Method for improving citrus liberobacter asiaticum resistance by using CsZRK1 gene
Through CRISPR/Cas9 technology, the site-directed mutation of CsZRK1 gene was solved, and the problem of insufficient resistance to citrus Huanglong disease was significantly improved, and the resistance of citrus to Huanglong disease was greatly improved, which has important breeding application value.
Patent Information
- Application Number
- CN202510516005.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-23
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2045-04-23
AI Technical Summary
No varieties that are resistant to citrus Huanglong disease have been cultivated yet. The reason is that the inaffinity of distant hybridization leads to a scarcity of resistance gene resources, and it is difficult to analyze the pathogenic mechanism of molecular mechanism research, and there are limitations in existing genetic engineering methods.
CRISPR/Cas9 technology site-directed mutation of the CsZRK1 gene, causing its function to be lost, thereby improving the resistance of citrus to Huanglong disease. CsZRK1 gene editing is used to mediate the sgRNA guidance sequence.
It significantly improves the resistance of citrus to Huanglong disease and does not affect the phenotype of transgenic plants, and has important breeding application value.
Smart Images

Figure CN120350037A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, and particularly relates to a method for improving the Huanglong disease resistance of citrus by using the CsZRK1 gene. Background Art
[0002] Citrus is the fruit with the largest planting area and output in China. The development of its industry faces a major threat - Huanglong disease (HLB) of citrus, which is caused by bacteria of the genus Candidatus Liberibacter and is transmitted by the Asian citrus psyllid. Currently, there are three pathogenic bacteria in total, namely Candidatus Liberibacter asiaticus (CLas), Candidatus Liberibacter americanus (CLam), and Candidatus Liberibacter africanus (CLaf). Among them, CLas has the strongest pathogenicity and has become the main pathogenic species of current citrus Huanglong disease.
[0003] Currently, no citrus varieties resistant to Huanglong disease have been cultivated. The core reason is the lack of resistance gene resources due to distant hybridization incompatibility. Although rootstock hybridization breeding has improved the tolerance of rootstocks to HLB by screening related germplasms, it cannot be inherited to the scions, and there are problems such as reproductive isolation and chimera formation in cross-species hybridization, which limit the creation of resistant varieties. The research on molecular mechanisms also faces major challenges: the pathogenic bacteria cannot be cultured in vitro artificially, making it difficult to analyze the pathogenic mechanism; the host disease-resistant signaling pathways, key genes, and immune response systems have not been systematically elucidated. Therefore, it is necessary to deepen the analysis of the citrus disease-resistant molecular mechanism and systematically explore key disease-resistant genes.
[0004] With the booming development of molecular biotechnology, using genetic engineering technology to introduce foreign genes into citrus has become a relatively popular method in the field of current disease-resistant variety cultivation. By introducing disease-resistant genes, strong resistance can be imparted to citrus. For example, Zou et al. found that overexpressing the key enzyme gene CsSAMT1 for MeSA synthesis can increase the contents of SA and MeSA hormones in citrus and enhance the resistance of citrus to Huanglong disease; Zheng et al. found that overexpressing SABP2 can increase the contents of SA and MeSA hormones and the resistance to Huanglong disease in citrus; Xu et al. used the endolysin genes LasLYS1 and LasLYS2 in the phage of Huanglong disease pathogen to improve the resistance of citrus to HLB, and LasLYS2 has significant and lasting resistance to HLB.
[0005] The invasion of pathogenic bacteria triggers a powerful defense mechanism in plants. To cause diseases, pathogenic bacteria usually need to evade host detection or inhibit the immune response. Pattern recognition receptors (PRRs) on the surface of plant cells can recognize conserved pathogen- / microbe- / herbivore-associated molecular patterns (PAMP / DAMP / MAMP / HAMPs), activate pattern-triggered immunity (PTI), and thus limit their pathogenicity. PRRs are associated with the plasma membrane and are usually receptor-like kinases (RLKs) or receptor-like proteins (RLPs) lacking a protein kinase domain. Pathogens secrete effector proteins to evade or inhibit PTI, resulting in effector-triggered susceptibility (ETS). In turn, plants have evolved nucleotide-binding leucine-rich repeat receptors (NLRs) to detect effectors encoded by resistance (R) genes and activate effector-triggered immunity (ETI) based on effector perception. Pathogens may also evolve, diversify, or utilize effector proteins to inhibit or evade ETI.
[0006] ZRK1 encodes an atypical kinase that lacks some key domains essential for catalysis in the kinase catalytic core. Mace and Murphy et al. found that atypical kinases play multiple roles as signal transduction components of gene networks. For example, the atypical kinase ILK1 promotes disease resistance in Arabidopsis by interacting with cation transporters. ZRK1 is involved in restricting the spread of bacteria from the infection site without visible cell death phenotypes. Huard et al. found that, similar to other broad-spectrum QTL-R genes, ZRK1 confers resistance to different races and all pathogenic variants of Xanthomonas campestris pv. citri. Burdett et al. demonstrated that ZRK1 is a component of the NLR disease resistance complex. These results suggest that ZRK1 may be part of the signal transduction for responding to the recognition of various pathogen determinants and coordinating the expression of related genes in the plant immune system.
[0007] In view of this, the present patent application is proposed. Summary of the Invention
[0008] The present invention provides a method for improving the Huanglongbing tolerance of citrus by using the CsZRK1 gene. By mediating the sgRNA guiding sequence of the CsZRK1 gene mutated by CRISPR / Cas9, the resistance of citrus to Huanglongbing can be significantly improved without affecting the phenotype of transgenic plants, which has great application value in citrus breeding for Huanglongbing resistance and can be used as a candidate gene for Huanglongbing resistance breeding with multiple Huanglongbing-resistant and -susceptible genes.
[0009] The present invention adopts the following technical solutions:
[0010] The object of the present invention is to provide a method for improving the resistance of citrus to Huanglongbing by using the CsZRK1 gene, and to improve the resistance of citrus plants to Huanglongbing by mutating the CsZRK1 gene. The nucleotide sequence of the CsZRK1 gene is shown in SEQ ID NO: 1.
[0011] Preferably, the method for mutating the CsZRK1 gene is: using CRISPR / Cas9 technology to site-directedly mutate the CsZRK1 gene, so that the protein encoded by the CsZRK1 gene loses its function.
[0012] Preferably, the process of site-directed mutation of the CsZRK1 gene using CRISPR / Cas9 technology is:
[0013] (1) Sequencing to determine the genome structure of CsZRK1;
[0014] (2) Screening of sgRNA guide sequences for editing the CsZRK1 gene;
[0015] (3) Construction of a CRISPR / Cas9 vector containing the sgRNA guide sequence of the CsZRK1 gene;
[0016] (4) The CRISPR / Cas9 vector was used to transform citrus to obtain a mutant strain with a mutation in the CsZRK1 gene.
[0017] Preferably, in step (1), the method for sequencing to ascertain the structural sequence of the citrus CsZRK1 genome is:
[0018] Using the citrus genome as a template, PCR primers TF and TR were used to amplify the full-length sequence of the CsZRK1 genome, and sequencing was performed to determine the sequence characteristics of its introns and exons.
[0019] Preferably, the CsZRK1 genome structure sequence is shown in SEQ ID No:5.
[0020] Preferably, the nucleotide sequence of the PCR primer TF is shown in SEQ ID No: 3;
[0021] The nucleotide sequence of the PCR primer TR is shown in SEQ ID No:4.
[0022] Preferably, in step (2), the screening process of the sgRNA guide sequence for editing the CsZRK1 gene is:
[0023] First, six sgRNA sequences S1, S2, S3, S4, S5, and S6 were screened according to the online website, and their nucleotide sequences are shown in SEQ ID No: 6, SEQ ID No: 7, SEQ ID No: 8, SEQ ID No: 9, SEQ ID No: 10, and SEQ ID No: 11, respectively;
[0024] Then, the sgRNA sequences S1, S2, S3, and S5 that guide Cas9 to cut CsZRK1 were screened by in vitro digestion.
[0025] Preferably, E365-E368_94-Cas9 endonuclease was used for the in vitro digestion screening.
[0026] Preferably, the CRISPR / Cas9 vector containing the sgRNA guiding sequence of the CsZRK1 gene is a tRNA-mediated multi-site editing vector.
[0027] Preferably, the construction process of the CRISPR / Cas9 vector containing the sgRNA guiding sequence of the CsZRK1 gene is as follows:
[0028] CRISPR / Cas9 vectors containing the guiding sequences of S1 and S2, and S3 and S5 were constructed respectively to obtain the pNG-Cas9-CsZRK1-S1S2 plant expression vector and the pNG-Cas9-CsZRK1-S3S5 plant expression vector.
[0029] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0030] 1. A method for improving the resistance of citrus to Huanglongbing by using the CsZRK1 gene provided in the embodiment of the present invention, by cloning the coding sequence of the citrus CsZRK1 gene, constructing a CRISPR / Cas9 mutant vector, and then transforming citrus, the incidence of Huanglongbing in the transgenic plant hairy roots is significantly reduced;
[0031] 2. A method for improving the resistance of citrus to Huanglongbing by using the CsZRK1 gene provided in the embodiment of the present invention, by integrating the citrus CsZRK1 gene mutant vector into citrus, can significantly improve the resistance of citrus to Huanglongbing and does not affect the phenotype of the transgenic plant;
[0032] 3. A method for improving the resistance of citrus to Huanglongbing by using the CsZRK1 gene provided in the embodiment of the present invention, by constructing a CRISPR / Cas9 mutant vector of the CsZRK1 gene, can greatly improve the resistance of the transgenic plant to Huanglongbing, which has great application value for the breeding of citrus resistant to Huanglongbing and can be used as a candidate gene for Huanglongbing resistance breeding with multiple Huanglongbing resistant and susceptible genes. Description of the Drawings
[0033] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following will briefly introduce the drawings required in the embodiments. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings. In the drawings:
[0034] Figure 1 Schematic diagram of the screening of sgRNA and the construction of plant expression vector in the implementation case of the present invention: Among them, (AB) are respectively the structure of the CsZRK1 gene, its sgRNA sequence and position, (C) is the in vitro activity detection of sgRNA, and (D) is the schematic diagram of the plant expression vector structure for editing CsZRK1; S1-S6: sgRNA; M: DNA molecular marker; CK: control;
[0035] Figure 2 Schematic diagram of the identification of hairy roots with multiple-site edited mutations of CsZRK1 mediated by CRISPR / Cas9 and amino acid sequence alignment in the implementation case of the present invention, (A) identification of mutant hairy roots, (B) amino acid sequence alignment of mutant hairy roots; yellow represents gene mutation. From top to bottom in Figure B are the control, line 1, and line 5;
[0036] Figure 3 Schematic diagram of the resistance evaluation of the mutant to Huanglongbing (HLB) in the implementation case of the present invention: (A) phenotypic observation, (B) content of CaLas in transgenic hairy roots; EV: pNG-Cas9 empty control, S1S2-#: pNG-Cas9-CsZRK1 mutant (# represents 1 or 5); * represents significant differences in bacterial titers. Detailed implementation manners
[0037] To make the purpose, technical solutions and advantages of the present invention clearer and more understandable, the following will further elaborate on the present invention in combination with the implementation cases and drawings. The illustrative embodiments of the present invention and their descriptions are only used to explain the present invention and do not limit the present invention.
[0038] In the following description, a large number of specific details are set forth in order to provide a thorough understanding of the present invention. However, it is obvious to those of ordinary skill in the art that the present invention does not have to be implemented with these specific details. In other implementation cases, well-known structures, circuits, materials or methods are not specifically described in order to avoid confusing the present invention.
[0039] Throughout the specification, reference to "an implementation case", "implementation case", "an example" or "example" means that a specific feature, structure or characteristic described in conjunction with the implementation case or example is included in at least one implementation case of the present invention. Therefore, the phrases "an implementation case", "implementation case", "an example" or "example" appearing in various places throughout the specification do not necessarily all refer to the same implementation case or example. In addition, specific features, structures or characteristics can be combined in one or more implementation cases or examples in any appropriate combination and / or sub-combination. In addition, it should be understood by those of ordinary skill in the art that the diagrams provided herein are for illustrative purposes, and the diagrams are not necessarily drawn to scale. The term "and / or" used herein includes any and all combinations of one or more related listed items.
[0040] In the description of the present invention, the directions or positional relationships indicated by terms such as “front”, “rear”, “left”, “right”, “up”, “down”, “vertical”, “horizontal”, “high”, “low”, “inside” and “outside” are based on the directions or positional relationships shown in the accompanying drawings and are only for the convenience of describing the present invention and simplifying the description. They do not indicate or imply that the device or element referred to must have a specific direction, be constructed and operated in a specific direction. Therefore, they should not be understood as limiting the scope of protection of the present invention.
[0041] Embodiment 1:
[0042] Genetic transformation of CsZRK1 gene mediated by Agrobacterium rhizogenes to improve citrus resistance to Huanglongbing disease
[0043] 1. Cloning of Citrus CsZRK1 Gene
[0044] RNA was extracted from Late Jin Orange using an RNA extraction kit (Adlai, CAT: RN09). cDNA was synthesized using Recombinant DNaseI (TAKARA). PCR primers TF (sequence shown in SEQ ID No: 3) and PCR primers TR (sequence shown in SEQ ID No: 4) were used to amplify the CsZRK1 fragment from citrus cDNA, with a length of 1032 bp and a sequence shown in SEQ ID NO: 1. The amplified DNA fragment was sequenced and analyzed to be the coding sequence of the citrus CsZRK1 gene.
[0045] CsZRK1 gene nucleotide sequence SEQ ID NO: 1:
[0046]
[0047] The amino acid sequence encoded by the CsZRK1 gene, SEQ ID NO: 2:
[0048] MNCLLRKIKRSEREKTKIYVMRNGEMFLEKLIKSCNNKRNPLHCYCAKELMSATNNYDKHKVIKTGMSYELYKGFLQDHPVSVMKFFEDFDYAKAYCFNNIVYASQMIHKNVLRLVGCCLETQNPILVFESAEYGTLADRIYHPRQPHFEPLPWTLRLKIAMEIAYAIAYLHVGFSRPTVFRNLEPSNILLDEQNVAKVFDFSFSVSIPEGETHITDWLLGTFGYIAPEYVTNGDCNEKCDVYGFGMLLLELLTGQRAVDRSRRQEIEDEYFLGDHVRLYIERSRFNEIIDAVIVGDGLCSATEQKVQAFTKLAFSCLSVSAEDRPTMVDVARKLRLMHRSET。
[0049] The nucleotide sequence of primer T-F, SEQ ID No: 3:
[0050] CGGGATCCATGAATTGTTTACTGAGAAAG。
[0051] The nucleotide sequence of primer T-R, SEQ ID No: 4:
[0052] GCGTCGACTTACGTTTCAGAACGATGCA。
[0053] Amplification system: 10X PCR mix: 2.5 μL; primer T-F (5 μmol / L): 1 μL; primer T-R (5 μmol / L): 1 μL; cDNA about 60 ng; add ddH2O to 25 μL.
[0054] Amplification program: 94 °C, 5 min; 94 °C, 30 s, 56 °C, 30 s, 72 °C, 1.5 min, 35 cycles; 72 °C extension for 10 min.
[0055] DNA fragment recovery: Under ultraviolet light, use a clean blade to cut out the agarose gel block containing the target fragment. Use a kit (Aidlab) to recover the fragment.
[0056] 2. Construction of the CsZRK1 editing vector:
[0057] The method for sequencing and determining the genomic structural sequence of citrus CsZRK1 is as follows: using the citrus genome as a template, and using PCR primers T-F and T-R to amplify the full-length genomic sequence of CsZRK1, and sequencing to determine the exon sequence characteristics. The genomic structural sequence of CsZRK1 is shown in SEQ ID No: 5.
[0058] The nucleotide sequence of the genomic structure of CsZRK1 SEQ ID No: 5:
[0059]
[0060] Six sgRNAs targeting the exons of candidate genes were screened using the online software (http: / / citrus.hzau.edu.cn / crispr / query.php), and the six sgRNAs with higher scores, namely S1, S2, S3, S4, S5, and S6, were selected. The E369_93-sgRNA Synthesis Kit was used for in vitro synthesis, and the specific synthesis method was referred to the instruction manual. The E365-E368_94-Cas9 endonuclease was used for in vitro activity analysis, and the specific method was referred to the instruction manual. The content of the bands was analyzed using the imageJ software, and the cleavage efficiency was calculated. The results showed that the cleavage efficiencies mediated by sgRNA S1, sgRNA S2, sgRNA S3, and sgRNA S5 were the highest, which were 81.02%, 63.36%, 70.22%, and 92.60% respectively. S1, S2, S3, and S5 were selected for the construction of plant expression vectors, and the plant expression vectors pNG-Cas9-CsZRK1-S1S2 and pNG-Cas9-CsZRK1-S3S5 were successfully constructed (as Figure 1 shown).
[0061] The nucleotide sequence of sgRNA S1 is SEQ ID No: 6:
[0062] ACTGAGAAAGATCAAGCGTTGGG.
[0063] The nucleotide sequence of sgRNA S2 is SEQ ID No: 7:
[0064] TGAACCTTCCAATATTTTATGGG.
[0065] The nucleotide sequence of sgRNA S3 is SEQ ID No: 8:
[0066] ATTTTCCGTGTCTATTCCGGGGG.
[0067] The nucleotide sequence of sgRNA S4 is SEQ ID No: 9:
[0068] GTGAAACCCACATAACCGATCGG.
[0069] The nucleotide sequence of sgRNA S5 is SEQ ID No: 10:
[0070] GATGCCGTAATTGTTGGAGATGG.
[0071] The nucleotide sequence of sgRNA S6 is SEQ ID No: 11:
[0072] AGCAGAAGATAGACCAACAAGGG。
[0073] 3. Citrus genetic transformation
[0074] (1) Transformation of Agrobacterium rhizogenes competent K599 with the positive plasmid
[0075] Transform the plant expression vectors pNG-Cas9-CsZRK1-S1S2 and pNG-Cas9-CsZRK1-S3S5 constructed above into Agrobacterium rhizogenes competent K599. The specific transformation steps refer to Bai Xiaojing (2019), and store the bacterial liquid in the -80 °C refrigerator.
[0076] (2) Preparation of bacterial liquid
[0077] Use an inoculation loop to streak the Agrobacterium rhizogenes bacterial liquids of pNG-Cas9-CsZRK1-S1S2 and pNG-Cas9-CsZRK1-S3S5 stored at -80 °C on the LK plate, and culture them in a constant temperature incubator at 28 °C for 2 d. Pick a single colony into LK liquid, and culture it overnight with shaking at 28 °C and 220 rpm on a constant temperature shaker.
[0078] (3) Preparation of explants
[0079] Pick the symptomatic branches of Huanglongbing in the greenhouse or field (with a diameter of about 0.5 cm, with 2-3 leaves and at least 1 node), rinse them clean, cut them obliquely into 5-cm stem segments with a small knife, and place them on ice for later use.
[0080] (4) Transformation
[0081] ① Dilution and resuspension of bacterial liquid
[0082] Using the LK liquid medium as a control, measure the concentration of the bacterial liquid, dilute it to OD600 = 0.1, V = 200 mL, and shake it again at 28 °C and 220 rpm until OD600 = 0.5. Transfer the bacterial liquid to a sterile centrifuge tube, centrifuge at 5000 rpm for 10 min, discard the supernatant, and add an equal volume of MS liquid medium with pH = 5.8 to resuspend it by shaking for later use.
[0083] ② Infection with bacterial liquid
[0084] Take out the pretreated explant stem segments, immerse the cut ends of the stem segments in the resuspended bacterial liquid, and perform vacuum infection at 30 psi for 30 min.
[0085] (5) Culture
[0086] Pour out the bacterial suspension, insert the stem segments vertically into the moist vermiculite, expose the nodes to the air, culture them in a 28 °C light incubator, and frequently add water to maintain the humidity.
[0087] Example 2:
[0088] Identification of Transgenic Hairy Roots and Evaluation of Huanglongbing Resistance
[0089] 1. Identification of Transgenic Hairy Roots
[0090] Total DNA of transgenic plants was extracted as a template, and amplified using Cas9 universal primers. Using the plant expression vector plasmid as a positive control and the wild-type plant as a negative control, PCR verification was carried out. Primers containing the sgRNA sequence were designed for HI-TOM rapid amplicon sequencing. By comparing the sequencing results, the mutation of the sgRNA site of the candidate gene was detected.
[0091] The operation steps of rapid amplicon sequencing are as follows:
[0092] (1) Primer design and amplification: Specific primers were designed according to the conventional PCR primer design principle. It is required that the target region is within 100 bp of the forward or reverse primer, and the recommended amplification length is 150 - 300 bp. Add the bridging sequence 5'-gagtacggtgtgc-3' to the 5' end of the specific sequence of the forward primer; add the bridging sequence 5'-ggatgctgg-3' before the 5' of the reverse primer to ensure normal library construction in the later stage. After PCR amplification, gel electrophoresis was performed to ensure that the target band was amplified.
[0093] (2) Sample treatment and submission for testing: To prevent liquid leakage, 1 - 5 μL of the amplification product was placed in a PCR instrument or oven to dry with the lid open, and then sent for testing with the lid on.
[0094] The test results are shown in Figure 2 . According to Figure 2 the results in, a total of 11 hairy roots were obtained in this experiment. Further screening mutants using rapid amplicon sequencing, it was found that there were two strains with base substitutions in the sgRNA. Among them, the S1S2-1 line contained a C / T base substitution at the S1 site, with a mutation rate of 32.46%; and a T / G base substitution at the S2 site, with a mutation rate of 100%. The S1S2-5 line contained G / T and C / T base substitutions at the S1 site, with a mutation rate of 96.22%; and a G / T base substitution at the S2 site, with a mutation rate of 98.43%. Further analysis found that the base mutation at the S2 site of the S1S2-1 line led to the mutation of N amino acid to K amino acid; the base substitution at the S2 site of the S1S2-5 line led to premature termination of translation and the production of an immature protein.
[0095] 2. Evaluation of Huanglongbing Resistance of Transgenic Hairy Roots
[0096] qPCR was used to detect the CaLas content in the mutant hairy roots, as shown in Figure 3As shown, the results showed that the CaLas content in the mutant hairy roots was significantly reduced compared with the EV control. Therefore, the CsZRK1 mutation significantly inhibited the proliferation of Candidatus Liberibacter asiaticus, indicating that the CsZRK1 mutation significantly enhanced the resistance to citrus huanglongbing.
[0097] The above results proved that the mutant CsZRK1 gene could enhance the tolerance of citrus to huanglongbing.
[0098] In summary, a method for improving the tolerance of citrus to huanglongbing provided by the present invention can significantly improve the resistance of citrus to huanglongbing by mediating the sgRNA guiding sequence of the CsZRK1 gene mutated by CRISPR / Cas9, and does not affect the phenotype of transgenic plants. It has great application value in citrus breeding for resistance to huanglongbing and can be used as a candidate gene for breeding for resistance to huanglongbing with multiple resistant and susceptible genes to huanglongbing.
[0099] The specific embodiments described above have further elaborated on the purpose, technical solutions, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the protection scope of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
Claims
1. A method for improving the resistance of citrus to Huanglongbing by using the CsZRK1 gene, characterized in that, The resistance of citrus plants to Huanglongbing is improved by mutating the CsZRK1 gene, and the nucleotide sequence of the CsZRK1 gene is shown in SEQ ID NO:
1.
2. The method for improving the Huanglongbing resistance of citrus by using the CsZRK1 gene according to claim 1, characterized in that, The method for mutating the CsZRK1 gene is: using CRISPR / Cas9 technology to site-directedly mutate the CsZRK1 gene, so that the protein encoded by the CsZRK1 gene loses its function.
3. A method for improving the Huanglongbing tolerance of citrus by using the CsZRK1 gene according to claim 2, characterized in that, The process of site-directed mutation of the CsZRK1 gene using the CRISPR / Cas9 technology is as follows: (1) Sequencing to determine the genome structure of CsZRK1; (2) Screening of sgRNA guide sequences for editing the CsZRK1 gene; (3) Construction of a CRISPR / Cas9 vector containing the sgRNA guide sequence of the CsZRK1 gene; (4) The CRISPR / Cas9 vector was used to transform citrus to obtain a mutant strain with a mutation in the CsZRK1 gene.
4. A method for improving the Huanglongbing tolerance of citrus by using the CsZRK1 gene according to claim 3, characterized in that, In step (1), the method for sequencing to ascertain the structural sequence of the citrus CsZRK1 genome is: Using the citrus genome as a template, PCR primers TF and TR were used to amplify the full-length sequence of the CsZRK1 genome, and sequencing was performed to determine the sequence characteristics of its introns and exons.
5. A method for improving the Huanglongbing resistance of citrus by using the CsZRK1 gene according to claim 4, characterized in that, The CsZRK1 genome structure sequence is shown in SEQ ID No:
5.
6. A method for improving the Huanglongbing tolerance of citrus by using the CsZRK1 gene according to claim 4, characterized in that The nucleotide sequence of the PCR primer TF is shown in SEQ ID No: 3; The nucleotide sequence of the PCR primer TR is shown in SEQ ID No:
4.
7. A method for improving the Huanglongbing tolerance of citrus by using the CsZRK1 gene according to claim 3, characterized in that In step (2), the screening process of the sgRNA guide sequence for editing the CsZRK1 gene is as follows: First, six sgRNA sequences S1, S2, S3, S4, S5 and S6 were screened according to the online website, and the nucleotide sequences were shown in SEQ ID No: 6, SEQ ID No: 7, SEQ ID No: 8, SEQ ID No: 9, SEQ ID No: 10 and SEQ ID No: 11, respectively; Then, the sgRNA sequences S1, S2, S3 and S5 that guide Cas9 to cut CsZRK1 were screened out by in vitro enzyme digestion.
8. A method for improving the Huanglongbing resistance of citrus by using the CsZRK1 gene according to claim 7, characterized in that, E365-E368_94-Cas9 endonuclease was used for in vitro enzyme screening.
9. A method for improving the Huanglongbing tolerance of citrus by using the CsZRK1 gene according to claim 3, characterized in that A CRISPR / Cas9 vector containing the sgRNA guide sequence of the CsZRK1 gene was constructed as a tRNA-mediated multi-site editing vector.
10. A method for improving the Huanglongbing tolerance of citrus using the CsZRK1 gene according to claim 9, characterized in that, The construction process of the CRISPR / Cas9 vector containing the CsZRK1 gene sgRNA guide sequence is as follows: CRISPR / Cas9 vectors containing S1 and S2, S3 and S5 guide sequences were constructed respectively to obtain pNG-Cas9-CsZRK1-S1S2 plant expression vector and pNG-Cas9-CsZRK1-S3S5 plant expression vector.
Citation Information
Patent Citations
SgRNA for improving citrus and application and using method thereof
CN111748555A
Method for improving citrus liberobacter asiaticum resistance by using CsMEKK1-2 gene
CN118126981A
Atypical MEKK protein CsMEKK1-1 for resisting citrus huanglongbing and preparation method of disease-resistant citrus
CN118207182A
ZAR1 and jim2 mediate resistance against plant pathogens containing yopj-family effectors
US20210310019A1
Cited By
Application and method of CsNBR1 gene in improvement of citrus liberobacter asiaticum resistance
CN120866401A