Application of gene inhibitor in preparation of medicine for treating diseases caused by neurite overgrowth

Abstract

The invention discloses an application of a gene inhibitor in preparation of a medicine for treating diseases caused by neurite overgrowth, and the gene inhibitor inhibits the growth of neurite by inhibiting the expression of Tribbles homologous protein 3 pseudokinase. The invention proposes and verifies that the inhibitor can effectively inhibit growth and regeneration of dorsal root ganglion for the first time, and provides a new direction for research and development of drugs for treating neuropathic pain and autism spectrum disorders.

Description

Technical Field

[0001] The present invention relates to gene therapy, and in particular to the application of a gene inhibitor in the preparation of a drug for treating diseases caused by excessive growth of neuronal processes. Background Art

[0002] The nervous system is a highly complex functional integration system of the body, composed of the central nervous system and the peripheral nervous system. Through the transmission of electrical signals and chemical signals, it precisely regulates the body's perception, analysis, and response to external stimuli, and at the same time coordinates motor, sensory, and visceral activities. As the basic functional unit of the nervous system, the dendrites of neurons are responsible for receiving upstream signals and integrating them into the cell body, while the axons conduct electrical impulses to distal target cells, forming a cross-regional signal transmission network. This dynamically balanced neural circuit is the core basis for maintaining cognitive, motor, and autonomic functions.

[0003] The normal development and growth of neuronal processes are crucial for nerve function, but their abnormal excessive growth may cause various nervous system diseases. In the brain, if the dendrites or axons of neurons over-branch and proliferate, it may disrupt the myelination process of white matter fibers, leading to abnormal connections in the neural circuit. For example, patients with autism spectrum disorder (ASD) often show excessive formation of synapses and abnormal increase in dendritic spine density in the cerebral cortex neurons. Such structural disorders may interfere with signal integration in brain regions related to social cognition, causing symptoms such as language disorders, repetitive behaviors, and sensory hypersensitivity. In the peripheral nervous system, the excessive growth of axons and abnormal sprouting of terminals in the dorsal root ganglion (DRG) are closely related to neuropathic pain. When the axons of DRG sensory neurons undergo pathological hyperplasia due to injury or inflammatory stimulation, their terminals will over-release pain transmitters and form ectopic discharges, resulting in the amplification or mistransmission of pain signals, manifested as spontaneous pain or touch-evoked pain.

[0004] Currently, the treatment of diseases caused by excessive growth of neuronal processes is mostly limited to symptomatic interventions mainly based on analgesic drugs and behavioral therapies. There is no therapy that directly targets and regulates genes related to the growth or regeneration of processes. It is still necessary to further analyze the molecular mechanism of neuronal process growth to develop precise disease intervention strategies. Summary of the Invention

[0005] Object of the Invention: The object of the present invention is to provide the application of a gene inhibitor that inhibits the expression of Tribbles homolog 3 pseudokinase in the preparation of a drug for treating diseases caused by excessive growth of neuronal processes.

[0006] Technical Solution: The application of the gene inhibitor that inhibits the expression of Tribbles homolog 3 pseudokinase in the preparation of a drug for treating diseases caused by excessive growth of neuronal processes.

[0007] Preferably, the gene inhibitor is any one of siRNA, shRNA, sgRNA, miRNA, and antisense oligonucleotide.

[0008] Preferably, the gene inhibitor is siRNA.

[0009] Preferably, the neuronal process includes an axon and / or a dendrite.

[0010] Preferably, the application is for the preparation of a drug for treating diseases caused by overgrowth of neuronal processes in the peripheral nervous system.

[0011] Preferably, the disease caused by overgrowth of neuronal processes in the peripheral nervous system is neuropathic pain.

[0012] Preferably, the application is for the preparation of a drug for treating diseases caused by overgrowth of neuronal processes in the central nervous system.

[0013] Preferably, the disease caused by overgrowth of neuronal processes in the central nervous system is autism spectrum disorder.

[0014] Preferably, the drug contains a gene inhibitor that inhibits the expression of Tribbles homolog 3 pseudokinase as an active ingredient and a pharmaceutically acceptable excipient.

[0015] Preferably, the dosage form of the drug is a granule, tablet, capsule, oral liquid, pill, emulsion, suspension, injection, infusion, or spray.

[0016] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: 1. The present invention first proposes and verifies that a gene inhibitor that inhibits the expression of Tribbles homolog 3 pseudokinase can effectively inhibit the growth and regeneration of dorsal root ganglia; 2. It provides a new direction for the research and development of drugs for the treatment of neuropathic pain and autism spectrum disorder. Description of the Drawings

[0017] Figure 1 It shows the expression changes of Trib3 gene in the dorsal root ganglia (DRG) tissues of rats after sciatic nerve injury. Among them, Figure 1 A shows the results of transcriptome sequencing to detect differentially expressed genes in DRG tissues. Red represents upregulation, and green represents downregulation; Figure 1 B shows the expression changes of Trib3 gene detected by RT-PCR;

[0018] Figure 2 It shows the immunofluorescence staining results of rat DRG tissues. Among them, the red fluorescence is Trib3 protein, the green fluorescence is the neuronal marker Tuj-1, the blue fluorescence is the cell nucleus, and the scale bar is 200 μm;

[0019] Figure 3 The immunofluorescence staining results of the DRG tissues of rats 1 day after sciatic nerve injury. Among them, the red fluorescence is Trib3 protein, the green fluorescence is the neuronal marker Tuj-1, the blue fluorescence is the cell nucleus, and the scale bar is 200 μm.

[0020] Figure 4 It is the expression of Trib3 gene after transfection of siRNA into rat DRG neurons.

[0021] Figure 5 It is the effect of transfection of Trib3 siRNA into rat DRG neurons on the growth of neuronal processes. Among them, the left figure is the Tuj-1 staining result of neurons, the scale bar is 100 μm, and the right figure is the statistics of the longest process length and total process length of neurons.

[0022] Figure 6 It is the effect of transfection of Trib3 siRNA into rat DRG explants on the extension of neuronal processes. Among them, the left figure is the Tuj-1 staining result of neurons, the scale bar is 500 μm, and the right figure is the statistics of the average length of neuronal processes.

[0023] Figure 7 It is the effect of knocking down Trib3 on the regeneration of damaged axons of rat DRG neurons. Among them, the left figure is the Tuj-1 staining result of the regenerated axons in the microfluidic cell culture system, the scale bar is 500 μm, and the right figure is the statistics of the average length of the regenerated axons of neurons. Detailed implementation manners

[0024] The technical solutions of the present invention will be further described below.

[0025] Example 1: Modeling, sampling, sequencing and analysis of sciatic nerve injury in rats

[0026] 1. Adult male SD rats weighing 180 - 220 g were taken. After anesthesia, the hair on the left hind limb was shaved and disinfected. For the rats in the injury group (sciatic nerve injury, SN-Exp), the leg skin was cut open with a sterilized surgical scissors, the sciatic nerve was carefully separated and exposed with an ophthalmic scissors, and a 30-second clamping was performed with a clamping forceps. For the rats in the sham operation group (sham, SN-sham), only the nerve exposure operation was completed without nerve injury.

[0027] 2. After 1 day, the sciatic nerve was dissected upward until the ilium, the sciatic nerve was clamped with a hemostatic forceps against the ilium, and the L4-L5 DRG of the rat was horizontally pulled out. The DRG axons were trimmed with a micro scissors, and the DRG was placed in a cryotube and quickly frozen in liquid nitrogen, and stored at -80°C.

[0028] 3. Extract the total RNA of the DRG tissue obtained in step 2, treat it with oligo dT magnetic beads to obtain purified mRNA fragments, use this as a template to synthesize cDNA, perform PCR amplification, and sequence using Illumina HiSeq TM 4000.

[0029] 4. For the obtained raw data, use analysis software to screen and remove useless information, detect the difference in gene expression levels (fold change) between the sciatic nerve injury group and the sham operation group and perform log2 transformation, screen genes with log2(fold change) ≥ 1 and false discovery rate less than 0.05 to obtain significantly different genes, and draw a volcano plot based on the obtained different genes to visually display the gene expression conditions between different groups.

[0030] 5. The total RNA obtained in step 3 is reverse transcribed using Oligo dT primer to obtain cDNA, and RT-PCR detection is performed using the SYBRGreen Premix Ex Taq (TaKaRa Bio, Inc.) system. The primer sequences of the target gene Trib3 and the internal reference gene GAPDH are shown in Table 1 below, and the reaction conditions are shown in Table 2 below:

[0031] Table 1 Primer sequences of target gene Trib3 and internal reference gene GAPDH

[0032]

[0033] Table 2 RT-PCR reaction conditions

[0034]

[0035] Collect fluorescence values during the extension stage of each cycle; after the amplification reaction is completed, perform melting curve analysis of the product to ensure the quality of the PCR product. Use GAPDH as an internal reference to detect the Ct values of the target gene Trib3 and the internal reference GAPDH, and calculate the relative expression level of Trib3 by the ΔΔCt method.

[0036] The results are as Figure 1 shown, Figure 1 A shows the expression of different genes in the DRG tissue 1 day after sciatic nerve injury in rats detected by DRG tissue transcriptome sequencing. Genes with downregulated expression after sciatic nerve injury are shown in blue, and genes with upregulated expression are shown in red, among which the Trib3 gene is upregulated; Figure 1 B shows the expression of the Trib3 gene in the DRG tissue 1 day after sciatic nerve injury in rats detected by RT-PCR. After sciatic nerve injury in rats, the expression level of the Trib3 gene in the DRG tissue is significantly increased.

[0037] 6. After taking the rat DRG tissue sections, immunofluorescence staining was performed. Red fluorescence was used to label Trib3 protein, and green fluorescence was used to label Tuj-1. The localization and distribution of Trib3 protein in the DRG tissue of normal rats and the expression changes of Trib3 protein in the DRG tissue after sciatic nerve injury in rats were observed.

[0038] The localization and distribution of Trib3 protein in the DRG tissue of normal rats are as Figure 2 shown. In the rat DRG tissue, there is co-labeling of Trib3 and the neuron-specific marker Tuj-1, indicating that Trib3 protein is expressed in neurons in the DRG tissue; the expression changes of Trib3 protein in the DRG tissue after sciatic nerve injury are as Figure 3 shown. Compared with the rats in the sham operation group (sham), the level of Trib3 protein in the DRG tissue of the rats in the injury group (sciatic nerve injury) is higher, and the expression of Trib3 protein in neurons increases.

[0039] Example 2: Cultivation and transfection of rat DRG neurons and explants

[0040] 1. Cultivation of rat DRG neurons

[0041] The DRG tissue of Sprague Dawley rats was taken, cut into small segments, digested with collagenase for 1.5 hours and trypsin for 10 minutes respectively, and then the cells were resuspended with 15% BSA. After centrifugation, a precipitate containing DRG neurons was obtained. Cell culture was carried out using Neurobasal A medium containing B27 and L-glutamine, and the DRG neurons were seeded on poly-L-lysine-coated culture dishes for cell culture.

[0042] 2. Cultivation of rat DRG explants

[0043] The DRG tissue of Sprague Dawley rats was taken, first digested with 0.025% trypsin for 5 minutes, cultured using Neurobasal A medium containing B27 and L-glutamine, and the DRG was seeded on poly-L-lysine-coated culture dishes for in vitro tissue culture.

[0044] 3. Transfection of rat DRG neurons and explants

[0045] According to Lipofectamine TMMethod of RNAiMAX transfection reagent instructions: In DRG neurons and explants cultured in 12-well plates, 120 pmol of Trib3 siRNA was transfected into each well to inhibit the expression of Trib3, and 120 pmol of siRNA-NC was transfected as a control group.

[0046] The inhibitor of Trib3 and the inhibitor control were both synthesized by Guangzhou Ribobio Co., Ltd. The Trib3 siRNA and inhibitor control used are shown in Table 3 below:

[0047] Table 3 Sequences of Trib3 siRNA and inhibitor control

[0048] Trib3 siRNA Name Sequence Listing Number Sequence 5’→3’ siRNA-Trib3-1 SEQ ID NO: 5 GAAGAAACCGTTGGAGTTT siRNA-Trib3-2 SEQ ID NO: 6 CCTCAAGTTGCGTCGATTT siRNA-Trib3-3 SEQ ID NO: 7 GCTCTCAGCTCCTATACAC siRNA-NC SEQ ID NO: 8 GGCTCTAGAAAAGCCTATGC

[0049] 3.1 Detection of Trib3 expression level after transfection

[0050] After 36 h of transfection, total RNA was extracted. After reverse transcription, RT-PCR was performed using the SYBR Green Premix Ex Taq (TaKaRa Bio, Inc.) system. The primer sequences and reaction conditions of the target gene Trib3 and the internal reference gene GAPDH were the same as those in Example 1; the fluorescence value was collected at the extension stage of each cycle; after the amplification reaction was completed, the melting curve analysis of the product was performed. Using GAPDH as the internal reference, the Ct values of the target gene Trib3 and the internal reference GAPDH were detected, and the relative expression level of Trib3 was calculated by the ΔΔCt method.

[0051] The results are as Figure 4 shown. Compared with DRG neurons transfected with control siRNA (siRNA-NC), after transfection of siRNA fragment 1 (siRNA-Trib3-1) targeting Trib3 into rat DRG neurons, the average expression level of the Trib3 gene decreased, but there was no significant change; after transfection of siRNA fragment 2 (siRNA-Trib3-2) and siRNA fragment 3 (siRNA-Trib3-3) targeting Trib3, the expression level of the Trib3 gene in rat DRG neurons decreased significantly.

[0052] 3.2 Detection of neuronal process growth after transfection

[0053] After 36 h of transfection, cell slides were prepared and fixed with 4% paraformaldehyde (PFA), and cell immunofluorescence staining was performed. Tuj-1 was labeled with green fluorescence to observe the length of the neuronal processes labeled by Tuj-1 and detect the effect of the Trib3 inhibitor on the growth of rat DRG neuronal processes.

[0054] The results are as Figure 5As shown in the figure, after transfection of siRNA-Trib3-2 or siRNA-Trib3-3 into rat DRG neurons, the longest process length and total process length of DRG neurons were significantly shorter than those of DRG neurons transfected with control siRNA, indicating that the growth of rat DRG neuron processes was inhibited by Trib3 inhibitors.

[0055] 3.3 Detection of the growth of DRG explants after transfection

[0056] After 36 h of transfection, the cell slides were fixed with 4% paraformaldehyde (PFA), and Tuj-1 staining was performed by immunofluorescence to observe the length of the processes extending outward in the DRG explants labeled with Tuj-1 and detect the effect of Trib3 inhibitors on the growth of processes in rat DRG explants.

[0057] The results were as Figure 6 shown. After transfection of siRNA-Trib3-2 or siRNA-Trib3-3 into rat DRG explants, the length of the processes growing outward in the DRG explants was significantly shorter, indicating that Trib3 inhibitors also inhibited the growth of processes in rat DRG explants.

[0058] Example 3: Detection of the regeneration of damaged axons in rat neurons

[0059] (1) Take a sterile microfluidic chamber, attach it to a culture dish coated with poly-L-lysine, rinse the microfluidic chamber with complete medium, discard the medium, and add 3 μL of cell suspension containing 20,000 cells to the left hole of the microfluidic chamber to allow it to flow into the axon chamber in the middle of the microfluidic chamber, and culture it in a 5% CO2, 37 °C incubator for 30 min;

[0060] (2) Add 50 μL of complete medium to each well, discard the complete medium after 3 h of culture, and add 200 μL of neuron medium containing b27 to each well;

[0061] (3) After 16 h of culture, transfect 120 pmol of siRNA-Trib3-2, siRNA-Trib3-3 or siRNA-NC on the cell side respectively. After 12 h, change the medium and continue to culture with neuron complete medium;

[0062] (5) Continue to culture for 24 h, observe the axon growth under a microscope. When the axons grow out of the right side of the microfluidic chamber, use a bench-top vacuum pump to aspirate 5 times on the axon side with a negative pressure of 0.025 MPa for 30 s each time, and observe under a microscope until all the axons are severed;

[0063] (6) After continuing to culture for 36 h, take out the culture dish, add 200 μL of 4% PFA to each well of the microfluidic chamber, and fix the cells at room temperature;

[0064] (7) After fixation, immunofluorescence staining of cells was performed. Tuj-1 was labeled with green fluorescence, and the length of the regenerated axons of Tuj-1-labeled neurons after axonal injury was observed on the axonal side of the microfluidic cell culture system to detect the axonal regeneration of neurons.

[0065] The results were as Figure 7 shown. After axonal injury, the regrowth length of axons in DRG neurons transfected with siRNA-Trib3-2 or siRNA-Trib3-3 was significantly shorter, indicating that Trib3 inhibitors could inhibit the regeneration of damaged axons in rat DRG neurons.

Claims

1. Use of a gene inhibitor that inhibits the expression of Tribbles homolog 3 pseudokinase in the preparation of a drug for treating diseases caused by overgrowth of neuronal processes.

2. The application according to claim 1, characterized in that, The gene inhibitor is any one of siRNA, shRNA, sgRNA, miRNA, and antisense oligonucleotide.

3. The application according to claim 2, wherein The gene inhibitor is siRNA.

4. The application according to claim 1, characterized in that, The neuronal processes include axons and / or dendrites.

5. The application according to claim 1, wherein The application is in the preparation of a drug for treating diseases caused by overgrowth of neuronal processes in the peripheral nervous system.

6. The application according to claim 5, wherein The disease caused by overgrowth of neuronal processes in the peripheral nervous system is neuropathic pain.

7. The application according to claim 1, wherein The application is in the preparation of a drug for treating diseases caused by overgrowth of neuronal processes in the central nervous system.

8. The application according to claim 7, wherein The disease caused by overgrowth of neuronal processes in the central nervous system is autism spectrum disorder.

9. The application according to claim 1, characterized in that The drug contains a gene inhibitor that inhibits the expression of Tribbles homolog 3 pseudokinase as an active ingredient and pharmaceutically acceptable excipients.

10. The application according to claim 1, wherein The dosage form of the drug is granule, tablet, capsule, oral liquid, pill, emulsion, suspension, injection, infusion or spray.

Images