Application of cotton GSTF8 gene in verticillium wilt resistance

Abstract

The invention belongs to the technical field of gene cotton resistance breeding, and particularly relates to application of cotton GhGSTF8 and GbGSTF8 genes in cotton verticillium wilt resistance. According to the application, the expression level of the GhGSTF8 gene in leaves and receptacles of cotton is relatively high through qRT-PCR (Quantitative Reverse Transcription-Polymerase Chain Reaction) detection; the expression level of the GbGSTF8 gene in leaves and stems of cotton is high. VIGS experiments show that after the GhGSTF8 gene is silenced, a new plant body shows an obvious susceptible character characteristic to verticillium wilt infection. After the GbGSTF8 gene is silenced, the silenced plant shows the character characteristic of resistance. Based on the research result, a certain application foundation can be laid for the molecular mechanism research of verticillium wilt resistance and the cultivation of new varieties of novel verticillium wilt-resistant plants.

Description

Technical Field

[0001] This application belongs to the technical field of cotton resistance breeding, and specifically relates to the application of cotton GSTF8 genes in cotton Verticillium wilt resistance. Background Art

[0002] Verticillium wilt is a soil-borne fungal plant disease caused by infection with Verticillium dahliae, which is characterized by strong pathogenicity, wide host distribution, and frequent variation. It poses a serious threat to the yield and quality of cotton and is known as the "cancer" of cotton. This pathogen has a wide host range and can infect more than 700 plant species, including those in the Malvaceae, Leguminosae, Solanaceae, and Rosaceae families. Verticillium dahliae colonizes in cotton plants, and its mycelia or spores rapidly spread into the xylem vessels through transpiration, hindering the transport of water and nutrients in the vascular tissue. At the same time, it secretes toxic substances, ultimately causing vascular browning, leaf yellowing, wilting, defoliation, and even plant death. Due to the massive reproduction of the pathogen's mycelia in the plant vascular tissue and the long-term dormancy of spores in the form of microsclerotia in the soil, traditional methods such as soil amendments, solar radiation exposure, or fungicide treatments have been proven ineffective in controlling Verticillium wilt disease. In recent years, climate change, continuous monoculture cropping, and the frequent introduction of new cotton varieties and hybrids have exacerbated the occurrence of Verticillium wilt globally.

[0003] Cotton is the main source of renewable natural fibers for the textile industry and vegetable oil for the food / feed industry. Among the more than 50 cotton species identified so far, four have been domesticated for fiber production worldwide, namely Gossypium herbaceum ( Gossypium herbaceum , A1), Gossypium arboreum ( G. arboreum , A2), Gossypium hirsutum ( G. hirsutum , AD1), and Gossypium barbadense ( G. barbadense, AD2). Although upland cotton and sea island cotton share the same allotetraploid ancestor, their plant types, fiber quality, yield, and environmental adaptability show significant differences during their independent domestication. Among them, upland cotton is widely cultivated, accounting for 95% of the global cotton production, and is the main target of breeding. However, as the world's most important cotton cultivar, upland cotton faces the problem of a narrow genetic basis, such as a lack of resistant germplasm resources, insufficient excellent genes, and insufficient quantitative trait loci (QTLs). On the contrary, although sea island cotton has significant advantages such as excellent fiber length, outstanding strength, and strong resistance to Verticillium wilt, due to its genetic limitations of short and ultrafine fiber traits and high cultivation requirements, its current contribution rate to global cotton production is less than 5%, which is difficult to meet the diversified needs of the textile industry. To solve this problem, breeders have significantly improved upland cotton's resistance to Verticillium wilt by introducing resistance genes from sea island cotton. Therefore, the differences between upland cotton and sea island cotton at the transcriptional and metabolic levels were studied, key SNP markers and key genes related to resistance to Verticillium wilt in upland cotton and sea island cotton were identified, the molecular mechanism of cotton resistance to Verticillium wilt was analyzed, and genetic resources were provided for molecular breeding of resistance to Verticillium wilt. The materials used in this application are the land and sea genetic standard lines TM-1 and Hai7124.

[0004] GST is a multi-gene encoded supergene family enzyme with multiple functions. It plays various primary and secondary metabolic regulation, stress metabolism, detoxification and antioxidant defense, heavy metal absorption, and promotion of seedling development in many plants. GST plays a key role in plant response to biotic and abiotic stresses by catalyzing glutathione conjugation reactions, scavenging ROS, and regulating hormone signaling pathways. The main function of GST is to catalyze the conjugation reaction of glutathione with electrophilic substrates to form more water-soluble glutathione conjugates, which facilitates its transport to the vacuole or outside the cell, thereby reducing its toxicity to cells. Plant GST can be divided into multiple families according to its sequence and function, such as Phi (GSTF), Tau (GSTU), Theta (GSTT), Zeta (GSTZ), and Lambda (GSTL). GSTs of different families differ in substrate specificity and function. In the study of salt tolerance of tomatoes, glutathione S-transferase U43 ( SlGSTU43 ) by regulating key enzymes in lignin biosynthesis SlCOMT2, regulating the lignin content in tomatoes, thereby enhancing the plant's adaptability to salt stress. In the study of salt stress in maize, under the treatment of gibberellic acid (GA3) (350 mM NaCl and 100, 300, and 500 ppm), the content of GST enzyme, GST isozyme activity, hydrogen sulfide, and anthocyanin increased, and the content of oxidative damage markers (malondialdehyde, H2O2, and superoxide radicals) decreased, thereby alleviating the adverse effects of salt stress on maize. In addition, through genomics, transcriptomics, and functional verification studies, it was found that the GST gene cluster in cotton maintains the redox homeostasis of cells by regulating the production and scavenging of H2O2, thereby enhancing the resistance of cotton to Verticillium wilt. Therefore, screening for GST genes in cotton and studying their application in the resistance of cotton to Verticillium wilt is of great significance. Summary of the Invention

[0005] The main purpose of this application is to provide a GSTF8 gene with certain application prospects for resistance to Verticillium wilt, thereby laying a certain application foundation for the cultivation of new cotton varieties resistant to Verticillium wilt.

[0006] The detailed technical solutions adopted in this application are as follows.

[0007] A cotton Verticillium wilt-resistant gene GhGSTF8, Its nucleotide sequence is as shown in SEQ ID No.1, and its encoded amino acid sequence is as shown in SEQ ID No.2.

[0008] A cotton Verticillium wilt-susceptible gene GbGSTF8, Its nucleotide sequence is as shown in SEQ ID No.3, and its encoded amino acid sequence is as shown in SEQ ID No.4.

[0009] The gene expression detection results show that the gene GhGSTF8 has the highest expression in the leaves of cotton, followed by the receptacle; the expression level of the gene GbGSTF8 is the highest in the leaves and the second highest in the stems. Further application results of the VIGS technology show that after silencing the GhGSTF8 gene, the disease index of Verticillium wilt in the plants increases, and after silencing the GbGSTF8 gene, the disease index of Verticillium wilt in the plants decreases.

[0010] Based on the above research results, after overexpressing the GhGSTF8 gene in upland cotton, it can be used to cultivate new plant varieties with high resistance to Verticillium wilt; after silencing or knocking out the GbGSTF8 gene in sea island cotton, it can be used to cultivate new plant varieties with enhanced resistance to Verticillium wilt.

[0011] Beneficial effects: Through the combined analysis of the cotton transcriptome and metabolome, the present invention screened the gene GSTF8, and further cloned the gene in upland cotton TM-1 and sea island cotton Hai7124. Further application experiments showed that GSTF8 After silencing, the disease resistance of upland cotton plants decreased, while that of sea island cotton plants increased, indicating that this gene is highly correlated with resistance to Verticillium wilt. Based on this research result, it can lay a certain application foundation for the study of the molecular mechanism of Verticillium wilt resistance and the breeding of new Verticillium wilt-resistant plant varieties, and also provide new references for the screening of new disease-resistant genes and the breeding of resistant plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 For gene GSTF8 PCR product electrophoresis detection, where the marker size is 100-2000bp, lanes 1-5 are TM-1, and lanes 6-10 are Hai7124.

[0013] Figure 2 For gene GSTF8 The nucleotide sequence comparison results in TM-1 and Hai7124 materials.

[0014] Figure 3 For gene GSTF8 Protein sequence alignment results in TM-1 and Hai7124 materials.

[0015] Figure 4 For gene GhGSTF8 qRT-PCR results of expression levels in cotton tissues (roots, stems, leaves, flowers, and receptacles) of TM-1.

[0016] Figure 5 For gene GbGSTF8 qRT-PCR results of expression levels in different cotton tissues (roots, stems, leaves, flowers, and receptacles) of Hai7124.

[0017] Figure 6 For gene GSTF8 Electrophoresis detection of VIGS vector fragment PCR products. The marker size is 100-2000bp, and lanes 1-2 are gene GhGSTF8 Silent fragment, lanes 3-4 are genes GbGSTF8 Silence fragment.

[0018] Figure 7 VIGS injection of albino genes in cotton plants GhCLA1 Albino phenotype after silencing.

[0019] Figure 8 After VIGS injection of cotton plants GSTF8 Detection of gene silencing efficiency in cotton.

[0020] Figure 9 Resistance of different cotton plants to Verticillium dahliae. (A) TRV2:00 Plants, TRV2: GhGSTF8 Plants and TRV2: GbGSTF8 Phenotypes of plants 15 days after inoculation with Verticillium dahliae. (B) TRV2:00 Plants, TRV2: GhGSTF8 Plants and TRV2: GbGSTF8 Disease index of plants 15 days after inoculation with Verticillium dahliae. The disease grades of more than 30 cotton seedlings were counted. (C) TRV2:00 Plants, TRV2: GhGSTF8 Plants and TRV2: GbGSTF8 Vascular browning of plants 15 days after inoculation with Verticillium dahliae (D) TRV2:00 Plants, TRV2: GhGSTF8 Plants and TRV2: GbGSTF8 Detection of Verticillium dahliae biomass in plants. (T - test was used to analyze gene expression differences. * indicates significant differences (*p < 0.05; **p < 0.01; ***p < 0.001). Specific implementation manners

[0021] The following further explains and illustrates the present application in conjunction with embodiments. Before introducing the specific embodiments, a brief introduction to some of the materials in the following embodiments is as follows.

[0022] Cotton materials include: The Verticillium dahliae - susceptible upland cotton TM - 1 and the Verticillium dahliae - resistant sea - island cotton Hai7124 were both provided by Researcher Liu Fang of the Cotton Research Institute, Chinese Academy of Agricultural Sciences; Verticillium dahliae strains: The highly virulent Verticillium dahliae strain V991 for cotton; Primer sequences: All were provided by Sangon Biotech; Other biological materials and reagents used can be obtained through commercial channels.

[0023] We selected TM - 1 and Hai7124 as materials and performed transcriptome and metabolome sequencing on samples of their roots 0, 1, and 2 days after inoculation with Verticillium dahliae V991. Based on the combined analysis of transcriptomic and metabolomic multi - omics, the gene GSTF8 ( GH_D11G2329 ) was screened. This gene is GhGSTF8, in TM - 1 and GbGSTF8 in Hai7124. The sequence listing of gene GhGSTF8 is shown in SEQ ID No.1, and the amino acid sequence encoded by it is shown in SEQ ID No.2; The gene GbGSTF8The sequence table of the gene is shown in SEQ ID No.3, and the amino acid sequence encoded by the gene is shown in SEQ ID No.4. We also analyzed the expression level of the gene in the roots, stems, leaves, flowers and receptacles of cotton TM-1 and Hai7124, and conducted VIGS experiments on the gene in TM-1 and Hai7124. The results showed that GSTF8 Silencing of significantly reduced the resistance of TM-1 to Verticillium wilt and enhanced the resistance of Hai7124 to Verticillium wilt.

[0024] Embodiment 1: GhGSTF8 and GbGSTF8 Acquisition of genes In the present invention, RNA-seq and metabolome analysis were performed on the root tissues of the disease-resistant material Hai7124 and the disease-susceptible material TM-1 at the early stage of V991 infection (0, 1 and 2 days). The KEGG co-enrichment analysis of DEGs and DAMs showed that the pathway in glutathione metabolism GSTF8 The gene may play an important role in the early stage of cotton response to Verticillium wilt infection, and it was found that after being infected by Verticillium wilt, cotton GhGSTF8 and GbGSTF8 The expression level of the gene changed significantly. Therefore, the inventors used upland cotton TM-1 and sea island cotton Hai7124 as materials to GhGSTF8 and GbGSTF8 A detailed analysis was carried out and the specific process is briefly introduced as follows.

[0025] First, cotton was planted. The seeds of two cotton varieties, Upland cotton TM-1 and Sea island cotton Hai7124, were delinted using concentrated sulfuric acid, washed with clean water and dried naturally, and the plump seeds of the same size were selected for the next experiment.

[0026] Planted in the greenhouse of Anyang Institute of Technology, Henan Province, and planted in a sterilized substrate composed of sand and vermiculite in a ratio of 3:2, placed in a greenhouse environment with a temperature of 28 ℃, a photoperiod of 16 hours of light and 8 hours of darkness, and a relative humidity of 68%. When the first true leaf of the cotton plant is fully expanded, the root tissues with uniform growth are collected. These roots are quickly transferred to collection tubes that have been pre-cooled in liquid nitrogen to ensure the preservation of the samples. They are then frozen in liquid nitrogen and stored in an ultra-low temperature freezer at -80 ℃ for future use.

[0027] Extract the RNA from the roots of two kinds of cotton seedlings respectively, and use the RNA extraction kit of Tiangen Biotech (Beijing) Co., Ltd. (RNAprep Pure Plant Plus Kit) to extract total RNA. Then perform reverse transcription to obtain cDNA. Use the Novoprotein HiScriptIII RT SuperMix for qPCR (+gDNA wiper) kit to synthesize cDNA. The centrifuge tubes used are RNase-free tubes, and the operation is carried out in a sterile environment on ice; (1) Add the reaction system as shown in Table 1 to the centrifuge tube Table 1 Reverse transcription PCR reaction system Ⅰ Component Volume (μL) <![CDATA[RNase-free ddH2O]]> to 16 4×gDNA wiper Mix 4 Template RNA Total RNA:1 pg (2) Gently pipette and mix well, incubate at 42 °C for 2 min, and store on ice; (3) Add the reaction system listed in Table 2 to the reaction tube in the first step, and pipette and mix well Table 2 Reverse transcription PCR reaction system Ⅱ Component Volume (μL) 5×HiScript 3 qRT SuperMix 4 The first reaction solution 16 (4) Set the PCR program as 37 °C for 15 min; 85 °C for 5 s; (5) Finally, store 20 μL of the PCR product (cDNA) in a -20 °C refrigerator to prevent degradation.

[0028] Using cDNA as a template, design primers and perform gene amplification. The primer sequences are shown in Table 3 as follows: Table 3 Primers used in the experiment Type Primer name Primer sequence Cloning OE2329-F AGAGGATCCCCGGGGGGTACCATGGCAACTCCGGTGAAAG Cloning OE2329-R CTAGGTTAACCATGTGGTACCTCAACTGCTGTGCTTCTGC The PCR amplification system is designed as shown in Table 4: Table 4 PCR amplification system Ingredient Volume 2×Phanta Max Buffer 25 μL dNTP Mix 1.0 μL Phanta Max Super-Fidelity DNA Polymerase 1.0 μL Forward Primer 2.0 μL Reverse Primer 2.0 μL cDNA 5.0 μL <![CDATA[ddH2O]]> 17 μL Total Volume 50 μL Perform electrophoresis detection on the PCR amplification product, and the results are as Figure 1 shown. It can be seen from the figure that the gene GhGSTF8 is 660 bp in size (corresponding to lanes 1-5 of Gossypium hirsutum TM-1), and the gene GbGSTF8 is 660 bp in size (corresponding to lanes 6-10 of Gossypium barbadense Hai7124), which is consistent with the expected results. Compare the nucleotide sequences and protein sequences of the genes GhGSTF8 and GbGSTF8 extracted from the two materials TM-1 and Hai7124, as Figure 2 and 3 shown. The sequence alignment results show that the genes GhGSTF8 and GbGSTF8There are 3 SNP sites in the nucleotide sequence and 1 non-synonymous mutation in the protein sequence.

[0029] Example 2: Tissue expression pattern study of the gene under natural conditions (wild type) GhGSTF8 and GbGSTF8 Based on the understanding of the basic characteristics of the genes GhGSTF8 and GbGSTF8 in Example 1 above, the inventors further specifically analyzed the tissue expression pattern of this gene in cotton tissues under natural conditions. The relevant experiments are briefly introduced as follows.

[0030] Tissues of roots, stems, leaves, flowers and receptacles of Gossypium hirsutum TM-1 and Gossypium barbadense Hai7124 were taken respectively, RNA was extracted, and cDNA was obtained using a reverse transcription kit. qPCR amplification was performed using the quantitative PCR primers shown in Table 5 below: Table 5 Primers used in the experiment Type Primer name Primer sequence Quantification DL2329-F GCTAAAGCGCTGGAGGTGTA Quantification DL2329-R AGCTCACCCCTATCAGTAGCA Quantification UBQ7F GAAGGCATTCCACCTGACCAAC Quantification UBQ7R CTTGACCTTCTTCTTCTTGTGCTTG The ChamQ Universal SYBR qPCR Master Mix kit from Novoprotein was used for quantitative PCR detection. The qRT-PCR reaction was carried out on an ABI7500 Fast real-time fluorescence quantitative PCR instrument. The reaction system is shown in Table 6 below: Table 6 System and conditions for real-time fluorescence quantification Component Volume (μL) cDNA 2 Forward Primer (10 μM) 0.5 Reverse Primer (10 μM) 0.5 2xPerfectStart® Green qPCR SuperMix 10 Universal Passive Reference Dye (50x) 0.4 Nuclease-free Water To 20 The reaction program was: denaturation at 95 °C for 30 s, followed by 40 cycles (denaturation at 95 °C for 10 s, annealing and extension at 60 °C for 30 s). After 40 cycles, the specificity of the amplified product was detected by melting curve analysis.

[0031] Each reaction included at least three replicates, with a single template diluted to different concentrations. Data analysis was performed using the 2 -ΔΔCT method to calculate the relative expression level of the target gene.

[0032] The detection results are shown in Figure 4 and 5 . Analysis showed that: in TM-1, GhGSTF8 had a higher expression level in leaves, followed by receptacles, indicating that GhGSTF8 expression had certain tissue differences. In Hai7124, GbGSTF8 had a higher expression level in leaves, followed by stems, indicating that GbGSTF8 expression had certain tissue differences.

[0033] Example 3: Gene silencing study Furthermore, the inventors constructed a VIGS interference vector using virus-induced gene silencing (VIGS) technology, and separately silenced the corresponding genes in two cotton varieties GhGSTF8 and GbGSTF8 , and observed the phenotypic changes of the cotton variety after gene silencing when infected with Verticillium dahliae. The results further demonstrated that GhGSTF8 positively regulates cotton resistance to Verticillium wilt, GbGSTF8 negatively regulates cotton resistance to Verticillium wilt. The relevant experimental conditions are briefly introduced as follows.

[0034] I. Construction of VIGS interference vector Enter the CDS sequence of the gene on the website https: / / vigs.solgenomics.net / to design a gene silencing fragment, design primers through Primer5.0 software, and add homologous arms GTGAGTAAGGTTACCGAATTC and CGTGAGCTCGGTACCGGATCC to the 5´ ends of the upstream and downstream primers respectively. The primer sequences are shown in Table 7: Table 7 Primers used in the experiment Type Primer Name Primer Sequence Cloning V2329F: GTGAGTAAGGTTACCGAATTCCTACTGCTGTGTCTAGGGTC Cloning V2329R: CGTGAGCTCGGTACCGGATCCGGGGTTAAAGCTCTGCCCTTC Using the cDNA of TM-1 and Hai7124 materials as templates respectively, perform PCR amplification on the target fragment. The reaction system and reaction procedure refer to Example 1 " GhGSTF8 and GbGSTF8 Obtaining of genes", and the electrophoresis results of the amplification products are as Figure 6 shown, and the sizes of the target gene fragments are correct.

[0035] Re-shake and activate the bacterial liquid of the pTRV2 vector that has been transformed into Escherichia coli competent cells and stored at -80 °C in the laboratory, and extract the plasmid. The plasmid extraction uses the TIANprep Mini Plasmid Kit plasmid mini-prep kit of Beijing Tiangen Biotech Co., Ltd. For the specific steps, refer to the instruction manual. Use the restriction enzyme EcoR I to linearize the plasmid vector. Prepare the enzyme digestion system in a centrifuge tube, and the components and their dosages are shown in Table 8. Mix the enzyme digestion system, centrifuge briefly, then incubate in a water bath at 37 °C for 1 h and at 65 °C for 30 min. Use 1% agarose gel electrophoresis for detection, and cut and recover the linearized vector after enzyme digestion.

[0036] Table 8 Enzyme digestion system Ingredient Dosage EcoR I 2 μL Cut smart Buffer 4 μL Plasmid Vector 10 μL <![CDATA[ddH2O]]> 4 μL Total Volume 20 μL (1) Ligation: Add the target gene and the linearized vector according to the dosages in Table 9 to the same centrifuge tube to prepare a ligation system. Then incubate the ligation system in a water bath at 37 °C for 30 min and cool on ice for 3 - 5 min to obtain the recombinant.

[0037] Table 9 Connection System Ingredient Volume Linearized Vector 4 μL Gene Fragment 6 μL 5×CE Ⅱ Buffer 4 μL Exnase Ⅱ 2 μL <![CDATA[ddH2O]]> 2 μL Total Volume 20 μL 。

[0038] (2)Transformation of Escherichia coli 1) Thaw the competent Escherichia coli DH5α cells on ice; 2) Pipette 50 μL of the Escherichia coli competent cells and add them to the recombinant product. Gently flick the wall of the centrifuge tube with your finger (do not shake) to evenly mix the recombinant product and the competent cells, and then let it stand on ice for 30 min; 3) Heat shock in a 42 °C water bath for 45 s, and immediately place it on ice for 2 - 3 min; 4) Add 300 μL of LB liquid medium (without antibiotics) to the centrifuge tube, and incubate it in a 37 °C shaker at 220 rpm for 1 h; 5) After the incubation is completed, spread the cells on an LB solid medium containing Kana (final concentration 50 μg / mL), and incubate it upside down at 37 °C for 12 - 16 h; 6) Use a sterilized toothpick to pick a single colony, streak it on an LB solid medium supplemented with Kana, and incubate it upside down at 37 °C for 12 - 16 h; 7) Perform colony PCR detection on the streaked single colonies; 8) Mix the PCR amplification system well, centrifuge it briefly, and place it in a PCR instrument for amplification; 9) Use 1% agarose gel electrophoresis to detect the colony PCR amplification products, and pick the single colonies with correct bands for shaking culture; 10) Pipette 1 mL of the bacterial solution for sequencing. The sequencing company is Shanghai Sangon Biotech Co., Ltd.

[0039] Select the single colonies with correct sequencing, and perform large-scale culture using liquid LB containing antibiotics. Then extract the plasmid using the Tiangen Plasmid Mini Kit (Midiprep). For the specific steps, please refer to the instruction manual.

[0040] In the laboratory, use the Agrobacterium strain GV3101 provided by Shanghai Weidi Co., Ltd. as the host for plasmid transformation. The specific operation process is as follows: (1)Thaw the GV3101 competent cells on ice for 10 min; (2)After thawing, take 20 μL of the competent cells and add 0.1 μL of the plasmid to be transformed, and mix gently; (3) Place the mixed cells on ice for 5 min, quickly freeze them in liquid nitrogen for 5 min, and incubate them in a 37 °C water bath for 5 min in sequence; (4) After incubation, add 300 μL of liquid LB medium without resistance to the mixture; (5) Resuscitate the mixture at 28 °C at a rotation speed of 200 rpm / min for 2 - 3 h; (6) After resuscitation, aspirate 300 μL of the bacterial liquid and evenly coat it on the LB solid medium containing the corresponding antibiotic resistance; (7) Invert the coated medium and place it in an incubator at 28 °C for 48 h; (8) After the cultivation, select monoclonal colonies for colony PCR analysis; (9) Detect by agarose gel electrophoresis and screen out the bacterial liquid corresponding to the band with the same size as the target gene; (10) Select the correct clone for the subsequent infection experiment, and the constructed VIGS interference vector is obtained. TRV2: GhGSTF8 and TRV2:GbGSTF8 .

[0041] II. Response of cotton to Verticillium dahliae after silencing genes GhGSTF8 and GbGSTF8 in TM - 1 and Hai7124 respectively Activate the Agrobacterium vectors of TRV1, TRV2, TRV2:GhCLA1 , TRV2:GhGSTF8 and TRV2:GbGSTF8 respectively, and expand the culture overnight in a 50 mL Erlenmeyer flask of LB liquid medium at 28 °C and 200 rpm. Pour the bacterial liquid into a 50 mL centrifuge tube, centrifuge at 6000 g for 10 min at room temperature, discard the supernatant, resuspend the remaining bacteria with the VIGS resuspension solution, adjust the OD value to 0.8 - 1.0, and mix the Agrobacterium resuspension solution containing TRV1 with the Agrobacterium resuspension solutions of TRV2, TRV2:GhCLA1 , TRV2:GhGSTF8 and TRV2:GbGSTF8 in equal volumes respectively, and stand still in the dark for 3 h.

[0042] Use a 1 mL syringe for injection. Gently scratch the back of the cotton cotyledon with the needle (note not to cut the leaf), suck the bacterial liquid with the syringe and gently push it into the cotton cotyledon at the wound to make the bacterial liquid fill the whole cotyledon. The injected cotton is placed in the dark at 25 °C for 24 h and then continued to be cultured. Observe the silencing GhCLA1 of the cotton plant leaves two weeks after injection. When the phenotype of the true leaves of the injected cotton begins to show albinism ( TRV2:GhCLA1 Figure 7)As a reference, detect the silencing rate of the target gene.

[0043] Take the true leaves of cotton plants two weeks after injecting the VIGS vector suspension, extract RNA and reverse transcribe it into cDNA, and detect the silencing rate of the target gene by qRT-PCR. The method is the same as that for "the tissue expression pattern of genes GhGSTF8 and GbGSTF8 under natural conditions (wild type)". The results showed that TRV2:GhGSTF8 and TRV2:GbGSTF8 the expression levels of genes in cotton plants were significantly lower than those in TRV2:00 cotton plants ( Figure 8 , TRV2:00 , which is an empty vector control without the target gene).

[0044] The method for infecting cotton with Verticillium dahliae is the root-injury inoculation method, and cotton is infected with the spore suspension of Verticillium dahliae V991 (1×10 7 conidia / mL). When the true leaves begin to turn yellow and wilt, count the incidence of cotton Verticillium wilt. Refer to the method in "Quarantine Detection and Identification of Verticillium dahliae in Cotton" to count the disease index of cotton (Standard No.: GB / T28084-2011): Disease index = ∑(number of plants at a certain disease level × representative value) × 100 / total number of plants surveyed × representative value of the most severe disease level.

[0045] Conduct stem section tests on the stem segments of TRV2:00 , TRV2:GhGSTF8 and TRV2:GbGSTF8 respectively. Cut a stem segment about 1 cm long above the cotyledon node, make a longitudinal section with a blade, and observe the browning of the vascular bundles under a microscope.

[0046] Conduct the detection of the biomass of Verticillium dahliae in TRV2:00 , TRV2:GhGSTF8 and TRV2:GbGSTF8 respectively. Randomly select the second true leaf of the plants 15 days after inoculating with Verticillium dahliae, grind it thoroughly with liquid nitrogen, and use the Novizan plant genomic DNA extraction kit (FastPure Plant DNA Isolation Mini Kit) to extract the genomic DNA of cotton leaves. See the instruction manual for the specific experimental operation. First, uniformly dilute the genomic DNA concentration to 100 ng / μL as the template. Use the cotton reference gene GhUBQ7 (DQ116441.1) and the specific primers ITS1-F and ST-Ve1-R of Verticillium dahliae to perform real-time quantitative PCR (qRT-PCR) to detect the content of Verticillium dahliae. The specific primers of Verticillium dahliae are shown in Table 10: Table 10 Primers used in the experiment Type Primer Name Primer Sequence Quantification ITS1-F AAAGTTTTAATGGTTCGCTAAGA Quantification STVe1-R CTTGGTCATTTAGAGGAAGTAA The qRT-PCR reaction was carried out using an ABI7500 Fast real-time PCR instrument, and the relative expression levels of target genes were calculated using the 2 -ΔΔCT method.

[0047] The results showed that after infection with Verticillium dahliae, morphological observations showed that the TRV2:GhGSTF8 leaves of TM-1 plants turned yellow, and the fallen leaves were more serious than those of the cotton in the control group ( Figure 9 A). TRV2:GhGSTF8 The disease index of cotton plants was significantly higher than that of TRV2:00 cotton plants ( Figure 9 B). TRV2:GhGSTF8 The browning of the vascular bundles of cotton plants was significantly higher than that of TRV2:00 cotton plants ( Figure 9 C). TRV2:00 The bacterial content in the plants was significantly lower than that of TRV2:GhGSTF8 plants ( Figure 9 D). After infection with Verticillium dahliae, morphological observations showed that the TRV2:GbGSTF8 leaves of Hai7124 cotton plants turned yellow, and the fallen leaves were less serious than those of the cotton in the control group ( Figure 9 A). TRV2:GbGSTF8 The disease index of cotton plants was lower than that of TRV2:00 cotton plants ( Figure 9 B). TRV2:GbGSTF8 The browning of the vascular bundles of cotton plants was lower than that of TRV2:00 cotton plants ( Figure 9 C). TRV2:00 The bacterial content in the plants was higher than that of TRV2:GbGSTF8 plants ( Figure 9 D).

[0048] Based on the above results, it can be seen that in the susceptible cultivar Gossypium hirsutum TM-1, after silencing the GhGSTF8 gene, when infected with Verticillium dahliae, the disease index of cotton increased significantly, indicating that GhGSTF8 positively regulates the resistance of cotton to Verticillium wilt; if this gene is overexpressed in Gossypium hirsutum, the susceptible cultivar can be transformed into a resistant cultivar. In the resistant cultivar Hai7124, after silencing the GbGSTF8 gene, when infected with Verticillium dahliae, the disease index of cotton decreased significantly, indicating that GbGSTF8 negatively regulates the resistance of cotton to Verticillium wilt; if this gene is silenced or knocked out in Gossypium barbadense, the resistance of Gossypium barbadense to Verticillium wilt can be enhanced.

Claims

1. A cotton Verticillium wilt resistance gene GhGSTF8, Characterized in that Its nucleotide sequence is as shown in SEQ ID No.

1.

2. The gene according to claim 1 GhGSTF8, characterized in that The amino acid sequence encoded by it is as shown in SEQ ID No.

2.

3. A cotton Verticillium wilt susceptible gene GbGSTF8, It is characterized in that Its nucleotide sequence is as shown in SEQ ID No.

3.

4. The gene according to claim 3 GbGSTF8, characterized in that The amino acid sequence encoded by it is as shown in SEQ ID No.

4.

5. The gene according to any one of claims 1-4 GhGSTF8 or GhGSTF8 for use in the resistance of cotton to Verticillium wilt.

6. The application according to claim 5, characterized in that, Overexpress the gene in Gossypium hirsutum GhGSTF8 Obtain disease-resistant varieties of Gossypium hirsutum 7. The application according to claim 5, characterized in that, Silence or knockout genes in Gossypium barbadense GbGSTF8 Obtain Gossypium barbadense varieties with enhanced disease resistance

Images