Rapid detection method of proteus mirabilis for non-disease diagnosis or non-treatment purpose

Abstract

The invention relates to the technical field of rapid detection methods, in particular to a rapid detection method for proteus mirabilis with a non-disease diagnosis or non-treatment purpose, firstly, an RPA reaction system and a CRISPR / Cas12a reaction system are respectively placed at the bottom of a PCR reaction tube and on the inner side of a tube cover, so that the competitive effect of CRISPR / Cas12a and RPA is avoided, and the detection accuracy is improved; the reaction rate and the sensitivity are ensured, and meanwhile, the risk of nucleic acid aerosol pollution is also avoided because the cover does not need to be opened; secondly, the RPA provided by the invention specifically amplifies a target DNA through a preferred primer, the CRISPR / Cas12a specifically recognizes a target sequence through preferred crRNA, under preferred reaction conditions, through double screening of the RPA and the CRISPR / Cas12a, rapid, sensitive and specific detection of proteus mirabilis can be realized, the reliability is high, the cross reactivity is low, and the method is convenient to popularize.

Description

Technical Field

[0001] The present invention relates to the technical field of rapid detection methods, and particularly relates to a rapid detection method for Proteus mirabilis for non-disease diagnosis or non-therapeutic purposes. Background Art

[0002] Proteus mirabilis is a specific pathogen in the genus Escherichia, belonging to a type of Escherichia coli. It is a Gram-negative bacterium with multiple virulence factors and can cause urinary tract infections (UTIs) in humans. Proteus mirabilis is one of the most common pathogens causing lower urinary tract infections (such as cystitis) and upper urinary tract infections (such as pyelonephritis). Proteus mirabilis is an important urinary tract pathogen with diverse infection routes, and its adverse effects on the human body include directly causing UTIs and their complications, as well as causing tissue damage through its virulence factors and immunopathological reactions. Therefore, rapid detection of Proteus mirabilis infection has great clinical significance because it can significantly improve the accuracy of diagnosis, accelerate the treatment process, reduce unnecessary antibiotic use, and lower the risk of complications caused by Proteus mirabilis infection.

[0003] Conventional detection methods for Proteus mirabilis cover a variety of techniques, including microbial culture, molecular biology detection (such as polymerase chain reaction, PCR), and mass spectrometry. Microbial culture, as a traditional method for detecting Proteus mirabilis, is considered the gold standard for detection. This method involves inoculating urine samples onto specific culture media and then culturing the bacteria under suitable conditions. Based on the bacterial culture, the biochemical characteristics of the bacteria are observed to confirm whether it is Proteus mirabilis; however, this method takes a long time, usually requiring 12 to 24 hours to complete, requires professional laboratory equipment and operators, and for some Proteus mirabilis strains that do not grow or grow slowly, they may not be detected by the culture method. Other methods include molecular biology methods, and the detection usually includes PCR and its derivative techniques, as well as immunological methods, such as enzyme-linked immunosorbent assay. Detection methods such as PCR usually require expensive laboratory equipment and professional technical personnel for operation, and immunological methods have a detection window period. Although molecular biology methods are highly sensitive, they do not always meet the requirements of being rapid, low-cost, and easy to operate simultaneously. Mass spectrometry identifies Proteus mirabilis by analyzing the mass fingerprint of bacterial proteins or peptides, and there are also problems such as the high cost of mass spectrometers and the need for professional training for operation and maintenance.

[0004] To overcome these limitations, researchers are developing new detection techniques, such as the RPA-CRISPR / Cas12a method, which combines isothermal nucleic acid amplification and CRISPR gene editing technologies. It can complete the detection of Proteus mirabilis in a shorter time, with simple operation and no dependence on expensive laboratory equipment, and is expected to become an ideal on-site rapid detection method.

[0005] However, there are still some defects in the existing RPA-CRISPR / Cas12a method for the detection of Proteus mirabilis. For example, in the existing detection operation process, the RPA amplification reaction is first carried out, and then the PRA reaction product is transferred to the CRISPR / Cas12a reaction system. It is necessary to open the lid to transfer the amplification product, which increases the risk of aerosol contamination. In addition, there are also problems of relatively high cross-reactivity and the need for further improvement of sensitivity and specificity. Summary of the Invention

[0006] The purpose of the present invention is to provide a rapid detection method for Proteus mirabilis for non-disease diagnosis or non-therapeutic purposes, aiming at the problems of the risk of aerosol contamination during detection, relatively high cross-reactivity, and the need for further improvement of sensitivity and specificity in the existing technology. By placing the RPA reaction system and the CRISPR / Cas12a reaction system at the bottom of the PCR reaction tube and the inner side of the tube lid respectively, the competitive effect between CRISPR / Cas12a and RPA is avoided, ensuring the reaction rate and sensitivity. At the same time, since there is no need to open the lid, the risk of nucleic acid aerosol contamination is also avoided. Secondly, the method provided by the present invention can achieve rapid, sensitive and specific detection of Proteus mirabilis.

[0007] In order to achieve the above purpose, the technical solution adopted by the present invention is as follows: A rapid detection method for Proteus mirabilis for non-disease diagnosis or non-therapeutic purposes, comprising the following steps: Add the RPA premix to the bottom of the reaction tube, and place the CRISPR / Cas12a premix on the inner side of the tube lid of the reaction tube, and collect them in one tube; Extract DNA from the test sample; Add the extracted DNA into the reaction tube and mix it with the RPA premix, close the tube lid, and carry out the RPA amplification reaction; perform centrifugation treatment to mix and react the CRISPR / Cas12a premix with the RPA reaction product; Perform fluorescence method or lateral flow biosensing strip detection to detect whether there is a signal of Proteus mirabilis; Wherein, the RPA premix includes RPA primers; The RPA primer sequences are: RPA-F: 5’-GTCTGTCATCATCTCGATCCCTCTATTCCTG-3’, RPA-R: 5’-ACGATTATTATCATTATCTGCGCTATCACCC-3’; The CRISPR / Cas12a premix includes crRNA and ssDNA signal probe; The sequence of crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUCCGCUGGUACCGGCAUCUGC-3’; The sequence of ssDNA signal probe is: 5’-FAM-TTATT-BHQ-3’.

[0008] The present invention provides a rapid detection method for Proteus mirabilis based on RPA-CRISPR / Cas12a. First, by placing the RPA reaction system and the CRISPR / Cas12a reaction system at the bottom of the PCR reaction tube and the inner side of the tube cap respectively, the present invention avoids the competitive effect between CRISPR / Cas12a and RPA, ensures the reaction rate and sensitivity. At the same time, since there is no need to open the lid, the risk of nucleic acid aerosol contamination is also avoided. Secondly, the RPA provided by the present invention specifically amplifies the target DNA through the optimized primers, and CRISPR / Cas12a specifically recognizes the target sequence through the optimized crRNA. Under the optimized reaction conditions, through the double screening of RPA and CRISPR / Cas12a, the rapid, sensitive and specific detection of Proteus mirabilis can be achieved, with high reliability and low cross-reactivity, which is convenient for popularization.

[0009] Further, the sample to be tested is a pretreated urine sample; The pretreated urine sample is prepared by the following method: Take the urine to be tested and perform centrifugation; Discard the supernatant, resuspend the precipitate with sterile water to obtain the pretreated urine sample.

[0010] Further, the specific method for extracting the DNA template is as follows: Heat the pretreated urine sample at 95 °C to 100 °C, perform centrifugation, and take the supernatant to obtain the extracted DNA template.

[0011] Further, heating is carried out using a metal bath or a water bath.

[0012] Further, heat for 5 min to 8 min.

[0013] Further, the rotation speed for centrifugation is 4000 rpm to 5000 rpm, and the centrifugation time is 30 s to 60 s.

[0014] The DNA template extraction method provided by the present invention does not require the use of a kit for extraction, has a low cost, and a short extraction time.

[0015] Furthermore, the temperature of the RPA amplification reaction is 37 °C to 42 °C, and the time of the RPA amplification reaction is 10 min to 12 min.

[0016] Furthermore, the temperature of the reaction between the CRISPR / Cas12a premix and the RPA reaction product is 37 °C to 42 °C, and the reaction time is 7 min to 10 min.

[0017] Furthermore, the volume ratio of the extracted DNA to the RPA premix is 1 to 1.5:23.5 to 24.

[0018] Furthermore, each 23.8 μL of the RPA premix includes 14.5 μL to 15 μL of the RPA Basic reaction buffer, 1 μL to 1.5 μL of 280 mM MgOAc, 1.1 μL to 1.3 μL of 10 μM RPA-F, 1.1 μL to 1.3 μL of 10 μM RPA-R, and the balance is DEPC-treated water.

[0019] Furthermore, each 10 μL of the CRISPR / Cas12a premix includes 0.5 μL to 1 μL of 1 μM Cas12a, 1.5 μL to 2 μL of 1 μM crRNA, 0.5 μL to 1 μL of 10 μM ssDNA probe, 3 μL to 4 μL of buffer buffer, and the balance is DEPC-treated water.

[0020] Furthermore, the added volume ratio of the RPA premix and the CRISPR / Cas12a premix is 2 to 3:1.

[0021] Furthermore, fluorescence method or lateral flow biosensing test strip is used to detect the signal of whether Proteus mirabilis is contained: if the fluorescence increases or the test line shows color, it indicates that Proteus mirabilis is contained in the sample to be tested.

[0022] The present invention provides a rapid detection method for Proteus mirabilis based on RPA-CRISPR / Cas12a. First, by placing the RPA reaction system and the CRISPR / Cas12a reaction system at the bottom of the PCR reaction tube and the inner side of the tube cap respectively, the present invention avoids the competitive effect between CRISPR / Cas12a and RPA, ensures the reaction rate and sensitivity. At the same time, since there is no need to open the cap, the risk of nucleic acid aerosol contamination is also avoided. Secondly, the RPA provided by the present invention specifically amplifies the target DNA through optimized primers, and CRISPR / Cas12a specifically recognizes the target sequence through optimized crRNA. Under optimized reaction conditions, through the double screening of RPA and CRISPR / Cas12a, rapid, sensitive and specific detection of Proteus mirabilis can be achieved, with high reliability and low cross-reactivity, which is convenient for popularization.

[0023] The rapid detection method for Proteus mirabilis provided by the present invention has a fast amplification speed and does not require additional cap opening, and can complete the detection of Proteus mirabilis in about 20 minutes.

[0024] The rapid detection method for Proteus mirabilis provided by the present invention has high specificity. RPA specifically amplifies the target DNA through primers, and CRISPR / Cas12a specifically recognizes the target DNA through crRNA. Through the double screening of RPA and CRISPR / Cas12a, Proteus mirabilis can be specifically detected without cross-reaction with common pathogenic bacteria.

[0025] The rapid detection method for Proteus mirabilis provided by the present invention has high sensitivity. Through the double amplification of RPA and CRISPR / Cas12a, Proteus mirabilis targets with a concentration of 2.8 copies / μL can be detected. Description of the Drawings

[0026] Figure 1 It is a data graph of RPA primer analysis in the example.

[0027] Figure 2 It is a data graph of crRNA screening in the example.

[0028] Figure 3 It is a data graph of the process of condition optimization in the example.

[0029] Figure 4 It is a data graph of the sensitivity test results in the example.

[0030] Figure 5 It is a data graph of the specificity test results in the example.

[0031] Figure 6 It is a display graph of the positions of the RPA premix and the CRISPR / Cas12a premix in the reaction tube. Detailed implementation manners

[0032] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Embodiment

[0033] Aiming at the problems existing in the prior art that there is a risk of aerosol pollution during detection, and the cross-reactivity is relatively high, and the sensitivity and specificity need to be further improved.

[0034] This embodiment provides a rapid detection method for Proteus mirabilis for non-disease diagnosis or non-therapeutic purposes, including the following steps: As Figure 6 shown, add the RPA premix to the bottom of the reaction tube, and place the CRISPR / Cas12a premix inside the tube cap of the reaction tube, and collect them in one tube; S1. Extract DNA from the sample to be tested; The sample to be tested is a pretreated urine sample; the pretreated urine sample is prepared by the following method: Take 1 mL of the urine sample to be tested in a 1.5 mL PCR tube and centrifuge at 4000 rpm for 45 s; Discard the supernatant, add 100 μL of sterile water to resuspend the precipitate, and shake well to obtain the pretreated urine sample.

[0035] Place the pretreated urine sample in a metal bath or water bath at 95 °C and heat for 5 min, centrifuge at 4000 rpm for 45 s, and take the supernatant, which is the extracted DNA sample.

[0036] In some embodiments, the specific method for extracting the DNA template is as follows: Place the pretreated urine sample under heating conditions of 95 °C to 100 °C, centrifuge, and take the supernatant to obtain the extracted DNA template.

[0037] In some embodiments, heating is performed using a metal bath or a water bath.

[0038] In some embodiments, heat for 5 min to 8 min.

[0039] In some embodiments, the rotation speed of the centrifugation treatment is 4000 rpm to 5000 rpm, and the time of the centrifugation treatment is 30 s to 60 s.

[0040] S2. Add 1.2 μL of the extracted DNA into the reaction tube and mix it with 23.8 μL of the RPA premix, close the tube cap, and perform an RPA amplification reaction at 39 °C for 10 min; RPA premix: 14.75 μL of RPA Basic reaction buffer, 1.25 μL of 280 mM MgOAc, 1.2 μL of 10 μM upstream primer (F), 1.2 μL of 10 μM downstream primer (R), 5.4 μL of DEPC-treated water.

[0041] In some embodiments, the volume ratio of the extracted DNA to the RPA premix is 1 - 1.5:23.5 - 24.

[0042] In some embodiments, every 23.8 μL of RPA premix contains 14.5 μL - 15 μL of RPA Basic reaction buffer, 1 μL - 1.5 μL of 280 mM MgOAc, 1.1 μL - 1.3 μL of 10 μM RPA-F, 1.1 μL - 1.3 μL of 10 μM RPA-R, and the balance is DEPC-treated water.

[0043] In some embodiments, the temperature of the RPA amplification reaction is 37°C - 42°C, and the time of the RPA amplification reaction is 10 min - 12 min.

[0044] S3. Centrifugation treatment. Mix 10 μL of the CRISPR / Cas12a premix with the RPA reaction product for reaction at a reaction temperature of 39°C and a reaction time of 7 - 10 min. The composition of the CRISPR / Cas12a reaction system: 0.875 μL of 1 μM Cas12a; 1.75 μL of 1 μM crRNA; 0.875 μL of 10 μM ssDNA probe; 3.5 μL of buffer; 3 μL of DEPC-treated water; in total 10 μL.

[0045] In some embodiments, every 10 μL of the CRISPR / Cas12a premix contains 0.5 μL - 1 μL of 1 μM Cas12a, 1.5 μL - 2 μL of 1 μM crRNA, 0.5 μL - 1 μL of 10 μM ssDNA probe, 3 μL - 4 μL of buffer, and the balance is DEPC-treated water.

[0046] In some embodiments, the added volume ratio of the RPA premix to the CRISPR / Cas12a premix is 2 - 3:1.

[0047] In some embodiments, the temperature of the mixing reaction of the CRISPR / Cas12a premix with the RPA reaction product is 37°C - 42°C, and the reaction time is 7 min - 10 min.

[0048] Perform fluorescence or lateral flow biosensing strip detection for signals indicating the presence of Proteus mirabilis; if fluorescence increases or the test line shows color, it indicates that the sample to be tested contains Proteus mirabilis.

[0049] Among them, the RPA premix includes RPA primers; The RPA primer sequences are: RPA-F: 5’-GTCTGTCATCATCTCGATCCCTCTATTCCTG-3’, RPA-R: 5’-ACGATTATTATCATTATCTGCGCTATCACCC-3’; The CRISPR / Cas12a premix includes crRNA and ssDNA signal probes; The sequence of crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUCCGCUGGUACCGGCAUCUGC-3’; The sequence of the ssDNA signal probe is: 5’-FAM-TTATT-BHQ-3’.

[0050] Specifically, this embodiment provides the exploration process of the rapid detection method of the embodiment: Step 1. Plasmid and clinical sample preparation Select the ureC gene of Proteus mirabilis (NC_010554.1) as the detection target gene, and synthesize the plasmid carrying the ureC gene by Sangon Biotech (Shanghai) Co., Ltd. Clinical strains are cultured in Luria-Bertani (LB) broth culture medium at a constant temperature of 37°C (120 r / min) for 12 hours, boiled at 95°C for 5 minutes, and then centrifuged to take the supernatant as the template.

[0051] Step 2. Primer design Using the ureC gene of Proteus mirabilis as the detection target gene, according to the RPA primer design principle, use the primer design software Primer Premier 6 to design 3 pairs of RPA forward and reverse candidate primers, and use NCBI-BLAST online to verify the specificity of the primers. The primers and target fragments are shown in Table 1. All primers are synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0052] Table 1 Primer sequences Name Sequence (5’→3’) F1 GTCTGTCATCATCTCGATCCCTCTATTCCTG R1 ACGATTATTATCATTATCTGCGCTATCACCC F2 GTCTGTCATCATCTCGATCCCTCTATTCCTG R2 AGTGCGTAAGATAACTTCTCCGACTCGTCCC F3 CATTAATACCGTGGACGAGCATCTTGATATGTTGA R3 GCCAAGTGCGTAAGATAACTTCTCCGACTC Step 3. RPA amplification reaction system 14.75 μL of RPA Basic reaction buffer (purchased from TwistDxTM, UK, for the TwistAmp® Basic kit of the recombinase polymerase amplification kit), 1.25 μL of 280 mM MgOAc, 1.2 μL of 10 μM upstream primer (F), 1.2 μL of 10 μM downstream primer (R), 1.2 μL of template, 5.4 μL of DEPC-treated water, for a total of 25 μL. The prepared reaction system is reacted at 39 °C for 15 minutes, and the results can be observed.

[0053] Step 4. Reaction system for one-tube RPA-CRISPR / Cas12a reaction The reaction of the one-tube method integrates the RPA reaction and the CRISPR / Cas12a reaction (EnGen® Lba Cas12a (Cpf1) nuclease purchased from NEB England Biolabs (Beijing)) in one tube. Composition of the CRISPR / Cas12a reaction system: 0.875 μL of 1 μM Cas12a; 1.75 μL of 1 μM crRNA; 0.875 μL of 10 μM ssDNA probe; 3 μL of DEPC water; 3.5 μL of buffer, for a total of 10 μL. Place the RPA reaction system at the bottom of the PCR reaction tube, and place the CRISPR / Cas12a system on the inner side of the PCR reaction tube cap. Add the sample to the RPA reaction system. After a 10-min RPA reaction at 39 °C, centrifuge at 1200 rpm for 10 seconds to centrifuge the CRISPR / Cas12a system on the inner side of the tube cap into the RPA reaction for the CRISPR / Cas12a cleavage reaction. Collect the fluorescence signal with a real-time fluorescence quantitative PCR instrument, and the detection can be completed in 7 - 10 min.

[0054] Step 5. Condition optimization (1) RPA primer screening: Using the plasmid with the ureC gene of Proteus mirabilis at a concentration of 10 4 copies / μL as the template, and using DEPC-treated water instead of the plasmid as the control, amplify with different RPA primer pairs according to the conditions in Step 3. Subsequently, add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) extraction solution to the reaction tube, mix well, centrifuge at 12000 rpm for 5 min, aspirate the supernatant, and extract the amplification product. Add the amplification product to 6×SuperStain LoadingBuffer at a ratio of 5:1, mix well, and perform electrophoresis on a 1.5% agarose gel at a constant voltage of 90 V for 30 min. Use a gel imager to develop and observe the results.

[0055] The results are as Figure 1as shown in A of []. According to the thickness of the bands of the amplification products, Primer 1 had the best effect. The sensitivity of Primer 1 was verified and it could reach 10 1 copies / μL, as shown in Figure 1 B of []. Screening of RPA primers for Proteus mirabilis. Lane 1: 250 bp DNA Ladder; Lane 2: F1R1 (246 bp); Lane 3: F1R1 control; Lane 4: F2R2 (171 bp); Lane 5: F2R2 control; Lane 6: F3R3 (212 bp); Lane 7: F3R3 control.

[0056] Analysis of the RPA amplification sensitivity of the F1R1 primer set. Lane 1: 250 bp DNA Ladder; Lane 2: plasmid concentration 10 2 copies / μL; Lane 3: plasmid concentration 10 1 copies / μL; Lane 4: plasmid concentration 10 0 copies / μL; Lane 5: negative control.

[0057] Design and screening of crRNA: crRNA was designed according to the optimal RPA primer amplification sequence, and the specific sequences are shown in Table 2; different crRNAs were used for reaction in the system described in Step 4, and the best crRNA was selected according to the intensity of the fluorescence signal and the time to reach the plateau. The results are as shown in Figure 2 [], and crRNA1 reached the plateau in a shorter time and had a higher fluorescence value at the end point. Therefore, crRNA1 was selected for the following experiments.

[0058] Table 2 Sequences of crRNA and ssDNA probes Name Sequence (5’→3’) crRNA1 UAAUUUCUACUAAGUGUAGAUCCGCUGGUACCGGCAUCUGC crRNA2 UAAUUUCUACUAAGUGUAGAUAACGGGAGACGCCCAAUGGG ssDNA probe FAM-TTATT-BHQ Optimization of the CRISPR / Cas12a system: Using plasmid (2.82×10 4 copies / μL) as the template, the reaction conditions such as the concentration of Cas12a (25 nM, 50 nM, 75 nM, 100 nM), the ratio of Cas12a / crRNA (1:1, 1:1.5, 1:2), and the concentration of ssDNA probe (150 nM, 250 nM, 350 nM) were optimized respectively. The fluorescence values at 10 min of the reaction were plotted, and the results are as shown in Figure 3 A of [], Figure 3 B of [], and Figure 3For C in it, the fluorescence values at different Cas12a concentrations vary little. Considering cost - effectiveness, the lowest concentration of 25 nM is selected as the final concentration. As the ratio of crRNA:Cas12a increases, the fluorescence value gradually increases, and finally the ratio of Cas12a:crRNA = 1:2 is selected as the final ratio. As the concentration of the ssDNA probe increases, the fluorescence value also increases, but there is no significant difference in the fluorescence values of the ssDNA probes at 250 nM and 300 nM. Therefore, 250 nM ssDNA probe is selected as the final concentration.

[0059] A. Optimization of Cas12a concentration; B. Optimization of Cas12a / crRNA ratio; C. Optimization of ssDNA probe concentration; The concentration of the plasmid template used is 10 4 copies / μL; Error bars represent the standard deviation of three repeated experiments.

[0060] Step 6, Sample pretreatment Nucleic acid extraction of Proteus mirabilis is carried out by the boiling method. The Proteus mirabilis suspension is directly thermally lysed at 95 °C for 5 min, centrifuged, and the supernatant is used as the RPA - CRISPR / Cas12a reaction template.

[0061] Step 7, Sensitivity test of the one - tube RPA - CRISPR / Cas12a detection method For the sensitivity detection with plasmid as the template, the plasmid standard containing the target fragment of the ureC gene of Proteus mirabilis is serially diluted to 2.8×10 4 copies / μL, 2.8×10 3 copies / μL, 2.8×10 2 copies / μL, 2.8×10 1 copies / μL and 2.8×10 0 copies / μL, and at the same time, DEPC - treated water is used as a negative control. According to the optimized reaction system in Step 4, 1.2 μL of the plasmid dilution is added to the RPA reaction system, and after a 10 - min RPA reaction at 39 °C, it is centrifuged at 1200 rpm for 10 seconds. The CRISPR / Cas12a system on the inner side of the tube cap is centrifuged into the RPA reaction for the CRISPR / Cas12a cleavage reaction. Fluorescence signals are collected by a real - time fluorescence quantitative PCR instrument, and the detection can be completed in 7 - 10 min. Plot the fluorescence values at 10 min of the reaction ( Figure 4 ) The reaction results show that this method can detect plasmid standards as low as 1×10 0 copies / μL.

[0062] Step 8, Specificity test of one-tube RPA-CRISPR / Cas12a DNA of pathogenic bacteria such as Staphylococcus aureus and Klebsiella pneumoniae was extracted by boiling method as templates, and one-tube RPA-CRISPR / Cas12a detection was carried out. The fluorescence values at 10 min of the reaction were plotted ( Figure 5 ). The results showed that this method had high specificity for Proteus mirabilis and there was no cross-reaction during the detection process.

[0063] From the results of the above embodiments, it can be seen that the present invention can quickly, sensitively, specifically and accurately detect Proteus mirabilis. It avoids cross-contamination of samples or the environment. This method has strong anti-interference ability, does not require complex nucleic acid extraction steps, and only simple thermal lysis can complete the sample pretreatment process. This method realizes one-tube RPA-CRISPR / Cas12a detection, does not require liquid transfer, simplifies the experimental steps, and reduces the possibility of aerosol contamination. In summary, this method can achieve rapid and accurate on-site detection of Proteus mirabilis.

[0064] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A rapid detection method for Proteus mirabilis for non-diagnostic or non-therapeutic purposes, characterized in that, It includes the following steps: Add the RPA premix to the bottom of the reaction tube, and place the CRISPR / Cas12a premix inside the tube cap of the reaction tube, collecting them in one tube; Extract DNA from the test sample; Add the extracted DNA into the reaction tube and mix it with the RPA premix, close the tube cap, and perform the RPA amplification reaction; Centrifuge to mix the CRISPR / Cas12a premix with the RPA reaction product for reaction; Perform fluorescence method or lateral flow biosensing test strip to detect the signal of Proteus mirabilis; Among them, the RPA premix includes RPA primers; The RPA primer sequences are: RPA-F: 5’-GTCTGTCATCATCTCGATCCCTCTATTCCTG-3’, RPA-R: 5’-ACGATTATTATCATTATCTGCGCTATCACCC-3’; The CRISPR / Cas12a premix includes crRNA and ssDNA signal probe; The sequence of crRNA is: 5’-UAAUUUCUACUAAGUGUAGAUCCGCUGGUACCGGCAUCUGC-3’; The sequence of ssDNA signal probe is: 5’-FAM-TTATT-BHQ-3’.

2. The rapid detection method according to claim 1, characterized in that, The test sample is a pretreated urine sample; The pretreated urine sample is prepared by the following method: Take the urine to be tested and centrifuge it; Discard the supernatant, take sterile water to resuspend the precipitate, and shake well to obtain the pretreated urine sample.

3. The rapid detection method according to claim 2, wherein The specific method for extracting the DNA template is as follows: Place the pretreated urine sample under the condition of 95℃ - 100℃ and heat it for 5 min - 8 min, centrifuge it, and take the supernatant to obtain the extracted DNA template.

4. The rapid detection method according to claim 1, wherein The temperature of the RPA amplification reaction is 37℃ - 42℃, and the time of the RPA amplification reaction is 10 min - 12 min.

5. The rapid detection method according to claim 1, characterized in that, The temperature for the reaction of mixing the CRISPR / Cas12a premix with the RPA reaction product is 37℃ - 42℃, and the reaction time is 7 min - 10 min.

6. The rapid detection method according to claim 1, wherein, The volume ratio of the extracted DNA to the RPA premix is 1 - 1.5:23.5 - 24.

7. The rapid detection method according to claim 6, characterized in that Every 23.8 μL of the RPA premix includes 14.5μL - 15 μL of RPA Basic reaction buffer, 1 μL - 1.5 μL of 280 mM MgOAc, 1.1 μL - 1.3 μL of 10μM RPA-F, 1.1 μL - 1.3 μL of 10 μM RPA-R, and the balance is DEPC-treated water.

8. The rapid detection method according to claim 7, characterized in that, Every 10 μL of the CRISPR / Cas12a premix includes 0.5 μL - 1 μL of 1μM Cas12a, 1.5 μL - 2 μL of 1 μM crRNA, 0.5 μL - 1 μL of 10 μM ssDNA probe, 3 μL - 4 μL of buffer buffer, and the balance is DEPC-treated water.

9. The rapid detection method according to claim 8, wherein The added volume ratio of the RPA premix and the CRISPR / Cas12a premix is 2 - 3:

1.

10. The rapid detection method according to any one of claims 1 to 9, characterized in that Perform fluorescence or lateral flow biosensing strip detection for signals indicating the presence of Proteus mirabilis: If fluorescence increases or the test line shows color, it indicates that the sample to be tested contains Proteus mirabilis.

Images