS signal was mainly concentrated in the roots and the expression level in the leaves was relatively low. However, at 21 days after flowering, the GUS gene was hardly expressed in the leaves, siliques, and seeds ( Figure 4 ). These results indicate that the promoter of the BnaA09.SCL28 gene has clear tissue-specific expression in plants.

[0062] Example 4. Construction of overexpression vector of BnaA09.SCL28

[0063] Through the website Brassica BnIR( http: / / cbi.hzau.edu.cn / bnapus / ) it was predicted that BnaA09.SCL28 was most highly expressed in early seeds of rapeseed. Therefore, the cDNA of ZS11 early seeds was used as a template to amplify the CDS sequence of BnaA09.SCL28. A band of about 1900 bp (SEQ ID No. 6) was cloned. After obtaining the target fragment by gel recovery, it was ligated with the pEASY-Blunt Simple vector. The bacterial solution of transformed Escherichia coli was screened using primers M13F + OE-BnaA09.SCL28-R and M13R + OE-BnaA09.SCL28-F. A band of about 2000 bp was selected for sequencing, and the target fragment of BnaA09.SCL28 was successfully obtained. Subsequently, the target fragment was transferred from the entry vector to the expression vector pEarlyGate101 through an LR reaction and transformed into Escherichia coli. Two pairs of primers, F35SND + OE-BnaA09.SCL28-R and OCS5NDR + OE-BnaA09.SCL28-F, were used to further screen the transformed strains. The sequencing results were aligned with the target sequence, showing a 100% consistency, and the overexpression vector pEarlyGate101-BnaA09.SCL28 was successfully constructed.

[0064] OE-BnaA09.SCL28-F: gccaactttgtacaaaaaagcaggctccATGTTGGCAGGTTGTTCAAGTTCATC(SEQ ID No. 7);

[0065] OE-BnaA09.SCL28-R: caactttgtacaagaaagctgggtcAGAACTCCCTCCGACACTCCAAGCCG(SEQ ID No. 8).

[0066] Example 5. Construction of pYLCRISPR / Cas9-BnaA09.SCL28 gene editing vector

[0067] Using the Atu3d vector as a template, amplification was performed respectively with primers BnaA09.SCL28-T1-R+U-F, BnaA09.SCL28-T1-F+gR-R, primers BnaA09.SCL28-T2-R+U-F and BnaA09.SCL28-T2-F+gR-R, primers BnaA09.SCL28-T3-R+U-F and BnaA09.SCL28-T3-F+gR-R, primers BnaA09.SCL28-T4-R+U-F and BnaA09.SCL28-T4-F+gR-R. Lanes 1 and 2 are the sgRNA-T1 expression cassette, lanes 3 and 4 are sgRNA-T2, lanes 5 and 6 are the sgRNA-T3 expression cassette, and lanes 7 and 8 are the sgRNA-T4 expression cassette( Figure 5 , A).

[0068] Using the sgRNA-T1 expression cassette as a template, PCR amplification was performed with primers Pps-GGL and Pgs-GG2, and the final sgRNA-T1 expression cassette of approximately 300 bp was successfully obtained. Using the sgRNA-T2 expression cassette as a template, PCR amplification was performed with primers Pps-GG2 and Pgs-GG3, and the final sgRNA-T2 expression cassette of approximately 300 bp was successfully obtained. Using the sgRNA-T3 expression cassette as a template, PCR amplification was performed with primers Pps-GG3 and Pgs-GG4, and the final sgRNA-T3 expression cassette of approximately 300 bp was successfully obtained. Using the sgRNA-T4 expression cassette as a template, further amplification was performed with primers Pps-GG4 and Pgs-GGR to obtain the final sgRNA-T4 expression cassette of 300 bp. The final expression cassettes of sgRNA-T1, sgRNA-T2, sgRNA-T3 and sgRNA-T4 were respectively recombined with the pYLCRISPR / Cas9 P35s-N vector, and the recombinant products were transformed into Escherichia coli competent cells. The transformed strains were screened using primers PB-L and PB-R, and 12 clones that were confirmed to be correct by bacterial inspection were obtained (see Figure 5 , B). These strains were sent to Tsingke Biotechnology Company for sequencing, and the sequencing results were compared using Geneious software. The results showed that the homology between the cloned gene sequence and the target fragment reached 100%. This result indicates that pYLCRISPR / Cas9-BnaA09.SCL28 was successfully obtained.

[0069] BnaA09.SCL28-T1-F: TCACTCCTTAATCTTCTGGTgttttagagctagaaat (SEQ ID No.9)

[0070] BnaA09.SCL28-T1-R: ACCAGAAGATTAAGGAGTGATgaccaatggtgctttg (SEQ ID No.10)

[0071] BnaA09.SCL28-T2-F: CAGTAGTAACTTCCCCCGCAgttttagagctagaaat (SEQ ID No.11)

[0072] BnaA09.SCL28-T2-R: TGCGGGGGAAGTTACTACTGTgaccaatggtgctttg (SEQ ID No.12)

[0073] BnaA09.SCL28-T3-F: GAGCATAAAGCTTCCACCTTgttttagagctagaaat (SEQ ID No.13)

[0074] BnaA09.SCL28-T3-R: AAGGTGGAAGCTTTATGCTCTgaccaatggtgctttg (SEQ ID No.14)

[0075] BnaA09.SCL28-T4-F: CTTGTCTGAGCAGAGTGAAGgttttagagctagaaat (SEQ ID No.15)

[0076] BnaA09.SCL28-T4-R: CTTCACTCTGCTCAGACAAGTgaccaatggtgctttg (SEQ ID No.16)

[0077] Example 6. Obtaining and phenotypic analysis of transgenic Arabidopsis thaliana

[0078] I. Screening and identification of overexpressed transgenic Arabidopsis thaliana positive plants

[0079] In this study, the inflorescence infiltration method was successfully used to obtain heterologous overexpression lines of Arabidopsis thaliana. Agrobacterium tumefaciens containing the pEarleyGate101-BnaA09.SCL28 vector was transformed into Arabidopsis thaliana Col-0. After harvesting the T0 generation seeds, they were planted on 1 / 2 MS medium containing the screening agent Basta (150 mg / L). After about 10 days of culture, when the plants had grown four true leaves, they were transplanted into nutrient soil and continued to be cultured for two more weeks until the leaves grew well. Subsequently, a kit was used to extract leaf DNA for PCR identification. Electrophoresis analysis showed that 6 transgenic Arabidopsis thaliana lines overexpressing OV-BnaA09.SCL28 were successfully obtained. The expression levels of the BnaA09.SCL28 gene in these 6 plants were further detected ( Figure 6 , A), and the results showed that the expression levels of BnaA09.SCL28 in all samples were significantly up-regulated. Based on this, the three lines with the highest expression levels (OV-AtSCL28-6, OV-AtSCL28-12, OV-AtSCL28-16) were selected for subsequent studies.

[0080] II. Obtaining and identification of Arabidopsis thaliana mutants

[0081] To further explore the function of BnaA09.SCL28, the T-DNA insertion mutant line of Arabidopsis thaliana atscl28 (AT1G63100) was purchased from the ABRC website. It was sown on blank 1 / 2 MS medium. After the plants were transplanted into nutrient soil and grown for two weeks, a kit was used to extract Arabidopsis thaliana leaf DNA, and the insertion of T-DNA in atscl28 plants was analyzed using the primers LP+RP and LB+RP, respectively. When the homozygous mutant was detected with the primer LP+RP, no band was observed, while when detected with the primer LB+RP, a band of approximately 500 bp was observed. The leaf RNA of the homozygous mutant was extracted and reverse-transcribed into cDNA, and the expression level of the AtSCL28 gene in the leaves of the homozygous line was detected using qRT-PCR ( Figure 6 , B), and the three lines with the lowest expression levels, namely atscl28-4 / -6 / -11, were selected for subsequent experiments.

[0082] III. Observation of Arabidopsis thaliana plant phenotypes

[0083] To explore the biological function of the BnaA09.SCL28 gene, this study compared wild-type Arabidopsis thaliana Col-0, the T-DNA insertion mutant atscl28 (or cr-scl28), and the transgenic plant OV-AtSCL28 (or OV-SCL28) overexpressing BnaA09.SCL28. The seed morphology was observed by electron microscopy, and the seed area was measured using ImageJ software. The results showed that, compared with Col-0, the seed surface area of atscl28 was significantly reduced, while the seed area of OV-SCL28 was significantly increased compared with Col-0 ( Figure 7 , A-B). These experimental results indicate that BnaA09.SCL28 plays an important role in positively regulating plant seed size.

[0084] This study also performed phenotypic observations of Col-0, OV-SCL28, and atscl28 throughout the growth period. Under the in vitro culture system of 1 / 2MS medium, phenomics analysis showed that: during the vegetative growth stage, there was no significant difference in the primary root length of the atscl28 mutant compared with Col-0, while the elongation of the primary root of the OV-SCL28 line was increased compared with Col-0 ( Figure 8 , A). After entering the reproductive growth stage, the mutant showed obvious developmental defect phenotypes, including reduced plant height and fewer branches; on the contrary, both the plant height and the number of branches of the overexpression line increased ( Figure 8 , B-C). Agronomic trait data analysis showed that this gene specifically affected silique development. The number of effective siliques per plant of OV-SCL28 was increased compared with the control, while that of the mutant was decreased ( Figure 8 , D). The above phenotypic results indicate that BnaA09.SCL28 positively regulates the longitudinal growth, branch development, and formation of reproductive organs of plants.

[0085] Example 7. Obtaining and phenotypic analysis of transgenic rapeseed

[0086] I. Identification of overexpressing transgenic rapeseed

[0087] In this experiment, the hypocotyl genetic transformation method of Brassica napus ZS11 was used, and the hypocotyls of rapeseed were infected with Agrobacterium carrying the pEarleyGate101-BnaA09.SCL28 overexpression vector. After Agrobacterium infection, the rapeseed hypocotyls formed buds, leaves, and roots through the tissue differentiation process. Subsequently, the plants were further cultured under hydroponic conditions and transplanted into the soil, and finally successfully grew into complete plants ( Figure 9 ).

[0088] DNA was extracted from the leaves of the germinated rapeseed plants, and the positive plants were identified by PCR method. The plants with the expected bands were judged as positive. A total of 6 positive transgenic plants were screened. Subsequently, the RNA of these 6 transgenic rapeseed plants was extracted, reverse transcribed into cDNA, and their gene expression levels were analyzed by qPCR. The results showed that the expression levels of the BnaA09.SCL28 gene (OE-BnaA09.SCL28-3 / 11) in 2 of these 6 transgenic plants were significantly up-regulated compared with ZS11 ( Figure 10 , A), indicating that they had strong transgenic expression and were suitable for subsequent experimental research.

[0089] II. Identification of rapeseed knockout plants

[0090] After obtaining the knockout vector pYLCRISPR / Cas9-BnaA09.SCL28 Agrobacterium, transgenic rapeseed plants were obtained by Agrobacterium-mediated transformation of the hypocotyls of Brassica napus. The DNA of the plant leaves was extracted and the Cas9 protein was detected using the universal primers cas9-F + cas9-R. The expected band size was about 300 bp, and 8 positive plants were obtained. The DNA of the positive plants containing the Cas9 protein was used to amplify the target gene, and the PCR products with the expected fragments were subjected to Hi-TOM sequencing. By analyzing the sequencing results, 1 plant had a base deletion, 1 plant had a base insertion resulting in an early stop codon, and 2 plants had base insertions, and the protein could not be normally encoded. 5 bases were deleted at the 44-48th bases downstream of ATG, resulting in the premature termination of the encoded protein sequence at the 18th amino acid, and it was named cri-BnaA09.SCL28-1. 3 bases were inserted at the 324th base downstream of ATG, resulting in the insertion of additional amino acids after the 108th amino acid of the protein encoded by this gene, and it was named cri-BnaA09.SCL28-4, cri-BnaA09.SCL28-8 ( Figure 10 , B). Subsequently, the T1 generation plants were identified, and the same editing sites led to the inability to correctly encode the protein.

[0091] III. Phenotype observation of BnaA09.SCL28 transgenic rapeseed plants

[0092] Based on the previous phenotypic analysis in the model plant Arabidopsis thaliana, we confirmed that the BnaA09.SCL28 gene has a significant positive regulatory effect on seed size and shows a potential positive regulatory effect on yield. To further verify the biological function of this gene, in this study, we constructed stably inherited overexpression lines (OE-BnaA09.SCL28-3 / 11) and CRISPR / Cas9-mediated gene-edited mutants (cri-BnaA09.SCL28-1 / 4 / 8) to systematically evaluate the effects of this gene on the key agronomic traits of Brassica napus. Phenotypic analysis showed that compared with the wild type ZS11, the overexpression lines showed significant changes in seed morphological characteristics, yield-related parameters, etc., specifically manifested as increased plant height, increased 1000-seed weight, significantly increased number of seeds per silique, and larger seeds ( Figure 11 , A-D).

[0093] In contrast, the gene knockout mutants showed reverse phenotypes such as shorter plant height, shorter silique length, smaller seeds, lower 1000-seed weight, and fewer effective siliques per plant ( Figure 12 , A-F). Through cross-species phenotypic consistency analysis (Arabidopsis thaliana - Brassica napus) and cross-validation of multi-omics data, we confirmed that BnaA09.SCL28 plays a key role in positively regulating seed size and yield formation by regulating silique development and seed size. This finding provides an important theoretical basis for analyzing the molecular regulatory network of rapeseed grain development and crop genetic improvement.

[0094] The above-described embodiments are only preferred embodiments given to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. An isolated rapeseed BnaA09.SCL28 gene, characterized in that, The nucleotide sequence of the rapeseed BnaA09.SCL28 gene is shown in SEQ ID No.

6.

2. The promoter of the rapeseed BnaA09.SCL28 gene according to claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID No.

5.

3. The plant overexpression vector containing the rapeseed BnaA09.SCL28 gene, characterized in that, A vector comprising the nucleic acid sequence shown in SEQ ID No. 6 and operably linked to a plant promoter, the vector being used for transforming plant cells to overexpress the BnaA09.SCL28 protein, the plant being Arabidopsis thaliana or rapeseed.

4. A plant expression vector containing the promoter of the rapeseed BnaA09.SCL28 gene, characterized in that, A vector comprising the nucleic acid sequence shown in SEQ ID No. 5, the vector being used to drive the specific expression of a target gene in the flower buds, early siliques or seeds of a plant, the plant being Arabidopsis thaliana or rapeseed.

5. The application of the rapeseed BnaA09.SCL28 gene according to claim 1 or the plant expression vector according to claim 3 in any of the following uses: (1) Increasing the size of rapeseed seeds; (2) Increasing the seed yield per plant of rapeseed; (3) Increasing the number of effective siliques of rapeseed; (4) Increasing the number of seeds per silique of rapeseed; (5) Increasing the plant height of rapeseed; (6) Increasing the number of branches of rapeseed plants.

6. Use of the plant expression vector according to claim 4 in driving specific expression of a target gene in early-stage flower buds, siliques or seeds of a plant, characterized in that, The plant is Arabidopsis thaliana or rapeseed.

7. A method for increasing the seed yield of Brassica napus, characterized in that, Comprising the following steps: (1) Constructing the plant overexpression vector according to claim 3; (2) Transforming the hypocotyls of rapeseed by Agrobacterium-mediated transformation; (3) Screening to obtain transgenic plants with stable overexpression of the BnaA09.SCL28 gene; (4) Evaluating the yield improvement effect by 1000-seed weight, the number of siliques per plant or the number of seeds per silique.

Images