Methods for modulating complement factor b expression
By administering CFB-specific inhibitors, especially antisense compound 696844, the disease problem caused by dysregulation of complement bypass pathway is solved, and effective therapeutic effects on kidney and eye diseases are achieved.
Patent Information
- Application Number
- CN202380076989.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-11-02
- Filing Date
- 2023-11-02
- Publication Date
- 2025-07-25
AI Technical Summary
Imbalance of the complement bypass pathway is associated with a variety of diseases and diseases, and prior art is difficult to effectively inhibit the expression of complement factor B to improve these diseases.
The expression and activity of CFB is inhibited by administration of complement factor B (CFB)-specific inhibitors, especially antisense compounds or modified oligonucleotides, and the accumulation of complement components is reduced, such as compound 696844.
Effectively reduce the accumulation of complement components in disordered complement bypass pathways, such as kidney and eye diseases, improve disease symptoms or delay their progression.
Smart Images

Figure CN120379677A_ABST
Abstract
Description
[0001] Related Applications
[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 382,057, filed Nov. 2, 2022, which is incorporated herein by reference in its entirety.
[0003] Incorporation of Electronic Sequence Listing
[0004] This application contains an electronic sequence listing that has been submitted electronically and is hereby incorporated by reference in its entirety. The sequence listing was created on Sep. 29, 2023, is named "BIOL0467USLSEQ.xml", and is 45,762 bytes in size. Technical Field
[0005] Provided herein are methods of improving a disease or disorder associated with dysregulation of the complement alternative pathway by administering a complement factor B (CFB)-specific inhibitor to a subject. Background Art
[0006] The complement system is part of the host innate immune system and is involved in lysing foreign cells, enhancing phagocytosis of antigens, agglutinating antigen carriers, and attracting macrophages and neutrophils. The complement system is divided into three initiating pathways: the classical pathway, the lectin pathway, and the alternative pathway, which converge at component C3 to generate an enzyme complex called C3 convertase that cleaves C3 into C3a and C3b. C3b associates with the CFB-mediated C3 convertase and enables the generation of C5 convertase that cleaves C5 into C5a and C5b, thereby initiating the membrane attack pathway and causing the formation of a membrane attack complex (MAC) comprising components C5b, C6, C7, C8, and C9. The membrane attack complex (MAC) forms a transmembrane channel and disrupts the phospholipid bilayer of the target cell, thereby causing cell lysis.
[0007] In homeostasis, the alternative pathway is continuously activated at a low "idling" level because the alternative pathway is activated by the spontaneous hydrolysis of C3 and the production of C3b (generating C5 convertase). Dysregulation of the complement alternative pathway is associated with diseases and disorders, including diseases and disorders of the kidney and eye. Brief Description of the Drawings
[0008] Figure 1A , Figure 1B and Figure 1C show plasma CFB protein levels after single or repeated subcutaneous administration of compound 696844 or placebo in healthy subjects. The sample blood collection dates are represented as the visit dates on the x-axis, and the administration dates of compound 696844 are indicated by arrows. Figure 1AShown are the means (+ / - SEM) of percent change from baseline in plasma CFB levels (mcg / mL) following a single administration of placebo; or 10, 20, or 40 mg of compound 696844 (N=6 per group). Figure 1B Shown are mean CFB protein levels (mcg / mL) following repeated administration (8 times over 6 weeks) of placebo; or 10 or 20 mg of compound 696844 (N=6, 12 or 12 per group, respectively). LLNR, lower limit of normal range = 146 mcg / mL. Figure 1C Means (+ / - SEM) of percent change in plasma CFB levels (mcg / mL) from baseline after repeated administration are shown. Baseline (BL) is defined as the mean of measurements on Day -1 and Day 1 (pre-dose), including unscheduled measurements between Day -1 and Day 1 (pre-dose).
[0009] Figure 2A , Figure 2B and Figure 2C Shown are systemic levels of various components of the complement cascade (CFB protein levels, CH50 activity, AH50 activity, and factor B cleavage products (Bb)) for subjects who received subcutaneous injections of placebo or compound 696844. The date of sample blood collection is indicated by visit day on the x-axis, and the date of subcutaneous injection administration is indicated by an arrow. Figure 2A (placebo) and Figure 2B (20 mg compound 696844) shows the mean (+ / - SEM) of the percentage change from baseline in the levels of plasma CFB protein (mcg / mL), plasma Bb (CFB cleavage product) (mcg / mL), serum AH50 (a biomarker of complement alternative pathway activity) (U / mL), and serum CH50 (a biomarker of classical complement pathway activity) (U / mL) are represented on the y-axis; baseline (BL) as Figure 1A and 1B defined. Figure 2C is a scatter plot of serum AH50 hemolytic activity (UmL) (x-axis) and CFB protein levels (mcg / ml) (y-axis) in subjects receiving placebo or before (Group 1, pentagons) or after administration of Compound 696844 (Group 2, diamonds).
[0010] Figure 3A and Figure 3B Urine protein / creatinine ratios in 24-hour urine samples of individual subjects before administration of Compound 696844 (baseline) and at Week 29 are shown. Figure 3A The urine protein / creatinine ratio for each subject is shown, and Figure 3B The percent change in urine protein / creatinine ratio from baseline to Week 29 is shown for each subject.
[0011] Figure 4A and Figure 4B shows the urinary protein excretion rate (mcg / day) in 24-hour urine samples of individual subjects before administration of compound 696844 (baseline) and at week 29. Figure 4A shows the urinary protein excretion rate for each subject, and Figure 4B shows the percentage change in the urinary protein excretion rate for each subject from baseline to week 29.
[0012] Figure 5 shows the glomerular filtration rate estimated based on the serum creatinine concentration (eGFR) of each subject from before administration of compound 696844 (baseline) to week 37. Using CKD-EPI 2009 adjusted values mL / min / 1.72m 2 . The sample serum collection dates are represented as weeks on the x-axis. Baseline (BL) is as Figure 1A and 1B defined.
[0013] Figure 6 shows the plasma CFB concentration (mg / dL) of subjects treated from before administration of compound 696844 (baseline) to week 37. The sample blood collection dates are represented as weeks on the x-axis, where the number of subjects providing the samples is indicated. The upper limit of normal (ULN) and lower limit of normal (LLN) are shown as indicated. Baseline is defined as the mean of the last 2 measurements obtained before the first dose of the study drug.
[0014] Figure 7 shows the urine Ba (factor B cleavage product) concentration (micrograms / L) of subjects treated from before administration of compound 696844 (baseline) to week 37. The sample collection dates are represented as weeks on the x-axis, where the number of subjects providing the samples is indicated. The upper limit of normal (ULN) and lower limit of normal (LLN) are shown as indicated. Baseline (BL) is defined as the mean of the last 2 measurements obtained before the first dose of compound 696844.
[0015] Figure 8 shows the mean percentage change relative to baseline of the means (+ / - v SEM) of plasma CFB, plasma Bb, urine Ba, serum AH50 activity, and serum CH50 activity at weeks 21, 25, and 27. Baseline (BL) is as Figure 1A and 1B defined. SUMMARY OF THE INVENTION
[0016] The complement system mediates innate immunity and plays an important role in the normal inflammatory response to injury, but its dysregulation can lead to severe damage. Dysregulation, such as overactivation of the classical, lectin, or alternative complement pathways, can result in disease or disorder. Activation of the alternative complement pathway beyond its constitutive "tick-over" level can lead to unrestrained overactivity and manifest as a disease or disorder of complement dysregulation.
[0017] The present invention provides methods for ameliorating a disease or disorder associated with complement pathway dysregulation in a subject by administering a complement factor B (CFB)-specific inhibitor. In some embodiments, methods are provided for ameliorating a disease or disorder associated with dysregulation of the alternative complement pathway in a subject by administering a complement factor B (CFB)-specific inhibitor. Several embodiments provided herein relate to a method of inhibiting CFB expression in a subject by administering a CFB-specific inhibitor to a subject having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway. Certain embodiments provided herein relate to a method of reducing or inhibiting the accumulation of C3 deposition in the kidney or eye of a subject having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway, the method comprising administering a CFB-specific inhibitor to the subject. In certain embodiments, the disease or disorder associated with dysregulation of the alternative complement pathway is a kidney disease or disorder. In certain embodiments, the kidney disease or disorder is a nephropathy, and in certain embodiments, the nephropathy is IgA nephropathy (Berger's disease). In certain embodiments, the disease or disorder associated with dysregulation of the alternative complement pathway is an eye disease or disorder. In certain embodiments, the eye disease or disorder is age-related macular degeneration, and in certain embodiments, the eye disease or disorder is geographic atrophy associated with age-related macular degeneration. In certain embodiments, the CFB-specific inhibitor is an antisense compound. In certain embodiments, the CFB-specific inhibitor is a modified oligonucleotide. In certain embodiments, the CFB-specific inhibitor is a GalNAc-conjugated modified oligonucleotide.
[0018] In certain embodiments, the method comprises administering a therapeutically effective amount of compound 696844. In certain embodiments, the therapeutically effective amount ranges from about 10 mg to about 100 mg. In certain embodiments, the therapeutically effective amount ranges from about 40 mg to about 100 mg. In certain embodiments, the therapeutically effective amount ranges from about 40 mg to about 70 mg. In certain embodiments, the therapeutically effective amount ranges from about 70 mg to about 100 mg. In certain embodiments, the therapeutically effective amount is about 10 mg, about 20 mg, about 40 mg, about 70 mg, or about 100 mg. In certain embodiments, the therapeutically effective amount is administered about once every 4 weeks. In certain embodiments, the therapeutically effective amount is administered about once every 8 weeks. In certain embodiments, the therapeutically effective amount is administered about once every 12 weeks. In certain embodiments, the therapeutically effective amount is administered about once every 16 weeks. In certain embodiments, the therapeutically effective amount is administered about once every 24 weeks. In certain embodiments, the therapeutically effective amount is administered about once every 6 months. In certain embodiments, the therapeutically effective amount is administered monthly. In certain embodiments, the therapeutically effective amount is administered once every two months. In certain embodiments, the therapeutically effective amount is administered once every three months. In certain embodiments, the therapeutically effective amount is administered quarterly. In certain embodiments, the therapeutically effective amount is administered twice a year (semi-annually). In certain embodiments, the therapeutically effective amount is administered annually.
[0019] In certain embodiments, the method comprises administering a loading dose of about 10 mg, about 20 mg, about 40 mg, about 70 mg, or about 100 mg of compound 696844 about once every 2 weeks, and subsequently administering a maintenance dose of about 10 mg, about 20 mg, about 40 mg, about 70 mg, or about 100 mg of compound 696844 about once every 4 weeks, about once every 8 weeks, about once every 12 weeks, or about once every 24 weeks. In certain embodiments, the method comprises administering a loading dose of about 10 mg, about 20 mg, about 40 mg, about 70 mg, or about 100 mg of compound 696844 about once every 4 weeks, and subsequently administering a maintenance dose of about 10 mg, about 20 mg, about 40 mg, about 70 mg, or about 100 mg of compound 696844 about once every 4 weeks, about once every 8 weeks, about once every 12 weeks, or about once every 24 weeks. In some embodiments, the method comprises administering at least 2 loading doses, at least 3 loading doses, at least 4 loading doses, at least 5 loading doses, or at least 6 loading doses.
[0020] In certain embodiments, the method includes administering a loading dose of about 40 mg to about 100 mg of Compound 696844 approximately once every 2 weeks, and subsequently administering a maintenance dose of about 40 mg to about 100 mg of Compound 696844 approximately once every 4 weeks, once every 8 weeks, once every 12 weeks, or once every 24 weeks. In certain embodiments, the method includes administering a loading dose of about 40 mg to about 100 mg of Compound 696844 approximately once every 4 weeks, and subsequently administering a maintenance dose of about 40 mg to about 100 mg of Compound 696844 approximately once every 4 weeks, once every 8 weeks, once every 12 weeks, or once every 24 weeks. In some embodiments, the method includes administering at least 2 loading doses, at least 3 loading doses, at least 4 loading doses, at least 5 loading doses, or at least 6 loading doses.
[0021] In certain embodiments, the method includes administering a loading dose of about 40 mg to about 70 mg of Compound 696844 approximately once every 2 weeks, and subsequently administering a maintenance dose of about 40 mg to about 70 mg of Compound 696844 approximately once every 4 weeks, once every 8 weeks, once every 12 weeks, or once every 24 weeks. In certain embodiments, the method includes administering a loading dose of about 40 mg to about 70 mg of Compound 696844 approximately once every 4 weeks, and subsequently administering a maintenance dose of about 40 mg to about 70 mg of Compound 696844 approximately once every 4 weeks, once every 8 weeks, once every 12 weeks, or once every 24 weeks. In some embodiments, the method includes administering at least 2 loading doses, at least 3 loading doses, at least 4 loading doses, at least 5 loading doses, or at least 6 loading doses. Detailed Description
[0022] It should be understood that both the foregoing general description and the following detailed description are merely exemplary and explanatory and are not restrictive. As used herein, unless otherwise specifically stated, the use of the singular includes the plural. Unless otherwise indicated, as used herein, the use of "or" means "and / or". Further, the use of the term "comprising" and other forms, such as "comprises" and "comprised of", is not restrictive. Additionally, unless otherwise specifically noted, terms such as "element" or "component" cover elements and components that include one unit, as well as elements and components that include more than one subunit.
[0023] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are hereby expressly incorporated by reference in their entirety and in part as discussed herein.
[0024] Definition
[0025] Unless otherwise defined, the terms, procedures, and techniques used in analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry as described herein are well known and commonly used in the art. To the extent permitted, all patents, applications, published applications, and other publications, as well as other data, mentioned throughout this disclosure are incorporated herein by reference in their entirety.
[0026] Unless otherwise indicated, the following terms have the following meanings:
[0027] As used herein, "2'-deoxynucleoside" means a nucleoside that includes a 2'-H (H) deoxyribosyl sugar moiety. In certain embodiments, the 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside and includes a 2'-β-D-deoxyribosyl sugar moiety having the β-D ribosyl configuration found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside or a nucleoside that includes an unmodified 2'-deoxyribosyl sugar moiety may include a modified nucleobase or may include an RNA nucleobase (uracil).
[0028] As used herein, "2'-MOE" means a 2'-OCH2CH2OCH3 group that replaces the 2'-OH group of a ribosyl sugar moiety. A "2'-MOE sugar moiety" means a sugar moiety having a 2'-OCH2CH2OCH3 group that replaces the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" means O-methoxyethyl.
[0029] As used herein, a "2'-MOE nucleoside" or a "2'-OCH2CH2OCH3 nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety (or a 2'-OCH2CH2OCH3 ribosyl sugar moiety).
[0030] As used herein, "5-methylcytosine" refers to cytosine that is modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleobase.
[0031] As used herein, "about" means plus or minus 7% of the value provided.
[0032] As used herein, "administering" or "administration" means providing an agent, pharmaceutical composition, or compound to a human subject.
[0033] As used herein, "improvement" in connection with treatment means that at least one symptom or characteristic is improved relative to the same symptom or characteristic without treatment. In certain embodiments, the improvement is a reduction in the severity or frequency of a symptom or characteristic, or a delay in the onset or a slowing of the progression of the severity or frequency of a symptom or characteristic. The progression or severity of a symptom or characteristic can be determined by subjective or objective measures known to those of skill in the art.
[0034] "Antisense compound" means a compound capable of hybridizing to a target nucleic acid by hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds such as antisense oligonucleotides, siRNA, shRNA, ssRNA, and occupancy-based compounds. Antisense compounds can include modified oligonucleotides. Antisense compounds can include modified oligonucleotides and conjugate groups.
[0035] As used herein, "CFB nucleic acid" or "factor B nucleic acid" or "complement factor B nucleic acid" means any nucleic acid encoding complement factor B. For example, in certain embodiments, the complement factor B nucleic acid includes a DNA sequence encoding complement factor B, an RNA sequence transcribed from DNA encoding complement factor B (including genomic DNA containing introns and exons), and an mRNA sequence encoding complement factor B. "Complement factor B mRNA" means an mRNA encoding complement factor B protein.
[0036] As used herein, "complement factor B", "CFB", "factor B", "FB", "complement factor B protein", "CFB protein", or "factor B protein" means the polypeptide expression product of a CFB nucleic acid.
[0037] As used herein, "complement component" means a product, by-product, end product, terminal product, or activation product of the complement pathway. In certain embodiments, the complement component is a by-product. In certain embodiments, the complement component is an end product or terminal product. In certain embodiments, the complement component is a by-product, end product, terminal product, or activation product of the alternative complement pathway. In certain embodiments, the complement component is any one of C3, C3a, C3b, C4b, C3dg, C5, C5a, C5b, C6, C7, C8, and C9.
[0038] "CFB specific inhibitor" refers to any agent that can specifically inhibit the expression or activity of CFB RNA and / or CFB protein at the molecular level. For example, CFB specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of CFB RNA and / or CFB protein. In certain embodiments, the CFB specific inhibitor is compound 696844. The activity of the CFB inhibitor, the reduction of CFB RNA, or the reduction of CFB protein can be evaluated by the methods described in WO 2015 / 168635.
[0039] As used herein, "dose" means the amount of the agent administered. In certain embodiments, the agent is compound 696844, and in certain embodiments, the agent is a compound having the chemical structure of compound 696844, or a pharmaceutically acceptable salt thereof.
[0040] As used herein, the term "internucleoside bond" is a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, "modified internucleoside bond" means any internucleoside bond other than a phosphodiester internucleoside bond. "Phosphorothioate internucleoside bond" is a modified internucleoside bond in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside bond is replaced by a sulfur atom.
[0041] As used herein, "loading dose" means a therapeutically effective amount of the agent administered during an initial dosing phase, during which the target concentration of the agent is achieved. "Initial loading dose" means the first administered loading dose. "Last loading dose" means the most recently administered loading dose before the first maintenance dose is administered.
[0042] As used herein, "maintenance dose" means a therapeutically effective amount of the agent administered during a dosing phase after the target concentration of the agent has been reached and maintained.
[0043] As used herein, the term "FB-L Rx " and "compound 696844" are interchangeable.
[0044] As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein, "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" is a group of atoms other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-Methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
[0045] As used herein, "nucleoside" means a compound comprising a nucleobase and a sugar moiety. The nucleobase and the sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. "Linked nucleosides" are nucleosides that are linked in a continuous sequence (i.e., there are no additional nucleosides between the linked nucleosides).
[0046] As used herein, "oligonucleotide" means a polymer of linked nucleosides linked via internucleoside bonds, where each nucleoside and internucleoside bond can be modified or unmodified. Unless otherwise specified, oligonucleotides consist of 8 to 50 linked nucleosides.
[0047] As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or internucleoside bond is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside modifications or internucleoside modifications.
[0048] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for administration to an animal. Some such carriers enable pharmaceutical compositions to be formulated, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.
[0049] As used herein, "pharmaceutically acceptable salt" means a physiologically acceptable and pharmaceutically acceptable salt of a compound. The pharmaceutically acceptable salt retains the desired biological activity of the parent compound and does not produce an undesired toxicological effect thereon.
[0050] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can comprise an oligomeric compound and a sterile aqueous solution.
[0051] As used herein, "potassium salt" means a salt of a modified oligonucleotide or compound, where the cation of the salt is potassium.
[0052] As used herein, "reduced or inhibited amount or activity" means a reduction or blockage of transcriptional expression or activity relative to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate complete elimination of transcriptional expression or activity.
[0053] As used herein, "RNA" means an RNA transcript and includes precursor mRNA and mature mRNA, unless otherwise specified.
[0054] As used herein, "sodium salt" means a salt of a modified oligonucleotide or compound, where the cation of the salt is sodium.
[0055] As used herein, "subject" refers to a human or non-human animal. In certain embodiments, the subject is a human subject. A "subject in need thereof" is a subject who would benefit from administration of a compound disclosed herein.
[0056] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. "Unmodified sugar moiety" means the 2'-OH(H)β-D-ribosyl moiety found in RNA ("unmodified RNA sugar moiety"), or the 2'-H(H)β-D-deoxyribosyl moiety found in DNA ("unmodified DNA sugar moiety"). The unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. "Modified sugar moiety" or "modified sugar" means a modified furanosyl moiety or a sugar substitute.
[0057] As used herein, "symptom or characteristic" means any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is apparent to the subject or to a medical professional examining or testing the subject. In certain embodiments, the characteristic becomes apparent after an invasive diagnostic test (including but not limited to an autopsy test). In certain embodiments, the marker becomes apparent on a brain MRI scan.
[0058] As used herein, "CFB RNA" corresponds to the RNA expression product of human factor B, and "CFB RNA" can refer to precursor mRNA or mRNA.
[0059] As used herein, "therapeutically effective amount" means the amount of an agent that provides a therapeutic benefit to a human subject. For example, a therapeutically effective amount improves the symptoms or characteristics of a disease or disorder.
[0060] As used herein, "trough concentration" means the concentration of an analyte (e.g., CFB protein in a biological sample) collected from a dosed human subject immediately before administration of a subsequent dose or the analyte concentration on the last day of a study.
[0061] As used herein, "one week" means 7 days.
[0062] Certain embodiments
[0063] Example 1. A method of ameliorating a disease or disorder associated with a dysregulation of the alternative complement pathway in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical structure:
[0064]
[0065] or a pharmaceutically acceptable salt thereof.
[0066] Example 2. The method according to Example 1, wherein the compound is a sodium salt or a potassium salt.
[0067] Example 3. A method of ameliorating a disease or disorder associated with a dysregulation of the alternative complement pathway in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical structure:
[0068]
[0069] Example 4. A method of ameliorating a disease or disorder associated with a dysregulation of the alternative complement pathway in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound, wherein the compound has the following chemical symbol (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T d s G ds T ds m C es m C es A es G es m C e (SEQ ID NO:4); wherein,
[0070] A = adenine nucleobase,
[0071] m C = 5-methylcytosine nucleobase,
[0072] G = guanine nucleobase,
[0073] T = thymine nucleobase,
[0074] e = 2'-MOE sugar moiety,
[0075] d = 2'-β-D-deoxyribosyl sugar moiety,
[0076] s = phosphorothioate internucleoside bond, and
[0077] GalNAc3-7 a-o'=
[0078]
[0079] Example 5. A method of reducing the expression of Complement Factor B (CFB) RNA in a human subject having a disease or disorder associated with a dysregulation of the alternative complement pathway or at risk of having said disease or disorder, said method comprising administering to said human subject a therapeutically effective amount of a compound according to the following chemical structure:
[0080]
[0081] or a pharmaceutically acceptable salt thereof.
[0082] Example 6. The method according to Example 5, wherein the compound is a sodium salt or a potassium salt.
[0083] Example 7. A method of reducing the expression of Complement Factor B (CFB) RNA in a human subject having a disease or disorder associated with a dysregulation of the alternative complement pathway or at risk of having said disease or disorder, said method comprising administering to said human subject a therapeutically effective amount of a compound according to the following chemical structure:
[0084]
[0085] Example 8. A method of reducing Complement Factor B (CFB) RNA in a human subject having a disease or disorder associated with a dysregulation of the alternative complement pathway or at risk of having said disease or disorder, said method comprising administering to said human subject a therapeutically effective amount of a compound, wherein the compound has the following chemical symbol (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C dsm C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO:4); wherein,
[0086] A = adenine nucleobase,
[0087] m C = 5-methylcytosine nucleobase,
[0088] G = guanine nucleobase,
[0089] T = thymine nucleobase,
[0090] e = 2'-MOE sugar moiety,
[0091] d = 2'-β-D-deoxyribosyl sugar moiety,
[0092] s = phosphorothioate internucleoside linkage, and
[0093] GalNAc3-7 a-o'=
[0094]
[0095] Example 9. The method according to any one of Examples 6 to 8, wherein the CFB mRNA is reduced.
[0096] Example 10. The method according to any one of Examples 6 to 8, wherein the CFB protein is reduced.
[0097] Example 11. The method according to any one of Examples 6 to 10, wherein administration of the compound reduces the CFB protein in one or both eyes.
[0098] Example 12. The method according to any one of Examples 6 to 11, wherein administration of the compound reduces the CFB protein in one or both kidneys.
[0099] Example 13. The method according to Example 12, wherein administration of the compound reduces the CFB protein in glomeruli.
[0100] Example 14. A method for reducing the level of complement components in the eyes or kidneys of a human subject suffering from a disease or disorder associated with dysregulation of the complement alternative pathway or at risk of developing said disease or disorder, said method comprising administering to said human subject a therapeutically effective amount of a compound having the following chemical structure:
[0101]
[0102] or a pharmaceutically acceptable salt thereof.
[0103] Example 15. The method according to Example 14, wherein the compound is a sodium salt or a potassium salt.
[0104] Example 16. A method for reducing the level of complement components in the eyes or kidneys of a human subject suffering from a disease associated with dysregulation of the complement alternative pathway or at risk of developing said disease, said method comprising administering to said human subject a therapeutically effective amount of a compound having the following chemical structure:
[0105]
[0106] Example 17. A method for reducing the level of complement components in the eyes or kidneys of a human subject suffering from a disease or disorder associated with dysregulation of the complement alternative pathway or at risk of developing said disease or disorder, said method comprising administering to said human subject a therapeutically effective amount of a compound, wherein the compound has the following chemical symbol (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m Ce (SEQ ID NO:4); wherein,
[0107] A = adenine nucleobase,
[0108] m C=5-methylcytosine nucleobase,
[0109] G = guanine nucleobase,
[0110] T = thymine nucleobase,
[0111] e=2'-MOE sugar moiety,
[0112] d = 2'-β-D-deoxyribosyl sugar moiety,
[0113] s = phosphorothioate internucleoside linkage, and
[0114] GalNAc3-7 a-o'=
[0115]
[0116] Embodiment 18. A method according to any one of embodiments 14 to 17, wherein the complement component is any one of C3, C3a, C3b, C4b, C3dg, C5, C5a, C5b, C6, C7, C8 and C9.
[0117] Example 19. A method of reducing complement factor B (CFB) protein in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound according to the following chemical structure:
[0118]
[0119] or a pharmaceutically acceptable salt thereof.
[0120] Embodiment 20. The method according to embodiment 19, wherein the compound is a sodium salt or a potassium salt.
[0121] Example 21. A method of reducing complement factor B (CFB) protein in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound according to the following chemical structure:
[0122]
[0123] Example 22. A method of reducing complement factor B (CFB) protein in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound, wherein the compound has the following chemical symbol (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO:4); wherein,
[0124] A = adenine nucleobase,
[0125] m C = 5-methylcytosine nucleobase,
[0126] G = guanine nucleobase,
[0127] T = thymine nucleobase,
[0128] e = 2'-MOE sugar moiety,
[0129] d = 2'-β-D-deoxyribosyl sugar moiety,
[0130] s = phosphorothioate internucleoside linkage, and
[0131] GalNAc3-7 a-o'=
[0132]
[0133] Example 23. The method according to any one of Examples 19 to 22, wherein the human subject has a disease or disorder associated with a dysregulation of the alternative complement pathway.
[0134] Example 24. The method according to any one of Examples 1 to 23, wherein the activity of the complement pathway is elevated.
[0135] Example 25. The method according to any one of Examples 1 to 24, wherein the activity of the alternative complement activity is elevated.
[0136] Example 26. The method according to Example 24 or Example 25, wherein the elevated activity is associated with a disease or disorder of the human subject.
[0137] Example 27. The method according to any one of Examples 1 to 26, wherein reducing CFB protein ameliorates the disease or disorder.
[0138] Example 28. The method according to any one of Examples 1 to 18 or 23 to 27, wherein the disease or disorder is an ocular disease or disorder.
[0139] Example 29. The method according to any one of Examples 1 to 18 or 23 to 28, wherein the disease or disorder is macular degeneration, neuromyelitis optica; corneal disease, corneal inflammation; autoimmune uveitis; or diabetic retinopathy.
[0140] Example 30. The method according to Example 29, wherein the macular degeneration is age-related macular degeneration (AMD).
[0141] Example 31. The method according to Example 30, wherein the AMD is wet AMD or intermediate AMD.
[0142] Example 32. The method according to Example 30, wherein the AMD is dry AMD.
[0143] Example 33. The method according to any one of Examples 1 to 18 or 23 to 32, wherein the disease or disorder is geographic atrophy associated with AMD.
[0144] Example 34. The method according to any one of Examples 1 to 18 or 23 to 27, wherein the disease or disorder is a kidney disease or disorder.
[0145] Example 35. The method according to Example 34, wherein the kidney disease or disorder is IgA nephropathy.
[0146] Example 36. The method according to Example 34, wherein the disease is lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS).
[0147] Example 37. The method according to Example 36, wherein the aHUS is characterized by thrombotic microangiopathy.
[0148] Example 38. The method according to any one of Examples 34 to 36, wherein the disease or disorder is a kidney disease or disorder associated with C3 deposition.
[0149] Example 39. The method according to Example 38, wherein the kidney disease or disorder is associated with C3 deposition in the glomerulus.
[0150] Example 40. The method according to any one of Examples 34 to 39, wherein the disease or disorder is a kidney disease or disorder associated with a below-normal circulating C3 level.
[0151] Example 41. The method according to Example 40, wherein the circulating C3 level is a serum or plasma C3 level.
[0152] Example 42. The method according to any one of Examples 1 to 41, wherein administering the compound reduces the accumulation of C3 levels in the eye.
[0153] Example 43. The method according to Example 42, wherein the accumulation is in blood vessels.
[0154] Example 44. The method according to any one of Examples 1 to 41, wherein administering the compound reduces the accumulation of C3 in the kidney.
[0155] Example 45. The method according to any one of Examples 1 to 41 or 44, wherein administering the compound reduces the C3 level in the kidney or reduces the accumulation of renal C3 deposition.
[0156] Example 46. The method according to Example 41 or any one of Examples 44 to 45, wherein administering the compound reduces the C3 level in the glomerulus or reduces the accumulation of C3.
[0157] Example 47. The method according to any one of Examples 1 to 18 or 23 to 27, wherein the disease or disorder is ANCA-associated vasculitis, antiphospholipid syndrome (also known as antiphospholipid antibody syndrome (APS)), asthma, rheumatoid arthritis, myasthenia gravis, multiple sclerosis, preeclampsia, or a metabolic disorder (such as NASH).
[0158] Example 48. The method according to any one of Examples 1 to 47, wherein the subject is identified as having a disease or disorder associated with a dysregulation of the complement alternative pathway or being at risk of developing the disease or disorder.
[0159] Example 49. The method according to Example 48, wherein the identification comprises detecting the complement level or the membrane attack complex level in the blood of the subject.
[0160] Example 50. The method according to Example 49, wherein the identification comprises detecting the complement level or the membrane attack complex level in the serum or plasma of the subject.
[0161] Example 51. The method according to Example 49, wherein the identification comprises performing a genetic test for a gene mutation of a complement factor associated with the disease or disorder.
[0162] Example 52. The method according to any one of Examples 1 to 18 or 23 to 51, wherein at least one symptom or feature of the disease or disorder associated with a dysregulation of the complement alternative pathway is improved.
[0163] Example 53. The method according to Example 52, wherein the symptom or feature is proteinuria; progressive decline in kidney function; C3 deposition in the kidney; hematuria; hypertension; kidney inflammation; IgA deposition in the glomerular mesangium; overactivity of the complement alternative pathway; elevated plasma CFB protein; elevated Bb in serum, plasma or urine; elevated Ba in serum, plasma or urine; elevated sC5b-9 in serum, plasma or urine; elevated or decreased C3 in serum, plasma or urine; elevated C4 in serum, plasma or urine; or elevated serum AH50 activity.
[0164] Example 54. The method according to Example 52, wherein the symptom or feature is progressive decline in vision; progressive decline in low-luminance vision; progressive decline in best-corrected vision; progressive decline in central vision; morphological changes in the choroidal capillaries; geographic atrophy of the eye; C3 deposition in the eye; overactivity of the complement alternative pathway; elevated plasma CFB protein; elevated Bb in serum, plasma or urine; elevated Ba in serum, plasma or urine; elevated sC5b-9 in serum, plasma or urine; elevated or decreased C3 in serum, plasma or urine; elevated C4 in serum, plasma or urine; or elevated serum AH50 activity.
[0165] Example 55. The method according to any one of Examples 1 to 54, wherein administering the compound slows or prevents vision loss; slows or prevents low-luminance vision loss; slows or prevents best-corrected visual acuity loss; slows or prevents central vision loss; slows or prevents morphological changes of the choroidal capillaries; slows or prevents geographic atrophy of the eye; reduces ocular C3 deposition; reduces complement alternative pathway activity; reduces plasma CFB protein; reduces serum, plasma or urine Bb; reduces serum, plasma or urine Ba; reduces serum, plasma or urine sC5b-9; regulates, increases or reduces serum, plasma or urine C3; reduces serum, plasma or urine C4; or reduces serum AH50 activity.
[0166] Example 56. The method according to any one of Examples 1 to 53, wherein administering the compound reduces proteinuria; slows or prevents kidney function decline; reduces C3 deposition in the kidney; reduces hematuria; reduces hypertension; reduces kidney inflammation; reduces IgA deposition in the glomerular mesangium; reduces complement alternative pathway activity; reduces plasma CFB protein; reduces serum, plasma or urine Bb; reduces serum, plasma or urine Ba; reduces serum, plasma or urine sC5b-9; regulates, increases or reduces serum, plasma or urine C3; reduces serum, plasma or urine C4; or reduces serum AH50 activity.
[0167] Example 57. The method according to any one of Examples 1 to 56, wherein the urinary protein / creatinine ratio is reduced after administering the compound.
[0168] Example 58. The method according to any one of Examples 1 to 57, wherein the level of urinary protein is reduced after administering the compound.
[0169] Example 59. The method according to any one of Examples 28 to 33, wherein administering the compound slows or prevents the progression or development of geographic atrophy in the subject.
[0170] Example 60. The method according to any one of Examples 28 to 33, wherein administering the compound slows the expansion of the area of geographic atrophy in the subject.
[0171] Example 61. The method according to Example 60, wherein administering the compound slows the expansion of geographic atrophy into the foveal region.
[0172] Example 62. The method according to any one of Examples 28 to 33, wherein administering the compound prevents the expansion of geographic atrophy.
[0173] Example 63. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is 10 mg.
[0174] Example 64. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is 20 mg.
[0175] Example 65. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is 40 mg.
[0176] Example 66. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is 70 mg.
[0177] Example 67. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is 100 mg.
[0178] Example 68. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is about 10 mg.
[0179] Example 69. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is about 20 mg.
[0180] Example 70. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is about 40 mg.
[0181] Example 71. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is about 70 mg.
[0182] Example 72. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is about 100 mg.
[0183] Example 73. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, and 350 mg.
[0184] Example 74. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, about 185 mg, about 190 mg, about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, about 260 mg, about 265 mg, about 270 mg, about 275 mg, about 280 mg, about 285 mg, about 290 mg, about 295 mg, about 300 mg, about 305 mg, about 310 mg, about 315 mg, about 320 mg, about 325 mg, about 330 mg, about 335 mg, about 340 mg, about 345 mg, and about 350 mg.
[0185] Example 75. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: 10 mg, 10.1 mg, 10.2 mg, 10.3 mg, 10.4 mg, 10.5 mg, 10.6 mg, 10.7 mg, 10.8 mg, 10.9 mg, 11 mg, 11.1 mg, 11.2 mg, 11.3 mg, 11.4 mg, 11.5 mg, 11.6 mg, 11.7 mg, 11.8 mg, 11.9 mg, 12 mg, 12.1 mg, 12.2 mg, 12.3 mg, 12.4 mg, 12.5 mg, 12.6 mg, 12.7 mg, 12.8 mg, 12.9 mg, 13 mg, 13.1 mg, 13.2 mg, 13.3 mg, 13.4 mg, 13.5 mg, 13.6 mg, 13.7 mg, 13.8 mg, 13.9 mg, 14 mg, 14.1 mg, 14.2 mg, 14.3 mg, 14.4 mg, 14.5 mg, 14.6 mg, 14.7 mg, 14.8 mg, 14.9 mg, 15 mg, 15.1 mg, 15.2 mg, 15.3 mg, 15.4 mg, 15.5 mg, 15.6 mg, 15.7 mg, 15.8 mg, 15.9 mg, 16 mg, 16.1 mg, 16.2 mg, 16.3 mg, 16.4 mg, 16.5 mg, 16.6 mg, 16.7 mg, 16.8 mg, 16.9 mg, 17 mg, 17.1 mg, 17.2 mg, 17.3 mg, 17.4 mg, 17.5 mg, 17.6 mg, 17.7 mg, 17.8 mg, 17.9 mg, 18 mg, 18.1 mg, 18.2 mg, 18.3 mg, 18.4 mg, 18.5 mg, 18.6 mg, 18.7 mg, 18.8 mg, 18.9 mg, 19 mg, 19.1 mg, 19.2 mg, 19.3 mg, 19.4 mg, 19.5 mg, 19.6 mg, 19.7 mg, 19.8 mg, 19.9 mg, 20 mg, 20.1 mg, 20.2 mg, 20.3 mg, 20.4 mg, 20.5 mg, 20.6 mg, 20.7 mg, 20.8 mg, 20.9 mg, 21 mg, 21.1 mg, 21.2 mg, 21.3 mg, 21.4 mg, 21.5 mg, 21.6 mg, 21.7 mg, 21.8 mg, 21.9 mg, 22 mg, 22.1 mg, 22.2 mg, 22.3 mg, 22.4 mg, 22.5 mg, 22.6 mg, 22.7 mg, 22.8 mg, 22.9 mg, 23 mg, 23.1 mg, 23.2 mg, 23.3 mg, 23.4 mg, 23.5 mg, 23.6 mg, 23.7 mg, 23.8 mg, 23.9 mg, 24 mg, 24.1 mg, 24.2 mg, 24.3 mg, 24.4 mg, 24.5 mg, 24.6 mg, 24.7 mg, 24.8 mg, 24.9 mg, 25 mg, 25.1 mg, 25.2 mg, 25.3 mg, 25.4 mg, 25.5 mg, 25.6 mg, 25.7 mg, 25.8 mg, 25.9 mg, 26 mg, 26.1 mg, 26.2 mg, 26.3 mg, 26.4 mg, 26.5 mg, 26.6 mg, 26.7 mg, 26.8 mg, 26.9 mg, 27 mg, 27.1 mg, 27.2 mg, 27.3 mg, 27.4 mg, 27.5 mg, 27.6 mg, 27.7 mg, 27.8 mg, 27.9 mg, 28 mg, 28.1 mg, 28.2 mg, 28.3 mg, 28.4 mg, 28.5 mg, 28.6 mg, 28.7 mg, 28.8 mg, 28.9 mg, 29 mg, 29.1 mg, 29.2 mg, 29.3 mg, 29.4 mg, 29.5 mg, 29.6 mg, 29.7 mg, 29.8 mg, 29.9 mg, 30 mg, 30.1 mg, 30.2 mg, 30.3 mg, 30.4 mg, 30.5 mg, 30.6 mg, 30.7 mg, 30.8 mg, 30.9 mg, 31 mg, 31.1 mg, 31.2 mg, 31.3 mg, 31.4 mg, 31.5 mg, 31.6 mg, 31.7 mg, 31.8 mg, 31.9 mg, 32 mg, 32.1 mg, 32.2 mg, 32.3 mg, 32.4 mg, 32.5 mg, 32.6 mg, 32.7 mg, 32.8 mg, 32.9 mg, 33 mg, 33.1 mg, 33.2 mg, 33.3 mg, 33.4 mg, 33.5 mg, 33.6 mg, 33.7 mg, 33.8 mg, 33.9 mg, 34 mg, 34.1 mg, 34.2 mg, 34.3 mg, 34.4 mg, 34.5 mg, 34.6 mg, 34.7 mg, 34.8 mg, 34.9 mg, 35 mg, 35.1 mg, 35.2 mg, 35.3 mg, 35.4 mg, 35.5 mg, 35.6 mg, 35.7 mg, 35.8 mg, 35.9 mg, 36 mg, 36.1 mg, 36.2 mg, 36.3 mg, 36.4 mg, 36.5 mg, 36.6 mg, 36.7 mg, 36.8 mg, 36.9 mg, 37 mg, 37.1 mg, 37.2 mg, 37.3 mg, 37.4 mg, 37.5 mg, 37.6 mg, 37.7 mg, 37.8 mg, 37.9 mg, 38 mg, 38.1 mg, 38.2 mg, 38.3 mg, 38.4 mg, 38.5 mg, 38.6 mg, 38.7 mg, 38.8 mg, 38.9 mg, 39 mg, 39.1 mg, 39.2 mg, 39.3 mg, 39.4 mg, 39.5 mg, 39.6 mg, 39.7 mg, 39.8 mg, 39.9 mg, 40 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, 42.8 mg, 42.9 mg, 43 mg, 43.1 mg, 43.2 mg, 43.3 mg, 43.4 mg, 43.5 mg, 43.6 mg, 43.7 mg, 43.8 mg, 43.9 mg, 44 mg, 44.1 mg, 44.2 mg, 44.3 mg, 44.4 mg, 44.5 mg, 44.6 mg, 44.7 mg, 44.8 mg, 44.9 mg, 45 mg, 45.1 mg, 45.2 mg, 45.3 mg, 45.4 mg, 45.5 mg, 45.6 mg, 45.7 mg, 45.8 mg, 45.9 mg, 46 mg, 46.1 mg, 46.2 mg, 46.3 mg, 46.4 mg, 46.5 mg, 46.6 mg, 46.7 mg, 46.8 mg, 46.9 mg, 47 mg, 47.1 mg, 47.2 mg, 47.3 mg, 47.4 mg, 47.5 mg, 47.6 mg, 47.7 mg, 47.8 mg, 47.9 mg, 48 mg, 48.1 mg, 48.2 mg, 48.3 mg, 48.4 mg, 48.5 mg, 48.6 mg, 48.7 mg, 48.8 mg, 48.9 mg, 49 mg, 49.1 mg, 49.2 mg, 49.3 mg, 49.4 mg, 49.5 mg, 49.6 mg, 49.7 mg, 49.8 mg, 49.9 mg, 50 mg, 50.1 mg, 50.2 mg, 50.3 mg, 50.4 mg, 50.5 mg, 50.6 mg, 50.7 mg, 50.8 mg, 50.9 mg, 51 mg, 51.1 mg, 51.2 mg, 51.3 mg, 51.4 mg, 51.5 mg, 51.6 mg, 51.7 mg, 51.8 mg, 51.9 mg, 52 mg, 52.1 mg, 52.2 mg, 52.3 mg, 52.4 mg, 52.5 mg, 52.6 mg, 52.7 mg, 52.8 mg, 52.9 mg, 53 mg, 53.1 mg, 53.2 mg, 53.3 mg, 53.4 mg, 53.5 mg, 53.6 mg, 53.7 mg, 53.8 mg, 53.9 mg, 54 mg, 54.1 mg, 54.2 mg, 54.3 mg, 54.4 mg, 54.5 mg, 54.6 mg, 54.7 mg, 54.8 mg, 54.9 mg, 55 mg, 55.1 mg, 55.2 mg, 55.3 mg, 55.4 mg, 55.5 mg, 55.6 mg, 55.7 mg, 55.8 mg, 55.9 mg, 56 mg, 56.1 mg, 56.2 mg, 56.3 mg, 56.4 mg, 56.5 mg, 56.6 mg, 56.7 mg, 56.8 mg, 56.9 mg, 57 mg, 57.1 mg, 57.2 mg, 57.3 mg, 57.4 mg, 57.5 mg, 57.6 mg, 57.7 mg, 57.8 mg, 57.9 mg, 58 mg, 58.1 mg, 58.2 mg, 58.3 mg, 58.4 mg, 58.5 mg, 58.6 mg, 58.7 mg, 58.8 mg, 58.9 mg, 59 mg, 59.1 mg, 59.2 mg, 59.3 mg, 59.4 mg, 59.5 mg, 59.6 mg, 59.7 mg, 59.8 mg, 59.9 mg, 60 mg, 60.1 mg, 60.2 mg, 60.3 mg, 60.4 mg, 60.5 mg, 60.6 mg, 60.7 mg, 60.8 mg, 60.9 mg, 61 mg, 61.1 mg, 61.2 mg, 61.3 mg, 61.4 mg, 61.5 mg, 61.6 mg, 61.7 mg, 61.8 mg, 61.9 mg, 62 mg, 62.1 mg, 62.2 mg, 62.3 mg, 62.4 mg, 62.5 mg, 62.6 mg, 62.7 mg, 62.8 mg, 62.9 mg, 63 mg, 63.1 mg, 63.2 mg, 63.3 mg, 63.4 mg, 63.5 mg, 63.6 mg, 63.7 mg, 63.8 mg, 63.9 mg, 64 mg, 64.1 mg, 64.2 mg, 64.3 mg, 64.4 mg, 64.5 mg, 64.6 mg, 64.7 mg, 64.8 mg, 64.9 mg, 65 mg, 65.1 mg, 65.2 mg, 65.3 mg, 65.4 mg, 65.5 mg, 65.6 mg, 65.7 mg, 65.8 mg, 65.9 mg, 66 mg, 66.1 mg, 66.2 mg, 66.3 mg, 66.4 mg, 66.5 mg, 66.6 mg, 66.7 mg, 66.8 mg, 66.9 mg, 67 mg, 67.1 mg, 67.2 mg, 67.3 mg, 67.4 mg, 67.5 mg, 67.6 mg, 67.7 mg, 67.8 mg, 67.9 mg, 68 mg, 68.1 mg, 68.2 mg, 68.3 mg, 68.4 mg, 68.5 mg, 68.6 mg, 68.7 mg, 68.8 mg, 68.9 mg, 69 mg, 69.1 mg, 69.2 mg, 69.3 mg, 69.4 mg, 69.5 mg, 69.6 mg, 69.7 mg, 69.8 mg and 69.9 mg.
[0186] Example 76. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: about 10 mg, about 10.1 mg, about 10.2 mg, about 10.3 mg, about 10.4 mg, about 10.5 mg, about 10.6 mg, about 10.7 mg, about 10.8 mg, about 10.9 mg, about 11 mg, about 11.1 mg, about 11.2 mg, about 11.3 mg, about 11.4 mg, about 11.5 mg, about 11.6 mg, about 11.7 mg, about 11.8 mg, about 11.9 mg, about 12 mg, about 12.1 mg, about 12.2 mg, about 12.3 mg, about 12.4 mg, about 12.5 mg, about 12.6 mg, about 12.7 mg, about 12.8 mg, about 12.9 mg, about 13 mg, about 13.1 mg, about 13.2 mg, about 13.3 mg, about 13.4 mg, about 13.5 mg, about 13.6 mg, about 13.7 mg, about 13.8 mg, about 13.9 mg, about 14 mg, about 14.1 mg, about 14.2 mg, about 14.3 mg, about 14.4 mg, about 14.5 mg, about 14.6 mg, about 14.7 mg, about 14.8 mg, about 14.9 mg, about 15 mg, about 15.1 mg, about 15.2 mg, about 15.3 mg, about 15.4 mg, about 15.5 mg, about 15.6 mg, about 15.7 mg, about 15.8 mg, about 15.9 mg, about 16 mg, about 16.1 mg, about 16.2 mg, about 16.3 mg, about 16.4 mg, about 16.5 mg, about 16.6 mg, about 16.7 mg, about 16.8 mg, about 16.9 mg, about 17 mg, about 17.1 mg, about 17.2 mg, about 17.3 mg, about 17.4 mg, about 17.5 mg, about 17.6 mg, about 17.7 mg, about 17.8 mg, about 17.9 mg, about 18 mg, about 18.1 mg, about 18.2 mg, about 18.3 mg, about 18.4 mg, about 18.5 mg, about 18.6 mg, about 18.7 mg, about 18.8 mg, about 18.9 mg, about 19 mg, about 19.1 mg, about 19.2 mg, about 19.3 mg, about 19.4 mg, about 19.5 mg, about 19.6 mg, about 19.7 mg, about 19.8 mg, about 19.9 mg, about 20 mg, about 20.1 mg, about 20.2 mg, about 20.3 mg, about 20.4 mg, about 20.5 mg, about 20.6 mg, about 20.7 mg, about 20.8 mg, about 20.9 mg, about 21 mg, about 21.1 mg, about 21.2 mg, about 21.3 mg, about 21.4 mg, about 21.5 mg, about 21.6 mg, about 21.7 mg, about 21.8 mg, about 21.9 mg, about 22 mg, about 22.1 mg, about 22.2 mg, approximately 22.3 mg, approximately 22.4 mg, approximately 22.5 mg, approximately 22.6 mg, approximately 22.7 mg, approximately 22.8 mg, approximately 22.9 mg, 23 mg, approximately 23.1 mg, approximately 23.2 mg, approximately 23.3 mg, approximately 23.4 mg, approximately 23.5 mg, approximately 23.6 mg, approximately 23.7 mg, approximately 23.8 mg, approximately 23.9 mg, 24 mg, approximately 24.1 mg, approximately 24.2 mg, approximately 24.3 mg, approximately 24.4 mg, approximately 24.5 mg, approximately 24.6 mg, approximately 24.7 mg, approximately 24.8 mg, approximately 24.9 mg, 25 mg, approximately 25.1 mg, approximately 25.2 mg, approximately 25.3 mg, approximately 25.4 mg, approximately 25.5 mg, approximately 25.6 mg, approximately 25.7 mg, approximately 25.8 mg, approximately 25.9 mg, 26 mg, approximately 26.1 mg, approximately 26.2 mg, approximately 26.3 mg, approximately 26.4 mg, approximately 26.5 mg, approximately 26.6 mg, approximately 26.7 mg, approximately 26.8 mg, approximately 26.9 mg, 27 mg, approximately 27.1 mg, approximately 27.2 mg, approximately 27.3 mg, approximately 27.4 mg, approximately 27.5 mg, approximately 27.6 mg, approximately 27.7 mg, approximately 27.8 mg, approximately 27.9 mg, 28 mg, approximately 28.1 mg, approximately 28.2 mg, approximately 28.3 mg, approximately 28.4 mg, approximately 28.5 mg, approximately 28.6 mg, approximately 28.7 mg, approximately 28.8 mg, approximately 28.9 mg, 29 mg, approximately 29.1 mg, approximately 29.2 mg, approximately 29.3 mg, approximately 29.4 mg, approximately 29.5 mg, approximately 29.6 mg, approximately 29.7 mg, approximately 29.8 mg, approximately 29.9 mg, 30 mg, approximately 30.1 mg, approximately 30.2 mg, approximately 30.3 mg, approximately 30.4 mg, approximately 30.5 mg, approximately 30.6 mg, approximately 30.7 mg, approximately 30.8 mg, approximately 30.9 mg, 31 mg, approximately 31.1 mg, approximately 31.2 mg, approximately 31.3 mg, approximately 31.4 mg, approximately 31.5 mg, approximately 31.6 mg, approximately 31.7 mg, approximately 31.8 mg, approximately 31.9 mg, 32 mg, approximately 32.1 mg, approximately 32.2 mg, approximately 32.3 mg, approximately 32.4 mg, approximately 32.5 mg, approximately 32.6 mg, approximately 32.7 mg, approximately 32.8 mg, approximately 32.9 mg, 33 mg, approximately 33.1 mg, approximately 33.2 mg, approximately 33.3 mg, approximately 33.4 mg, approximately 33.5 mg, approximately 33.6 mg, approximately 33.7 mg, approximately 33.8 mg, approximately 33.9 mg, 34 mg, approximately 34.1 mg, approximately 34.2 mg, approximately 34.3 mg, approximately 34.4 mg, approximately 34.5 mg, approximately 34.6 mg, approximately 34.7 mg, approximately 34.8 mg, approximately 34.9 mg, about 35 mg, about 35.1 mg, about 35.2 mg, about 35.3 mg, about 35.4 mg, about 35.5 mg, about 35.6 mg, about 35.7 mg, about 35.8 mg, about 35.9 mg, about 36 mg, about 36.1 mg, about 36.2 mg, about 36.3 mg, about 36.4 mg, about 36.5 mg, about 36.6 mg, about 36.7 mg, about 36.8 mg, about 36.9 mg, about 37 mg, about 37.1 mg, about 37.2 mg, about 37.3 mg, about 37.4 mg, about 37.5 mg, about 37.6 mg, about 37.7 mg, about 37.8 mg, about 37.9 mg, about 38 mg, about 38.1 mg, about 38.2 mg, about 38.3 mg, about 38.4 mg, about 38.5 mg, about 38.6 mg, about 38.7 mg, about 38.8 mg, about 38.9 mg, about 39 mg, about 39.1 mg, about 39.2 mg, about 39.3 mg, about 39.4 mg, about 39.5 mg, about 39.6 mg about 39.7 mg, about 39.8 mg, about 39.9 mg, about 40 mg, about 40.1 mg, about 40.2 mg, about 40.3 mg, about 40.4 mg, about 40.5 mg, about 40.6 mg, about 40.7 mg, about 40.8 mg, about 40.9 mg, about 41 mg, about 41.1 mg, about 41.2 mg, about 41.3 mg, about 41.4 mg, about 41.5 mg, about 41.6 mg, about 41.7 mg, about 41.8 mg, about 41.9 mg, about 42 mg, about 42.1 mg, about 42.2 mg, about 42.3 mg, about 42.4 mg, about 42.5 mg, about 42.6 mg, about 42.7 mg, about 42.8 mg, about 42.9 mg, about 43 mg, about 43.1 mg, about 43.2 mg, about 43.3 mg, about 43.4 mg, about 43.5 mg, about 43.6 mg, about 43.7 mg, about 43.8 mg, about 43.9 mg, about 44 mg, about 44.1 mg, about 44.2 mg, about 44.3 mg, about 44.4 mg, about 44.5 mg, about 44.6 mg, about 44.7 mg, about 44.8 mg, about 44.9 mg, about 45 mg, about 45.1 mg, about 45.2 mg, about 45.3 mg, about 45.4 mg, about 45.5 mg, about 45.6 mg, about 45.7 mg, about 45.8 mg, about 45.9 mg, about 46 mg, about 46.1 mg, about 46.2 mg, about 46.3 mg, about 46.4 mg, about 46.5 mg, about 46.6 mg, about 46.7 mg, about 46.8 mg, about 46.9 mg, about 47 mg, about 47.1 mg, about 47.2 mg, about 47.3 mg, about 47.4 mg, about 47.5 mg, about 47.6 mg, about 47.7 mg, approximately 47.8 mg, approximately 47.9 mg, approximately 48 mg, approximately 48.1 mg, approximately 48.2 mg, approximately 48.3 mg, approximately 48.4 mg, approximately 48.5 mg, approximately 48.6 mg, approximately 48.7 mg, approximately 48.8 mg, approximately 48.9 mg, approximately 49 mg, approximately 49.1 mg, approximately 49.2 mg, approximately 49.3 mg, approximately 49.4 mg, approximately 49.5 mg, approximately 49.6 mg, approximately 49.7 mg, approximately 49.8 mg, approximately 49.9 mg, approximately 50 mg, approximately 50.1 mg, approximately 50.2 mg, approximately 50.3 mg, approximately 50.4 mg, approximately 50.5 mg, approximately 50.6 mg, approximately 50.7 mg, approximately 50.8 mg, approximately 50.9 mg, approximately 51 mg, approximately 51.1 mg, approximately 51.2 mg, approximately 51.3 mg, approximately 51.4 mg, approximately 51.5 mg, approximately 51.6 mg, approximately 51.7 mg, approximately 51.8 mg, approximately 51.9 mg, approximately 52 mg, approximately 52.1 mg, approximately 52.2 mg, approximately 52.3 mg, approximately 52.4 mg, approximately 52.5 mg, approximately 52.6 mg, approximately 52.7 mg, approximately 52.8 mg, approximately 52.9 mg, approximately 53 mg, approximately 53.1 mg, approximately 53.2 mg, approximately 53.3 mg, approximately 53.4 mg, approximately 53.5 mg, approximately 53.6 mg, approximately 53.7 mg, approximately 53.8 mg, approximately 53.9 mg, approximately 54 mg, approximately 54.1 mg, approximately 54.2 mg, approximately 54.3 mg, approximately 54.4 mg, approximately 54.5 mg, approximately 54.6 mg, approximately 54.7 mg, approximately 54.8 mg, approximately 54.9 mg, approximately 55 mg, approximately 55.1 mg, approximately 55.2 mg, approximately 55.3 mg, approximately 55.4 mg, approximately 55.5 mg, approximately 55.6 mg, approximately 55.7 mg, approximately 55.8 mg, approximately 55.9 mg, approximately 56 mg, approximately 56.1 mg, approximately 56.2 mg, approximately 56.3 mg, approximately 56.4 mg, approximately 56.5 mg, approximately 56.6 mg, approximately 56.7 mg, approximately 56.8 mg, approximately 56.9 mg, approximately 57 mg, approximately 57.1 mg, approximately 57.2 mg, approximately 57.3 mg, approximately 57.4 mg, approximately 57.5 mg, approximately 57.6 mg, approximately 57.7 mg, approximately 57.8 mg, approximately 57.9 mg, approximately 58 mg, approximately 58.1 mg, approximately 58.2 mg, approximately 58.3 mg, approximately 58.4 mg, approximately 58.5 mg, approximately 58.6 mg, approximately 58.7 mg, approximately 58.8 mg, approximately 58.9 mg, approximately 59 mg, approximately 59.1 mg, approximately 59.2 mg, approximately 59.3 mg, approximately 59.4 mg, approximately 59.5 mg, approximately 59.6 mg, approximately 59.7 mg, approximately 59.8 mg, approximately 59.9 mg, approximately 60 mg, approximately 60.1 mg, approximately 60.2 mg, approximately 60.3 mg, approximately 60.4 mg, approximately 60.5 mg, approximately 60.6 mg, approximately 60.7 mg, approximately 60.8 mg, approximately 60.9 mg, approximately 61 mg, approximately 61.1 mg, approximately 61.2 mg, approximately 61.3 mg, approximately 61.4 mg, approximately 61.5 mg, approximately 61.6 mg, approximately 61.7 mg, approximately 61.8 mg, approximately 61.9 mg, approximately 62 mg, approximately 62.1 mg, approximately 62.2 mg, approximately 62.3 mg, approximately 62.4 mg, approximately 62.5 mg, approximately 62.6 mg, approximately 62.7 mg, approximately 62.8 mg, approximately 62.9 mg, approximately 63 mg, approximately 63.1 mg, approximately 63.2 mg, approximately 63.3 mg, approximately 63.4 mg, approximately 63.5 mg, approximately 63.6 mg, approximately 63.7 mg, approximately 63.8 mg, approximately 63.9 mg, approximately 64 mg, approximately 64.1 mg, approximately 64.2 mg, approximately 64.3 mg, approximately 64.4 mg, approximately 64.5 mg, approximately 64.6 mg, approximately 64.7 mg, approximately 64.8 mg, approximately 64.9 mg, approximately 65 mg, approximately 65.1 mg, approximately 65.2 mg, approximately 65.3 mg, approximately 65.4 mg, approximately 65.5 mg, approximately 65.6 mg, approximately 65.7 mg, approximately 65.8 mg, approximately 65.9 mg, approximately 66 mg, approximately 66.1 mg, approximately 66.2 mg, approximately 66.3 mg, approximately 66.4 mg, approximately 66.5 mg, approximately 66.6 mg, approximately 66.7 mg, approximately 66.8 mg, approximately 66.9 mg, approximately 67 mg, approximately 67.1 mg, approximately 67.2 mg, approximately 67.3 mg, approximately 67.4 mg, approximately 67.5 mg, approximately 67.6 mg, approximately 67.7 mg, approximately 67.8 mg, approximately 67.9 mg, approximately 68 mg, approximately 68.1 mg, approximately 68.2 mg, approximately 68.3 mg, approximately 68.4 mg, approximately 68.5 mg, approximately 68.6 mg, approximately 68.7 mg, approximately 68.8 mg, approximately 68.9 mg, approximately 69 mg, approximately 69.1 mg, approximately 69.2 mg, approximately 69.3 mg, approximately 69.4 mg, approximately 69.5 mg, approximately 69.6 mg, approximately 69.7 mg, approximately 69.8 mg and approximately 69.9 mg.
[0187] Example 77. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: 20 mg, 20.1 mg, 20.2 mg, 20.3 mg, 20.4 mg, 20.5 mg, 20.6 mg, 20.7 mg, 20.8 mg, 20.9 mg, 21 mg, 21.1 mg, 21.2 mg, 21.3 mg, 21.4 mg, 21.5 mg, 21.6 mg, 21.7 mg, 21.8 mg, 21.9 mg, 22 mg, 22.1 mg, 22.2 mg, 22.3 mg, 22.4 mg, 22.5 mg, 22.6 mg, 22.7 mg, 22.8 mg, 22.9 mg, 23 mg, 23.1 mg, 23.2 mg, 23.3 mg, 23.4 mg, 23.5 mg, 23.6 mg, 23.7 mg, 23.8 mg, 23.9 mg, 24 mg, 24.1 mg, 24.2 mg, 24.3 mg, 24.4 mg, 24.5 mg, 24.6 mg, 24.7 mg, 24.8 mg, 24.9 mg, 25 mg, 25.1 mg, 25.2 mg, 25.3 mg, 25.4 mg, 25.5 mg, 25.6 mg, 25.7 mg, 25.8 mg, 25.9 mg, 26 mg, 26.1 mg, 26.2 mg, 26.3 mg, 26.4 mg, 26.5 mg, 26.6 mg, 26.7 mg, 26.8 mg, 26.9 mg, 27 mg, 27.1 mg, 27.2 mg, 27.3 mg, 27.4 mg, 27.5 mg, 27.6 mg, 27.7 mg, 27.8 mg, 27.9 mg, 28 mg, 28.1 mg, 28.2 mg, 28.3 mg, 28.4 mg, 28.5 mg, 28.6 mg, 28.7 mg, 28.8 mg, 28.9 mg, 29 mg, 29.1 mg, 29.2 mg, 29.3 mg, 29.4 mg, 29.5 mg, 29.6 mg, 29.7 mg, 29.8 mg, 29.9 mg, 30 mg, 30.1 mg, 30.2 mg, 30.3 mg, 30.4 mg, 30.5 mg, 30.6 mg, 30.7 mg, 30.8 mg, 30.9 mg, 31 mg, 31.1 mg, 31.2 mg, 31.3 mg, 31.4 mg, 31.5 mg, 31.6 mg, 31.7 mg, 31.8 mg, 31.9 mg, 32 mg, 32.1 mg, 32.2 mg, 32.3 mg, 32.4 mg, 32.5 mg, 32.6 mg, 32.7 mg, 32.8 mg, 32.9 mg, 33 mg, 33.1 mg, 33.2 mg, 33.3 mg, 33.4 mg, 33.5 mg, 33.6 mg, 33.7 mg, 33.8 mg, 33.9 mg, 34 mg, 34.1 mg, 34.2 mg, 34.3 mg, 34.4 mg, 34.5 mg, 34.6 mg, 34.7 mg, 34.8 mg, 34.9 mg, 35 mg, 35.1 mg, 35.2 mg, 35.3 mg, 35.4 mg, 35.5 mg, 35.6 mg, 35.7 mg, 35.8 mg, 35.9 mg, 36 mg, 36.1 mg, 36.2 mg, 36.3 mg, 36.4 mg, 36.5 mg, 36.6 mg, 36.7 mg, 36.8 mg, 36.9 mg, 37 mg, 37.1 mg, 37.2 mg, 37.3 mg, 37.4 mg, 37.5 mg, 37.6 mg, 37.7 mg, 37.8 mg, 37.9 mg, 38 mg, 38.1 mg, 38.2 mg, 38.3 mg, 38.4 mg, 38.5 mg, 38.6 mg, 38.7 mg, 38.8 mg, 38.9 mg, 39 mg, 39.1 mg, 39.2 mg, 39.3 mg, 39.4 mg, 39.5 mg, 39.6 mg, 39.7 mg, 39.8 mg, 39.9 mg and 40 mg.
[0188] Example 78. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: about 20 mg, about 20.1 mg, about 20.2 mg, about 20.3 mg, about 20.4 mg, about 20.5 mg, about 20.6 mg, about 20.7 mg, about 20.8 mg, about 20.9 mg, about 21 mg, about 21.1 mg, about 21.2 mg, about 21.3 mg, about 21.4 mg, about 21.5 mg, about 21.6 mg, about 21.7 mg, about 21.8 mg, about 21.9 mg, about 22 mg, about 22.1 mg, about 22.2 mg, about 22.3 mg, about 22.4 mg, about 22.5 mg, about 22.6 mg, about 22.7 mg, about 22.8 mg, about 22.9 mg, about 23 mg, about 23.1 mg, about 23.2 mg, about 23.3 mg, about 23.4 mg, about 23.5 mg, about 23.6 mg, about 23.7 mg, about 23.8 mg, about 23.9 mg, about 24 mg, about 24.1 mg, about 24.2 mg, about 24.3 mg, about 24.4 mg, about 24.5 mg, about 24.6 mg, about 24.7 mg, about 24.8 mg, about 24.9 mg, about 25 mg, about 25.1 mg, about 25.2 mg, about 25.3 mg, about 25.4 mg, about 25.5 mg, about 25.6 mg, about 25.7 mg, about 25.8 mg, about 25.9 mg, about 26 mg, about 26.1 mg, about 26.2 mg, about 26.3 mg, about 26.4 mg, about 26.5 mg, about 26.6 mg, about 26.7 mg, about 26.8 mg, about 26.9 mg, about 27 mg, about 27.1 mg, about 27.2 mg, about 27.3 mg, about 27.4 mg, about 27.5 mg, about 27.6 mg, about 27.7 mg, about 27.8 mg, about 27.9 mg, about 28 mg, about 28.1 mg, about 28.2 mg, about 28.3 mg, about 28.4 mg, about 28.5 mg, about 28.6 mg, about 28.7 mg, about 28.8 mg, about 28.9 mg, about 29 mg, about 29.1 mg, about 29.2 mg, about 29.3 mg, about 29.4 mg, about 29.5 mg, about 29.6 mg, about 29.7 mg, about 29.8 mg, about 29.9 mg, about 30 mg, about 30.1 mg, about 30.2 mg, about 30.3 mg, about 30.4 mg, about 30.5 mg, about 30.6 mg, about 30.7 mg, about 30.8 mg, about 30.9 mg, about 31 mg, about 31.1 mg, about 31.2 mg, about 31.3 mg, about 31.4 mg, about 31.5 mg, about 31.6 mg, about 31.7 mg, about 31.8 mg, about 31.9 mg, about 32 mg, about 32.1 mg, about 32.2 mg, approximately 32.3 mg, approximately 32.4 mg, approximately 32.5 mg, approximately 32.6 mg, approximately 32.7 mg, approximately 32.8 mg, approximately 32.9 mg, approximately 33 mg, approximately 33.1 mg, approximately 33.2 mg, approximately 33.3 mg, approximately 33.4 mg, approximately 33.5 mg, approximately 33.6 mg, approximately 33.7 mg, approximately 33.8 mg, approximately 33.9 mg, approximately 34 mg, approximately 34.1 mg, approximately 34.2 mg, approximately 34.3 mg, approximately 34.4 mg, approximately 34.5 mg, approximately 34.6 mg, approximately 34.7 mg, approximately 34.8 mg, approximately 34.9 mg, approximately 35 mg, approximately 35.1 mg, approximately 35.2 mg, approximately 35.3 mg, approximately 35.4 mg, approximately 3�.5 mg, approximately 35.6 mg, approximately 35.7 mg, approximately 35.8 mg, approximately 35.9 mg, approximately 36 mg, approximately 36.1 mg, approximately 36.2 mg, approximately 36.3 mg, approximately 36.4 mg, approximately 36.5 mg, approximately 36.6 mg, approximately 36.7 mg, approximately 36.8 mg, approximately 36.9 mg, approximately 37 mg, approximately 37.1 mg, approximately 37.2 mg, approximately 37.3 mg, approximately 37.4 mg, approximately 37.5 mg, approximately 37.6 mg, approximately 37.7 mg, approximately 37.8 mg, approximately 37.9 mg, approximately 38 mg, approximately 38.1 mg, approximately 38.2 mg, approximately 38.3 mg, approximately 38.4 mg, approximately 38.5 mg, approximately 38.6 mg, approximately 38.7 mg, approximately 38.8 mg, approximately 38.9 mg, approximately 39 mg, approximately 39.1 mg, approximately 39.2 mg, approximately 39.3 mg, approximately 39.4 mg, approximately 39.5 mg, approximately 39.6 mg, approximately 39.7 mg, approximately 39.8 mg, approximately 39.9 mg and 40 mg.
[0189] Example 79. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: 40 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, 42.8 mg, 42.9 mg, 43 mg, 43.1 mg, 43.2 mg, 43.3 mg, 43.4 mg, 43.5 mg, 43.6 mg, 43.7 mg, 43.8 mg, 43.9 mg, 44 mg, 44.1 mg, 44.2 mg, 44.3 mg, 44.4 mg, 44.5 mg, 44.6 mg, 44.7 mg, 44.8 mg, 44.9 mg, 45 mg, 45.1 mg, 45.2 mg, 45.3 mg, 45.4 mg, 45.5 mg, 45.6 mg, 45.7 mg, 45.8 mg, 45.9 mg, 46 mg, 46.1 mg, 46.2 mg, 46.3 mg, 46.4 mg, 46.5 mg, 46.6 mg, 46.7 mg, 46.8 mg, 46.9 mg, 47 mg, 47.1 mg, 47.2 mg, 47.3 mg, 47.4 mg, 47.5 mg, 47.6 mg, 47.7 mg, 47.8 mg, 47.9 mg, 48 mg, 48.1 mg, 48.2 mg, 48.3 mg, 48.4 mg, 48.5 mg, 48.6 mg, 48.7 mg, 48.8 mg, 48.9 mg, 49 mg, 49.1 mg, 49.2 mg, 49.3 mg, 49.4 mg, 49.5 mg, 49.6 mg, 49.7 mg, 49.8 mg, 49.9 mg, 50 mg, 50.1 mg, 50.2 mg, 50.3 mg, 50.4 mg, 50.5 mg, 50.6 mg, 50.7 mg, 50.8 mg, 50.9 mg, 51 mg, 51.1 mg, 51.2 mg, 51.3 mg, 51.4 mg, 51.5 mg, 51.6 mg, 51.7 mg, 51.8 mg, 51.9 mg, 52 mg, 52.1 mg, 52.2 mg, 52.3 mg, 52.4 mg, 52.5 mg, 52.6 mg, 52.7 mg, 52.8 mg, 52.9 mg, 53 mg, 53.1 mg, 53.2 mg, 53.3 mg, 53.4 mg, 53.5 mg, 53.6 mg, 53.7 mg, 53.8 mg, 53.9 mg, 54 mg, 54.1 mg, 54.2 mg, 54.3 mg, 54.4 mg, 54.5 mg, 54.6 mg, 54.7 mg, 54.8 mg, 54.9 mg, 55 mg, 55.1 mg, 55.2 mg, 55.3 mg, 55.4 mg, 55.5 mg, 55.6 mg, 55.7 mg, 55.8 mg, 55.9 mg, 56 mg, 56.1 mg, 56.2 mg, 56.3 mg, 56.4 mg, 56.5 mg, 56.6 mg, 56.7 mg, 56.8 mg, 56.9 mg, 57 mg, 57.1 mg, 57.2 mg, 57.3 mg, 57.4 mg, 57.5 mg, 57.6 mg, 57.7 mg, 57.8 mg, 57.9 mg, 58 mg, 58.1 mg, 58.2 mg, 58.3 mg, 58.4 mg, 58.5 mg, 58.6 mg, 58.7 mg, 58.8 mg, 58.9 mg, 59 mg, 59.1 mg, 59.2 mg, 59.3 mg, 59.4 mg, 59.5 mg, 59.6 mg, 59.7 mg, 59.8 mg, 59.9 mg, 60 mg, 60.1 mg, 60.2 mg, 60.3 mg, 60.4 mg, 60.5 mg, 60.6 mg, 60.7 mg, 60.8 mg, 60.9 mg, 61 mg, 61.1 mg, 61.2 mg, 61.3 mg, 61.4 mg, 61.5 mg, 61.6 mg, 61.7 mg, 61.8 mg, 61.9 mg, 62 mg, 62.1 mg, 62.2 mg, 62.3 mg, 62.4 mg, 62.5 mg, 62.6 mg, 62.7 mg, 62.8 mg, 62.9 mg, 63 mg, 63.1 mg, 63.2 mg, 63.3 mg, 63.4 mg, 63.5 mg, 63.6 mg, 63.7 mg, 63.8 mg, 63.9 mg, 64 mg, 64.1 mg, 64.2 mg, 64.3 mg, 64.4 mg, 64.5 mg, 64.6 mg, 64.7 mg, 64.8 mg, 64.9 mg, 65 mg, 65.1 mg, 65.2 mg, 65.3 mg, 65.4 mg, 65.5 mg, 65.6 mg, 65.7 mg, 65.8 mg, 65.9 mg, 66 mg, 66.1 mg, 66.2 mg, 66.3 mg, 66.4 mg, 66.5 mg, 66.6 mg, 66.7 mg, 66.8 mg, 66.9 mg, 67 mg, 67.1 mg, 67.2 mg, 67.3 mg, 67.4 mg, 67.5 mg, 67.6 mg, 67.7 mg, 67.8 mg, 67.9 mg, 68 mg, 68.1 mg, 68.2 mg, 68.3 mg, 68.4 mg, 68.5 mg, 68.6 mg, 68.7 mg, 68.8 mg, 68.9 mg, 69 mg, 69.1 mg, 69.2 mg, 69.3 mg, 69.4 mg, 69.5 mg, 69.6 mg, 69.7 mg, 69.8 mg, 69.9 mg and 70 mg.
[0190] Example 80. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: about 40 mg, about 40.1 mg, about 40.2 mg, about 40.3 mg, about 40.4 mg, about 40.5 mg, about 40.6 mg, about 40.7 mg, about 40.8 mg, about 40.9 mg, about 41 mg, about 41.1 mg, about 41.2 mg, about 41.3 mg, about 41.4 mg, about 41.5 mg, about 41.6 mg, about 41.7 mg, about 41.8 mg, about 41.9 mg, about 42 mg, about 42.1 mg, about 42.2 mg, about 42.3 mg, about 42.4 mg, about 42.5 mg, about 42.6 mg, about 42.7 mg, about 42.8 mg, about 42.9 mg, about 43 mg, about 43.1 mg, about 43.2 mg, about 43.3 mg, about 43.4 mg, about 43.5 mg, about 43.6 mg, about 43.7 mg, about 43.8 mg, about 43.9 mg, about 44 mg, about 44.1 mg, about 44.2 mg, about 44.3 mg, about 44.4 mg, about 44.5 mg, about 44.6 mg, about 44.7 mg, about 44.8 mg, about 44.9 mg, about 45 mg, about 45.1 mg, about 45.2 mg, about 45.3 mg, about 45.4 mg, about 45.5 mg, about 45.6 mg, about 45.7 mg, about 45.8 mg, about 45.9 mg, about 46 mg, about 46.1 mg, about 46.2 mg, about 46.3 mg, about 46.4 mg, about 46.5 mg, about 46.6 mg, about 46.7 mg, about 46.8 mg, about 46.9 mg, about 47 mg, about 47.1 mg, about 47.2 mg, about 47.3 mg, about 47.4 mg, about 47.5 mg, about 47.6 mg, about 47.7 mg, about 47.8 mg, about 47.9 mg, about 48 mg, about 48.1 mg, about 48.2 mg, about 48.3 mg, about 48.4 mg, about 48.5 mg, about 48.6 mg, about 48.7 mg, about 48.8 mg, about 48.9 mg, about 49 mg, about 49.1 mg, about 49.2 mg, about 49.3 mg, about 49.4 mg, about 49.5 mg, about 49.6 mg, about 49.7 mg, about 49.8 mg, about 49.9 mg, about 50 mg, about 50.1 mg, about 50.2 mg, about 50.3 mg, about 50.4 mg, about 50.5 mg, about 50.6 mg, about 50.7 mg, about 50.8 mg, about 50.9 mg, about 51 mg, about 51.1 mg, about 51.2 mg, about 51.3 mg, about 51.4 mg, about 51.5 mg, about 51.6 mg, about 51.7 mg, about 51.8 mg, about 51.9 mg, about 52 mg, about 52.1 mg, about 52.2 mg, approximately 52.3 mg, approximately 52.4 mg, approximately 52.5 mg, approximately 52.6 mg, approximately 52.7 mg, approximately 52.8 mg, approximately 52.9 mg, approximately 53 mg, approximately 53.1 mg, approximately 53.2 mg, approximately 53.3 mg, approximately 53.4 mg, approximately 53.5 mg, approximately 53.6 mg, approximately 53.7 mg, approximately 53.8 mg, approximately 53.9 mg, approximately 54 mg, approximately 54.1 mg, approximately 54.2 mg, approximately 54.3 mg, approximately 54.4 mg, approximately 54.5 mg, approximately 54.6 mg, approximately 54.7 mg, approximately 54.8 mg, approximately 54.9 mg, approximately 55 mg, approximately 55.1 mg, approximately 55.2 mg, approximately 55.3 mg, approximately 55.4 mg, approximately 55.5 mg, approximately 55.6 mg, approximately 55.7 mg, approximately 55.8 mg, approximately 55.9 mg, approximately 56 mg, approximately 56.1 mg, approximately 56.2 mg, approximately 56.3 mg, approximately 56.4 mg, approximately 56.5 mg, approximately 56.6 mg, approximately 56.7 mg, approximately 56.8 mg, approximately 56.9 mg, approximately 57 mg, approximately 57.1 mg, approximately 57.2 mg, approximately 57.3 mg, approximately 57.4 mg, approximately 57.5 mg, approximately 57.6 mg, approximately 57.7 mg, approximately 57.8 mg, approximately 57.9 mg, approximately 58 mg, approximately 58.1 mg, approximately 58.2 mg, approximately 58.3 mg, approximately 58.4 mg, approximately 58.5 mg, approximately 58.6 mg, approximately 58.7 mg, approximately 58.8 mg, approximately 58.9 mg, approximately 59 mg, approximately 59.1 mg, approximately 59.2 mg, approximately 59.3 mg, approximately 59.4 mg, approximately 59.5 mg, approximately 59.6 mg, approximately 59.7 mg, approximately 59.8 mg, approximately 59.9 mg, approximately 60 mg, approximately 60.1 mg, approximately 60.2 mg, approximately 60.3 mg, approximately 60.4 mg, approximately 60.5 mg, approximately 60.6 mg, approximately 60.7 mg, approximately 60.8 mg, approximately 60.9 mg, approximately 61 mg, approximately 61.1 mg, approximately 61.2 mg, approximately 61.3 mg, approximately 61.4 mg, approximately 61.5 mg, approximately 61.6 mg, approximately 61.7 mg, approximately 61.8 mg, approximately 61.9 mg, approximately 62 mg, approximately 62.1 mg, approximately 62.2 mg, approximately 62.3 mg, approximately 62.4 mg, approximately 62.5 mg, approximately 62.6 mg, approximately 62.7 mg, approximately 62.8 mg, approximately 62.9 mg, approximately 63 mg, approximately 63.1 mg, approximately 63.2 mg, approximately 63.3 mg, approximately 63.4 mg, approximately 63.5 mg, approximately 63.6 mg, approximately 63.7 mg, approximately 63.8 mg, approximately 63.9 mg, approximately 64 mg, approximately 64.1 mg, approximately 64.2 mg, approximately 64.3 mg, approximately 64.4 mg, approximately 64.5 mg, approximately 64.6 mg, approximately 64.7 mg, approximately 64.8 mg, approximately 64.9 mg, about 65 mg, about 65.1 mg, about 65.2 mg, about 65.3 mg, about 65.4 mg, about 65.5 mg, about 65.6 mg, about 65.7 mg, about 65.8 mg, about 65.9 mg, about 66 mg, about 66.1 mg, about 66.2 mg, about 66.3 mg, about 66.4 mg, about 66.5 mg, about 66.6 mg, about 66.7 mg, about 66.8 mg, about 66.9 mg, about 67 mg, about 67.1 mg, about 67.2 mg, about 67.3 mg, about 67.4 mg, about 67.5 mg, about 67.6 mg, about 67.7 mg, about 67.8 mg, about 67.9 mg, about 68 mg, about 68.1 mg, about 68.2 mg, about 68.3 mg, about 68.4 mg, about 68.5 mg, about 68.6 mg, about 68.7 mg, about 68.8 mg, about 68.9 mg, about 69 mg, about 69.1 mg, about 69.2 mg, about 69.3 mg, about 69.4 mg, about 69.5 mg, about 69.6 mg, about 69.7 mg, about 69.8 mg, about 69.9 mg and about 70 mg.
[0191] Example 81. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: 70 mg, 70.1 mg, 70.2 mg, 70.3 mg, 70.4 mg, 70.5 mg, 70.6 mg, 70.7 mg, 70.8 mg, 70.9 mg, 71 mg, 71.1 mg, 71.2 mg, 71.3 mg, 71.4 mg, 71.5 mg, 71.6 mg, 71.7 mg, 71.8 mg, 71.9 mg, 72 mg, 72.1 mg, 72.2 mg, 72.3 mg, 72.4 mg, 72.5 mg, 72.6 mg, 72.7 mg, 72.8 mg, 72.9 mg, 73 mg, 73.1 mg, 73.2 mg, 73.3 mg, 73.4 mg, 73.5 mg, 73.6 mg, 73.7 mg, 73.8 mg, 73.9 mg, 74 mg, 74.1 mg, 74.2 mg, 74.3 mg, 74.4 mg, 74.5 mg, 74.6 mg, 74.7 mg, 74.8 mg, 74.9 mg, 75 mg, 75.1 mg, 75.2 mg, 75.3 mg, 75.4 mg, 75.5 mg, 75.6 mg, 75.7 mg, 75.8 mg, 75.9 mg, 76 mg, 76.1 mg, 76.2 mg, 76.3 mg, 76.4 mg, 76.5 mg, 76.6 mg, 76.7 mg, 76.8 mg, 76.9 mg, 77 mg, 77.1 mg, 77.2 mg, 77.3 mg, 77.4 mg, 77.5 mg, 77.6 mg, 77.7 mg, 77.8 mg, 77.9 mg, 78 mg, 78.1 mg, 78.2 mg, 78.3 mg, 78.4 mg, 78.5 mg, 78.6 mg, 78.7 mg, 78.8 mg, 78.9 mg, 79 mg, 79.1 mg, 79.2 mg, 79.3 mg, 79.4 mg, 79.5 mg, 79.6 mg, 79.7 mg, 79.8 mg, 79.9 mg, 80 mg, 80.1 mg, 80.2 mg, 80.3 mg, 80.4 mg, 80.5 mg, 80.6 mg, 80.7 mg, 80.8 mg, 80.9 mg, 81 mg, 81.1 mg, 81.2 mg, 81.3 mg, 81.4 mg, 81.5 mg, 81.6 mg, 81.7 mg, 81.8 mg, 81.9 mg, 82 mg, 82.1 mg, 82.2 mg, 82.3 mg, 82.4 mg, 82.5 mg, 82.6 mg, 82.7 mg, 82.8 mg, 82.9 mg, 83 mg, 83.1 mg, 83.2 mg, 83.3 mg, 83.4 mg, 83.5 mg, 83.6 mg, 83.7 mg, 83.8 mg, 83.9 mg, 84 mg, 84.1 mg, 84.2 mg, 84.3 mg, 84.4 mg, 84.5 mg, 84.6 mg, 84.7 mg, 84.8 mg, 84.9 mg, 85 mg, 85.1 mg, 85.2 mg, 85.3 mg, 85.4 mg, 85.5 mg, 85.6 mg, 85.7 mg, 85.8 mg, 85.9 mg, 86 mg, 86.1 mg, 86.2 mg, 86.3 mg, 86.4 mg, 86.5 mg, 86.6 mg, 86.7 mg, 86.8 mg, 86.9 mg, 87 mg, 87.1 mg, 87.2 mg, 87.3 mg, 87.4 mg, 87.5 mg, 87.6 mg, 87.7 mg, 87.8 mg, 87.9 mg, 88 mg, 88.1 mg, 88.2 mg, 88.3 mg, 88.4 mg, 88.5 mg, 88.6 mg, 88.7 mg, 88.8 mg, 88.9 mg, 89 mg, 89.1 mg, 89.2 mg, 89.3 mg, 89.4 mg, 89.5 mg, 89.6 mg, 89.7 mg, 89.8 mg, 89.9 mg, 90 mg, 90.1 mg, 90.2 mg, 90.3 mg, 90.4 mg, 90.5 mg, 90.6 mg, 90.7 mg, 90.8 mg, 90.9 mg, 91 mg, 91.1 mg, 91.2 mg, 91.3 mg, 91.4 mg, 91.5 mg, 91.6 mg, 91.7 mg, 91.8 mg, 91.9 mg, 92 mg, 92.1 mg, 92.2 mg, 92.3 mg, 92.4 mg, 92.5 mg, 92.6 mg, 92.7 mg, 92.8 mg, 92.9 mg, 93 mg, 93.1 mg, 93.2 mg, 93.3 mg, 93.4 mg, 93.5 mg, 93.6 mg, 93.7 mg, 93.8 mg, 93.9 mg, 94 mg, 94.1 mg, 94.2 mg, 94.3 mg, 94.4 mg, 94.5 mg, 94.6 mg, 94.7 mg, 94.8 mg, 94.9 mg, 95 mg, 95.1 mg, 95.2 mg, 95.3 mg, 95.4 mg, 95.5 mg, 95.6 mg, 95.7 mg, 95.8 mg, 95.9 mg, 96 mg, 96.1 mg, 96.2 mg, 96.3 mg, 96.4 mg, 96.5 mg, 96.6 mg, 96.7 mg, 96.8 mg, 96.9 mg, 97 mg, 97.1 mg, 97.2 mg, 97.3 mg, 97.4 mg, 97.5 mg, 97.6 mg, 97.7 mg, 97.8 mg, 97.9 mg, 98 mg, 98.1 mg, 98.2 mg, 98.3 mg, 98.4 mg, 98.5 mg, 98.6 mg, 98.7 mg, 98.8 mg, 98.9 mg, 99 mg, 99.1 mg, 99.2 mg, 99.3 mg, 99.4 mg, 99.5 mg, 99.6 mg, 99.7 mg, 99.8 mg and 99.9 mg.
[0192] Example 82. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: about 70 mg, about 70.1 mg, about 70.2 mg, about 70.3 mg, about 70.4 mg, about 70.5 mg, about 70.6 mg, about 70.7 mg, about 70.8 mg, about 70.9 mg, about 71 mg, about 71.1 mg, about 71.2 mg, about 71.3 mg, about 71.4 mg, about 71.5 mg, about 71.6 mg, about 71.7 mg, about 71.8 mg, about 71.9 mg, about 72 mg, about 72.1 mg, about 72.2 mg, about 72.3 mg, about 72.4 mg, about 72.5 mg, about 72.6 mg, about 72.7 mg, about 72.8 mg, about 72.9 mg, about 73 mg, about 73.1 mg, about 73.2 mg, about 73.3 mg, about 73.4 mg, about 73.5 mg, about 73.6 mg, about 73.7 mg, about 73.8 mg, about 73.9 mg, about 74 mg, about 74.1 mg, about 74.2 mg, about 74.3 mg, about 74.4 mg, about 74.5 mg, about 74.6 mg, about 74.7 mg, about 74.8 mg, about 74.9 mg, about 75 mg, about 75.1 mg, about 75.2 mg, about 75.3 mg, about 75.4 mg, about 75.5 mg, about 75.6 mg, about 75.7 mg, about 75.8 mg, about 75.9 mg, about 76 mg, about 76.1 mg, about 76.2 mg, about 76.3 mg, about 76.4 mg, about 76.5 mg, about 76.6 mg, about 76.7 mg, about 76.8 mg, about 76.9 mg, about 77 mg, about 77.1 mg, about 77.2 mg, about 77.3 mg, about 77.4 mg, about 77.5 mg, about 77.6 mg, about 77.7 mg, about 77.8 mg, about 77.9 mg, about 78 mg, about 78.1 mg, about 78.2 mg, about 78.3 mg, about 78.4 mg, about 78.5 mg, about 78.6 mg, about 78.7 mg, about 78.8 mg, about 78.9 mg, about 79 mg, about 79.1 mg, about 79.2 mg, about 79.3 mg, about 79.4 mg, about 79.5 mg, about 79.6 mg, about 79.7 mg, about 79.8 mg, about 79.9 mg, about 80 mg, about 80.1 mg, about 80.2 mg, about 80.3 mg, about 80.4 mg, about 80.5 mg, about 80.6 mg, about 80.7 mg, about 80.8 mg, about 80.9 mg, about 81 mg, about 81.1 mg, about 81.2 mg, about 81.3 mg, about 81.4 mg, about 81.5 mg, about 81.6 mg, about 81.7 mg, about 81.8 mg, about 81.9 mg, about 82 mg, about 82.1 mg, about 82.2 mg, approximately 82.3 mg, approximately 82.4 mg, approximately 82.5 mg, approximately 82.6 mg, approximately 82.7 mg, approximately 82.8 mg, approximately 82.9 mg, approximately 83 mg, approximately 83.1 mg, approximately 83.2 mg, approximately 83.3 mg, approximately 83.4 mg, approximately 83.5 mg, approximately 83.6 mg, approximately 83.7 mg, approximately 83.8 mg, approximately 83.9 mg, approximately 84 mg, approximately 84.1 mg, approximately 84.2 mg, approximately 84.3 mg, approximately 84.4 mg, approximately 84.5 mg, approximately 84.6 mg, approximately 84.7 mg, approximately 84.8 mg, approximately 84.9 mg, approximately 85 mg, approximately 85.1 mg, approximately 85.2 mg, approximately 85.3 mg, approximately 85.4 mg, approximately 85.5 mg, approximately 85.6 mg, approximately 85.7 mg, approximately 85.8 mg, approximately 85.9 mg, approximately 86 mg, approximately 86.1 mg, approximately 86.2 mg, approximately 86.3 mg, approximately 86.4 mg, approximately 86.5 mg, approximately 86.6 mg, approximately 86.7 mg, approximately 86.8 mg, approximately 86.9 mg, approximately 87 mg, approximately 87.1 mg, approximately 87.2 mg, approximately 87.3 mg, approximately 87.4 mg, approximately 87.5 mg, approximately 87.6 mg, approximately 87.7 mg, approximately 87.8 mg, approximately 87.9 mg, approximately 88 mg, approximately 88.1 mg, approximately 88.2 mg, approximately 88.3 mg, approximately 88.4 mg, approximately 88.5 mg, approximately 88.6 mg, approximately 88.7 mg, approximately 88.8 mg, approximately 88.9 mg, approximately 89 mg, approximately 89.1 mg, approximately 89.2 mg, approximately 89.3 mg, approximately 89.4 mg, approximately 89.5 mg, approximately 89.6 mg, approximately 89.7 mg, approximately 89.8 mg, approximately 89.9 mg, approximately 90 mg, approximately 90.1 mg, approximately 90.2 mg, approximately 90.3 mg, approximately 90.4 mg, approximately 90.5 mg, approximately 90.6 mg, approximately 90.7 mg, approximately 90.8 mg, approximately 90.9 mg, approximately 91 mg, approximately 91.1 mg, approximately 91.2 mg, approximately 91.3 mg, approximately 91.4 mg, approximately 91.5 mg, approximately 91.6 mg, approximately 91.7 mg, approximately 91.8 mg, approximately 91.9 mg, approximately 92 mg, approximately 92.1 mg, approximately 92.2 mg, approximately 92.3 mg, approximately 92.4 mg, approximately 92.5 mg, approximately 92.6 mg, approximately 92.7 mg, approximately 92.8 mg, approximately 92.9 mg, approximately 93 mg, approximately 93.1 mg, approximately 93.2 mg, approximately 93.3 mg, approximately 93.4 mg, approximately 93.5 mg, approximately 93.6 mg, approximately 93.7 mg, approximately 93.8 mg, approximately 93.9 mg, approximately 94 mg, approximately 94.1 mg, approximately 94.2 mg, approximately 94.3 mg, approximately 94.4 mg, approximately 94.5 mg, approximately 94.6 mg, approximately 94.7 mg, approximately 94.8 mg, approximately 94.9 mg, about 95 mg, about 95.1 mg, about 95.2 mg, about 95.3 mg, about 95.4 mg, about 95.5 mg, about 95.6 mg, about 95.7 mg, about 95.8 mg, about 95.9 mg, about 96 mg, about 96.1 mg, about 96.2 mg, about 96.3 mg, about 96.4 mg, about 96.5 mg, about 96.6 mg, about 96.7 mg, about 96.8 mg, about 96.9 mg, about 97 mg, about 97.1 mg, about 97.2 mg, about 97.3 mg, about 97.4 mg, about 97.5 mg, about 97.6 mg, about 97.7 mg, about 97.8 mg, about 97.9 mg, about 98 mg, about 98.1 mg, about 98.2 mg, about 98.3 mg, about 98.4 mg, about 98.5 mg, about 98.6 mg, about 98.7 mg, about 98.8 mg, about 98.9 mg, about 99 mg, about 99.1 mg, about 99.2 mg, about 99.3 mg, about 99.4 mg, about 99.5 mg, about 99.6 mg, about 99.7 mg, about 99.8 mg and about 99.9 mg.
[0193] Example 83. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: 100 mg, 100.1 mg, 100.2 mg, 100.3 mg, 100.4 mg, 100.5 mg, 100.6 mg, 100.7 mg, 100.8 mg, 100.9 mg, 101 mg, 101.1 mg, 101.2 mg, 101.3 mg, 101.4 mg, 101.5 mg, 101.6 mg, 101.7 mg, 101.8 mg, 101.9 mg, 102 mg, 102.1 mg, 102.2 mg, 102.3 mg, 102.4 mg, 102.5 mg, 102.6 mg, 102.7 mg, 102.8 mg, 102.9 mg, 103 mg, 103.1 mg, 103.2 mg, 103.3 mg, 103.4 mg, 103.5 mg, 103.6 mg, 103.7 mg, 103.8 mg, 103.9 mg, 104 mg, 104.1 mg, 104.2 mg, 104.3 mg, 104.4 mg, 104.5 mg, 104.6 mg, 104.7 mg, 104.8 mg, 104.9 mg, 105 mg, 105.1 mg, 105.2 mg, 105.3 mg, 105.4 mg, 105.5 mg, 105.6 mg, 105.7 mg, 105.8 mg, 105.9 mg, 106 mg, 106.1 mg, 106.2 mg, 106.3 mg, 106.4 mg, 106.5 mg, 106.6 mg, 106.7 mg, 106.8 mg, 106.9 mg, 107 mg, 107.1 mg, 107.2 mg, 107.3 mg, 107.4 mg, 107.5 mg, 107.6 mg, 107.7 mg, 107.8 mg, 107.9 mg, 108 mg, 108.1 mg, 108.2 mg, 108.3 mg, 108.4 mg, 108.5 mg, 108.6 mg, 108.7 mg, 108.8 mg, 108.9 mg, 109 mg, 109.1 mg, 109.2 mg, 109.3 mg, 109.4 mg, 109.5 mg, 109.6 mg, 109.7 mg, 109.8 mg, 109.9 mg, 110 mg, 110.1 mg, 110.2 mg, 110.3 mg, 110.4 mg, 110.5 mg, 110.6 mg, 110.7 mg, 110.8 mg, 110.9 mg, 111 mg, 111.1 mg, 111.2 mg, 111.3 mg, 111.4 mg, 111.5 mg, 111.6 mg, 111.7 mg, 111.8 mg, 111.9 mg, 112 mg, 112.1 mg, 112.2mg, 112.3mg, 112.4mg, 112.5mg, 112.6mg, 112.7mg, 112.8mg, 112.9mg, 113mg, 113.1mg, 113.2mg, 113.3mg, 113.4mg, 113.5mg, 113.6mg, 113.7mg, 113.8mg, 113.9mg, 114mg, 114.1mg, 114.2mg, 114.3mg, 114.4mg, 114.5mg, 114.6mg, 114.7mg, 114.8mg, 114.9mg, 115mg, 115.1mg, 115.2mg, 115.3mg, 115.4mg, 115.5mg, 115.6mg, 115.7mg, 115.8mg, 115.9mg, 116mg, 116.1mg, 116.2mg, 116.3mg, 116.4mg, 116.5mg, 116.6mg, 116.7mg, 116.8mg, 116.9mg, 117mg, 117.1mg, 117.2mg, 117.3mg, 117.4mg, 117.5mg, 117.6mg, 117.7mg, 117.8mg, 117.9mg, 118mg, 118.1mg, 118.2mg, 118.3mg, 118.4mg, 118.5mg, 118.6mg, 118.7mg, 118.8mg, 118.9mg, 119mg, 119.1mg, 119.2mg, 119.3mg, 119.4mg, 119.5mg, 119.6mg, 119.7mg, 119.8mg, 119.9mg, 120mg, 120.1mg, 120.2mg, 120.3mg, 120.4mg, 120.5mg, 120.6mg, 120.7mg, 120.8mg, 120.9mg, 121mg, 121.1mg, 121.2mg, 121.3mg, 121.4mg, 121.5mg, 121.6mg, 121.7mg, 121.8mg, 121.9mg, 122mg, 122.1mg, 122.2mg, 122.3mg, 122.4mg, 122.5mg, 122.6mg, 122.7mg, 122.8mg, 122.9mg, 123mg, 123.1mg, 123.2mg, 123.3mg, 123.4mg, 123.5mg, 123.6mg, 123.7mg, 123.8mg, 123.9mg, 124mg, 124.1mg, 124.2mg, 124.3mg, 124.4mg, 124.5mg, 124.6mg, 124.7mg, 124.8mg, 124.9 mg and 125 mg.
[0194] Example 84. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: about 100 mg, about 100.1 mg, about 100.2 mg, about 100.3 mg, about 100.4 mg, about 100.5 mg, about 100.6 mg, about 100.7 mg, about 100.8 mg, about 100.9 mg, about 101 mg, about 101.1 mg, about 101.2 mg, about 101.3 mg, about 101.4 mg, about 101.5 mg, about 101.6 mg, about 101.7 mg, about 101.8 mg, about 101.9 mg, about 102 mg, about 102.1 mg, about 102.2 mg, about 102.3 mg, about 102.4 mg, about 102.5 mg, about 102.6 mg, about 102.7 mg, about 102.8 mg, about 102.9 mg, about 103 mg, about 103.1 mg, about 103.2 mg, about 103.3 mg, about 103.4 mg, about 103.5 mg, about 103.6 mg, about 103.7 mg, about 103.8 mg, about 103.9 mg, about 104 mg, about 104.1 mg, about 104.2 mg, about 104.3 mg, about 104.4 mg, about 104.5 mg, about 104.6 mg, about 104.7 mg, about 104.8 mg, about 104.9 mg, about 105 mg, about 105.1 mg, about 105.2 mg, about 105.3 mg, about 105.4 mg, about 105.5 mg, about 105.6 mg, about 105.7 mg, about 105.8 mg, about 105.9 mg, about 106 mg, about 106.1 mg, about 106.2 mg, about 106.3 mg, about 106.4 mg, about 106.5 mg, about 106.6 mg, about 106.7 mg, about 106.8 mg, about 106.9 mg, about 107 mg, about 107.1 mg, about 107.2 mg, about 107.3 mg, about 107.4 mg, about 107.5 mg, about 107.6 mg, about 107.7 mg, about 107.8 mg, about 107.9 mg, about 108 mg, about 108.1 mg, about 108.2 mg, about 108.3 mg, about 108.4 mg, about 108.5 mg, about 108.6 mg, about 108.7 mg, about 108.8 mg, about 108.9 mg, about 109 mg, about 109.1 mg, about 109.2 mg, about 109.3 mg, about 109.4 mg, about 109.5 mg, about 109.6 mg, about 109.7 mg, about 109.8 mg, about 109.9 mg, about 110 mg, about 110.1 mg, about 110.2 mg, about 110.3 mg, about 110.4 mg, about 110.5 mg, about 110.6 mg, about 110.7 mg, about 110.8 mg, approximately 110.9 mg, approximately 111 mg, approximately 111.1 mg, approximately 111.2 mg, approximately 111.3 mg, approximately 111.4 mg, approximately 111.5 mg, approximately 111.6 mg, approximately 111.7 mg, approximately 111.8 mg, approximately 111.9 mg, approximately 112 mg, approximately 112.1 mg, approximately 112.2 mg, approximately 112.3 mg, approximately 112.4 mg, approximately 112.5 mg, approximately 112.6 mg, approximately 112.7 mg, approximately 112.8 mg, approximately 112.9 mg, approximately 113 mg, approximately 113.1 mg, approximately 113.2 mg, approximately 113.3 mg, approximately 113.4 mg, approximately 113.5 mg, approximately 113.6 mg, approximately 113.7 mg, approximately 113.8 mg, approximately 113.9 mg, approximately 114 mg, approximately 114.1 mg, approximately 114.2 mg, approximately 114.3 mg, approximately 114.4 mg, approximately 114.5 mg, approximately 114.6 mg, approximately 114.7 mg, approximately 114.8 mg, approximately 114.9 mg, approximately 115 mg, approximately 115.1 mg, approximately 115.2 mg, approximately 115.3 mg, approximately 115.4 mg, approximately 115.5 mg, approximately 115.6 mg, approximately 115.7 mg, approximately 115.8 mg, approximately 115.9 mg, approximately 116 mg, approximately 116.1 mg, approximately 116.2 mg, approximately 116.3 mg, approximately 116.4 mg, approximately 116.5 mg, approximately 116.6 mg, approximately 116.7 mg, approximately 116.8 mg, approximately 116.9 mg, approximately 117 mg, approximately 117.1 mg, approximately 117.2 mg, approximately 117.3 mg, approximately 117.4 mg, approximately 117.5 mg, approximately 117.6 mg, approximately 117.7 mg, approximately 117.8 mg, approximately 117.9 mg, approximately 118 mg, approximately 118.1 mg, approximately 118.2 mg, approximately 118.3 mg, approximately 118.4 mg, approximately 118.5 mg, approximately 118.6 mg, approximately 118.7 mg, approximately 118.8 mg, approximately 118.9 mg, approximately 119 mg, approximately 119.1 mg, approximately 119.2 mg, approximately 119.3 mg, approximately 119.4 mg, approximately 119.5 mg, approximately 119.6 mg, approximately 119.7 mg, approximately 119.8 mg, approximately 119.9 mg, approximately 120 mg, approximately 120.1 mg, approximately 120.2 mg, approximately 120.3 mg, approximately 120.4 mg, approximately 120.5 mg, approximately 120.6 mg, approximately 120.7 mg, approximately 120.8 mg, approximately 120.9 mg, approximately 121 mg, approximately 121.1 mg, approximately 121.2 mg, approximately 121.3 mg, approximately 121.4 mg, approximately 121.5 mg, approximately 121.6 mg, approximately 121.7 mg, approximately 121.8 mg, approximately 121.9 mg, approximately 122 mg, approximately 122.1 mg, about 122.2 mg, about 122.3 mg, about 122.4 mg, about 122.5 mg, about 122.6 mg, about 122.7 mg, about 122.8 mg, about 122.9 mg, about 123 mg, about 123.1 mg, about 123.2 mg, about 123.3 mg, about 123.4 mg, about 123.5 mg, about 123.6 mg, about 123.7 mg, about 123.8 mg, about 123.9 mg, about 124 mg, about 124.1 mg, about 124.2 mg, about 124.3 mg, about 124.4 mg, about 124.5 mg, about 124.6 mg, about 124.7 mg, about 124.8 mg, about 124.9 mg and about 125 mg.
[0195] Example 85. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is in the range of any of the following: 10 mg to 200 mg, 10 mg to 190 mg, 10 mg to 180 mg, 10 mg to 170 mg, 10 mg to 160 mg, 10 mg to 150 mg, 10 mg to 140 mg, 10 mg to 120 mg, 10 mg to 110 mg, 10 mg to 100 mg, 10 mg to 80 mg, 10 mg to 70 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, 10 mg to 20 mg, 20 mg to 200 mg, 20 mg to 190 mg, 20 mg to 180 mg, 20 mg to 170 mg, 20 mg to 160 mg, 20 mg to 150 mg, 20 mg to 140 mg, 20 mg to 120 mg, 20 mg to 110 mg, 20 mg to 100 mg, 20 mg to 80 mg, 20 mg to 70 mg, 20 mg to 60 mg, 20 mg to 50 mg, 20 mg to 10 mg, 20 mg to 30 mg, 30 mg to 200 mg, 30 mg to 190 mg, 30 mg to 180 mg, 30 mg to 170 mg, 30 mg to 160 mg, 30 mg to 150 mg, 30 mg to 140 mg, 30 mg to 120 mg, 30 mg to 110 mg, 30 mg to 100 mg, 30 mg to 80 mg, 30 mg to 70 mg, 30 mg to 60 mg, 30 mg to 50 mg, 30 mg to 20 mg, 40 mg to 200 mg, 40 mg to 190 mg, 40 mg to 180 mg, 40 mg to 170 mg, 40 mg to 160 mg, 40 mg to 150 mg, 40 mg to 140 mg, 40 mg to 120 mg, 40 mg to 110 mg, 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 200 mg, 50 mg to 190 mg, 50 mg to 180 mg, 50 mg to 170 mg, 50 mg to 160 mg, 50 mg to 150 mg, 50 mg to 140 mg, 50 mg to 120 mg, 50 mg to 110 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 200 mg, 60 mg to 190 mg, 60 mg to 180 mg, 60 mg to 170 mg, 60 mg to 160 mg, 60 mg to 150 mg, 60 mg to 140 mg, 60 mg to 120 mg, 60 mg to 110 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 200 mg, 70 mg to 190 mg,70 mg to 180 mg, 70 mg to 170 mg, 70 mg to 160 mg, 70 mg to 150 mg, 70 mg to 140 mg, 70 mg to 120 mg, 70 mg to 110 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 200 mg, 80 mg to 190 mg, 80 mg to 180 mg, 80 mg to 170 mg, 80 mg to 160 mg, 80 mg to 150 mg, 80 mg to 140 mg, 80 mg to 120 mg, 80 mg to 110 mg, 80 mg to 100 mg, 80 mg to 90 mg, 90 mg to 200 mg, 90 mg to 190 mg, 90 mg to 180 mg, 90 mg to 170 mg, 90 mg to 160 mg, 90 mg to 150 mg, 90 mg to 140 mg, 90 mg to 120 mg, 90 mg to 110 mg, 90 mg to 100 mg, 100 mg to 200 mg, 100 mg to 190 mg, 100 mg to 180 mg, 100 mg to 170 mg, 100 mg to 160 mg, 100 mg to 150 mg, 100 mg to 140 mg, 100 mg to 120 mg, 100 mg to 110 mg, 110 mg to 200 mg, 110 mg to 190 mg, 110 mg to 180 mg, 110 mg to 170 mg, 110 mg to 160 mg, 110 mg to 150 mg, 110 mg to 140 mg, 110 mg to 130 mg, 110 mg to 120 mg, 120 mg to 200 mg, 120 mg to 190 mg, 120 mg to 180 mg, 120 mg to 170 mg, 120 mg to 160 mg, 120 mg to 150 mg, 120 mg to 140 mg, 120 mg to 130 mg, 130 mg to 200 mg, 130 mg to 190 mg, 130 mg to 180 mg, 130 mg to 170 mg, 130 mg to 160 mg, 130 mg to 150 mg, 130 mg to 140 mg, 140 mg to 200 mg, 140 mg to 190 mg, 140 mg to 180 mg, 140 mg to 170 mg, 140 mg to 160 mg, 140 mg to 150 mg, 150 mg to 200 mg, 150 mg to 190 mg, 150 mg to 180 mg, 150 mg to 170 mg, 150 mg to 160 mg, 160 mg to 200 mg, 160 mg to 190 mg, 160 mg to 180 mg, 160 mg to 170 mg, 180 mg to 200 mg, 180 mg to 190 mg, 190 mg to 200 mg, 105 mg to 135 mg, 105 mg to 130 mg, 105 mg to 125 mg, 105 mg to 120 mg, 110 mg to 135 mg110 mg to 130 mg, 110 mg to 125 mg, 110 mg to 120 mg, 115 mg to 135 mg, 115 mg to 130 mg, 115 mg to 125 mg, 115 mg to 120 mg, 115 mg to 125 mg, 115 mg to 120 mg, 120 mg to 135 mg, 120 mg to 125 mg, 125 mg to 140 mg, 125 mg to 130 mg, 130 mg to 135 mg, 135 mg to 140 mg, 120 mg to 129 mg, 120 mg to 128 mg, 120 mg to 127 mg, 120 mg to 86 mg, 120 mg to 124 mg, 120 mg to 123 mg, 120 mg to 122 mg, 120 mg to 121 mg, 121 mg to 130 mg, 122 mg to 129 mg, 122 mg to 128 mg, 122 mg to 127 mg, 122 mg to 126 mg, 122 mg to 125 mg, 122 mg to 124 mg, 122 mg to 123 mg, 123 mg to 130 mg, 123 mg to 129 mg, 123 mg to 128 mg, 123 mg to 127 mg, 123 mg to 126 mg, 123 mg to 125 mg, 123 mg to 124 mg, 124 mg to 130 mg, 124 mg to 129 mg, 124 mg to 128 mg, 124 mg to 127 mg, 124 mg to 126 mg, 124 mg to 125 mg, 125 mg to 129 mg, 125 mg to 128 mg, 125 mg to 127 mg, 125 mg to 126 mg, 126 mg to 130 mg, 126 mg to 129 mg, 126 mg to 128 mg, 126 mg to 127 mg, 127 mg to 130 mg, 127 mg to 129 mg, 127 mg to 128 mg, 128 mg to 130 mg, 128 mg to 129 mg and 129 mg to 130 mg.
[0196] Example 86. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is from 1 mg to any one of the following: less than 350 mg, less than 345 mg, less than 340 mg, less than 335 mg, less than 330 mg, less than 325 mg, less than 320 mg, less than 315 mg, less than 310 mg, less than 305 mg, less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg, less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.
[0197] Example 87. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is from 1 mg to any one of the following: less than about 350 mg, less than about 345 mg, less than about 340 mg, less than about 335 mg, less than about 330 mg, less than about 325 mg, less than about 320 mg, less than about 315 mg, less than about 310 mg, less than about 305 mg, less than about 300 mg, less than about 295 mg, less than about 290 mg, less than about 285 mg, less than about 280 mg, less than about 275 mg, less than about 270 mg, less than about 265 mg, less than about 260 mg, less than about 255 mg, less than about 250 mg, less than about 245 mg, less than about 240 mg, less than about 235 mg, less than about 230 mg, less than about 225 mg, less than about 220 mg, less than about 215 mg, less than about 210 mg, less than about 205 mg, less than about 200 mg, less than about 195 mg, less than about 190 mg, less than about 185 mg, less than about 180 mg, less than about 175 mg, less than about 170 mg, less than about 165 mg, less than about 160 mg, less than about 150 mg, less than about 145 mg, less than about 140 mg, less than about 135 mg, less than about 130 mg, less than about 125 mg, less than about 120 mg, less than about 115 mg, less than about 110 mg, less than about 105 mg, less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, less than about 40 mg, less than about 35 mg, less than about 30 mg, less than about 25 mg, less than about 20 mg, less than about 15 mg, less than about 10 mg, and less than about 5 mg.
[0198] Example 88. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is any one of the following: at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, at least 150 mg, at least 155 mg, at least 160 mg, at least 165 mg, at least 170 mg, at least 175 mg, at least 180 mg, at least 185, at least 190 mg, at least 195 mg, and at least 200 mg.
[0199] Example 89. The method according to any one of Examples 1 to 62, wherein the therapeutically effective amount is from 1 mg to any one of the following: at least about 5 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, or at least about 150 mg, at least about 155 mg, at least about 160 mg, at least about 165 mg, at least about 170 mg, at least about 175 mg, at least about 180 mg, at least about 185, at least about 190 mg, at least about 195 mg, and at least about 200 mg.
[0200] Example 90. The method according to any one of Examples 1 to 89, which comprises administering the compound once every two weeks.
[0201] Example 91. The method according to any one of Examples 1 to 89, which comprises administering the compound once every four weeks.
[0202] Example 92. The method according to any one of Examples 1 to 89, which comprises administering the compound once every eight weeks.
[0203] Example 93. The method according to any one of Examples 1 to 89, which comprises administering the compound once every 12 weeks.
[0204] Example 94. The method according to any one of Examples 1 to 89, which comprises administering the compound once every 16 weeks.
[0205] Example 95. The method according to any one of Examples 1 to 89, which comprises administering the compound once every 20 weeks.
[0206] Example 96. The method according to any one of Examples 1 to 89, which comprises administering the compound once every 24 weeks.
[0207] Example 97. The method according to any one of Examples 1 to 89, which comprises administering the compound once every 6 months.
[0208] Example 98. The method according to any one of Examples 1 to 89, which comprises administering the compound approximately once every 2 weeks.
[0209] Example 99. The method according to any one of Examples 1 to 89, which comprises administering the compound approximately once every 4 weeks.
[0210] Example 100. The method according to any one of Examples 1 to 89, which comprises administering the compound approximately once every 8 weeks.
[0211] Example 101. The method according to any one of Examples 1 to 89, which comprises administering the compound approximately once every 12 weeks.
[0212] Example 102. The method according to any one of Examples 1 to 89, which comprises administering the compound approximately once every 16 weeks.
[0213] Example 103. The method according to any one of Examples 1 to 89, which comprises administering the compound approximately once every 20 weeks.
[0214] Example 104. The method according to any one of Examples 1 to 89, which comprises administering the compound approximately once every 24 weeks.
[0215] Example 105. The method according to any one of Examples 1 to 89, which comprises administering the compound approximately once every 6 months.
[0216] Example 106. The method according to any one of Examples 1 to 89, which comprises administering the compound approximately once every 6 months, approximately once every 7 months, approximately once every 8 months, approximately once every 9 months, approximately once every 10 months, approximately once every 11 months, or approximately once every 12 months.
[0217] Example 107. The method according to any one of Examples 1 to 89, which comprises applying the compound monthly.
[0218] Example 108. The method according to any one of Examples 1 to 89, which comprises applying the compound once every two months.
[0219] Example 109. The method according to any one of Examples 1 to 89, which comprises applying the compound once every three months.
[0220] Example 110. The method according to any one of Examples 1 to 89, which comprises applying the compound quarterly.
[0221] Example 111. The method according to any one of Examples 1 to 89, which comprises applying the compound semi-annually.
[0222] Example 112. The method according to any one of Examples 1 to 89, which comprises applying the compound annually.
[0223] Example 113. The method according to any one of Examples 1 to 89, which comprises applying the compound once every two years.
[0224] Example 114. The method according to any one of Examples 1 to 89, which comprises applying the compound according to any one of the following: once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, once every twelve weeks, once every thirteen weeks, once every fourteen weeks, once every fifteen weeks, once every sixteen weeks, once every seventeen weeks, once every eighteen weeks, once every nineteen weeks, once every twenty weeks, once every twenty-one weeks, once every twenty-two weeks, once every twenty-three weeks, once every twenty-four weeks, once a month, once every two months, once every three months, once every four months, once every five months, once every six months, once every seven months, once every eight months, once every nine months, once every ten months, once every eleven months, or once a year.
[0225] Example 115. The method according to any one of Examples 1 to 89, which comprises administering the compound in any of the following: about once every 1 week, about once every 2 weeks, about once every 3 weeks, about once every 4 weeks, about once every 5 weeks, about once every 6 weeks, about once every 7 weeks, about once every 8 weeks, about once every 9 weeks, about once every 10 weeks, about once every 11 weeks, about once every 12 weeks, about once every 13 weeks, about once every 14 weeks, about once every 15 weeks, about once every 16 weeks, about once every 17 weeks, about once every 18 weeks, about once every 19 weeks, about once every 21 weeks, about once every 22 weeks, about once every 23 weeks, about once every 24 weeks, about once a month, about once every 2 months, about once every 3 months, about once every 4 months, about once every 5 months, about once every 6 months, about once every 7 months, about once every 8 months, about once every 9 months, about once every 10 months, about once every 11 months, or about once a year.
[0226] Example 116. The method according to any one of Examples 1 to 89, which comprises administering a 20 mg dose of the compound to the human subject once every four weeks.
[0227] Example 117. The method according to any one of Examples 1 to 89, which comprises administering a 40 mg dose of the compound to the human subject once every four weeks.
[0228] Example 118. The method according to any one of Examples 1 to 89, which comprises administering a 70 mg dose of the compound to the human subject once every four weeks.
[0229] Example 119. The method according to any one of Examples 1 to 89, which comprises administering a 100 mg dose of the compound to the human subject once every 4 weeks.
[0230] Example 120. The method according to any one of Examples 1 to 89, which comprises administering a 20 mg dose of the compound to the human subject once every eight weeks.
[0231] Example 121. The method according to any one of Examples 1 to 89, which comprises administering a 40 mg dose of the compound to the human subject once every eight weeks.
[0232] Example 122. The method according to any one of Examples 1 to 89, which comprises administering a 70 mg dose of the compound to the human subject once every eight weeks.
[0233] Example 123. The method according to any one of Examples 1 to 89, which comprises administering a 100 mg dose of the compound to the human subject once every eight weeks.
[0234] Example 124. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 20 mg of the compound once every 12 weeks, once every 3 months, or once every quarter.
[0235] Example 125. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 40 mg of the compound once every 12 weeks, once every 3 months, or once every quarter.
[0236] Example 126. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 70 mg of the compound once every 12 weeks, once every 3 months, or once every quarter.
[0237] Example 127. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 100 mg of the compound once every 12 weeks, once every 3 months, or once every quarter.
[0238] Example 128. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 20 mg of the compound once every 6 months or twice a year.
[0239] Example 129. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 40 mg of the compound once every 6 months or twice a year.
[0240] Example 130. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 70 mg of the compound once every 6 months or twice a year.
[0241] Example 131. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 100 mg of the compound once every 6 months or twice a year.
[0242] Example 132. The method according to any one of Examples 1 to 131, wherein two doses of the compound are administered.
[0243] Example 133. The method according to any one of Examples 1 to 131, wherein four doses of the compound are administered.
[0244] Example 134. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 100 mg of the compound once every 2 weeks for a total of 3 doses, followed by administering a dose of 100 mg of the compound once every 4 weeks thereafter.
[0245] Example 135. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 70 mg of the compound once every 2 weeks, a total of 3 doses, and then administering a dose of 70 mg of the compound once every 4 weeks thereafter.
[0246] Example 136. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 40 mg of the compound once every 2 weeks, a total of 3 doses, and then administering a dose of 40 mg of the compound once every 4 weeks thereafter.
[0247] Example 137. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 40 mg to 70 mg of the compound once every 4 weeks.
[0248] Example 138. The method according to any one of Examples 1 to 89, which comprises administering to the human subject an amount of about 40 mg to about 70 mg of the compound once every 4 weeks.
[0249] Example 139. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 40 mg to 70 mg of the compound once every 2 weeks, a total of 3 doses, and then administering a dose of 40 mg to 70 mg of the compound once every 4 weeks thereafter.
[0250] Example 140. The method according to any one of Examples 1 to 89, which comprises administering to the human subject an amount of about 40 mg to about 70 mg of the compound once every 2 weeks, a total of 3 doses, and then administering an amount of about 40 mg to about 70 mg of the compound once every 4 weeks thereafter.
[0251] Example 141. The method according to Example 139 or Example 140, wherein for the first 6 doses, the same amount of the compound is administered.
[0252] Example 142. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 70 mg of the compound once every 4 weeks, a total of 3 doses, and then administering a dose of 40 mg of the compound once every 4 weeks thereafter.
[0253] Example 143. The method according to any one of Examples 1 to 89, which comprises administering to the human subject a dose of 70 mg of the compound once every 4 weeks, a total of 3 doses, and then administering a dose of 70 mg of the compound once every 8 weeks thereafter.
[0254] Example 144. The method according to any one of Examples 1 to 89, wherein the human subject has IgA nephropathy, and the method comprises administering to the subject a first dosing regimen comprising a total of 3 doses once every two weeks, and then administering a 100 mg dose of the compound once every 4 weeks.
[0255] Example 145. The method according to Example 128, further comprising monitoring the safety or efficacy of the dosing regimen, stopping the administration of the first dosing regimen, and then administering to the subject a second dosing regimen comprising administering a 70 mg dose of the compound once every 4 weeks.
[0256] Example 146. The method according to any one of Examples 90 to 145, wherein 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 doses are administered.
[0257] Example 147. The method according to any one of Examples 1 to 89, which comprises administering to the human subject an initial loading dose of 70 mg of the compound.
[0258] Example 148. The method according to Example 147, which comprises administering to the human subject a second loading dose of 70 mg of the compound 4 weeks after the initial loading dose.
[0259] Example 149. The method according to Example 147 or Example 148, which comprises administering to the human subject a maintenance dose of 40 mg of the compound 4 weeks after the second loading dose.
[0260] Example 150. The method according to Example 147 or Example 148, which comprises administering to the human subject a maintenance dose of 40 mg of the compound 8 weeks after the second loading dose.
[0261] Example 151. The method according to Example 147 or Example 148, which comprises administering to the human subject a maintenance dose of 40 mg of the compound 12 weeks after the second loading dose.
[0262] Example 152. The method according to Example 147 or Example 148, which comprises administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 4 weeks after the second loading dose and then every 4 weeks thereafter.
[0263] Example 153. The method according to Example 147 or Example 148, which comprises administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 8 weeks after the second loading dose and every 8 weeks thereafter.
[0264] Example 154. The method according to Example 147 or Example 148, which comprises administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 12 weeks after the second loading dose and every 12 weeks thereafter.
[0265] Example 155. The method according to Example 147 or Example 148, which comprises administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 16 weeks after the second loading dose and every 16 weeks thereafter.
[0266] Example 156. The method according to Example 147 or Example 148, which comprises administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 24 weeks after the second loading dose and every 24 weeks thereafter.
[0267] Example 157. The method according to any one of Examples 149 to 156, wherein at least 2, at least 3, at least 4, at least 5 or at least 6 maintenance doses are administered to the human subject.
[0268] Example 158. The method according to any one of Examples 1 to 157, wherein the compound is administered subcutaneously.
[0269] Example 159. The method according to Example 145, wherein the compound is administered by injection.
[0270] Example 160. The method according to any one of Examples 1 to 159, wherein the compound is formulated as a pharmaceutical composition comprising the compound and a pharmaceutically acceptable diluent.
[0271] Example 161. The method according to Example 160, wherein the pharmaceutically acceptable diluent is sterile water, sterile saline or sterile phosphate buffered saline.
[0272] Example 162. The method according to any one of Examples 1 to 161, wherein the compound is co-administered with an angiotensin converting enzyme inhibitor, an angiotensin receptor blocker, a sodium / glucose co-transporter-2 inhibitor, an anti-complement agent or a complement inhibitor.
[0273] Example 163. A method for improving IgA nephropathy, improving geographic atrophy, reducing CFB protein or reducing CFB RNA in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound having the following chemical structure:
[0274]
[0275] or a pharmaceutically acceptable salt thereof.
[0276] Example 164. The method according to Example 163, wherein the compound is a sodium salt or a potassium salt.
[0277] Example 165. A method for improving IgA nephropathy, improving geographic atrophy, reducing CFB protein or reducing CFB RNA in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound having the following chemical structure:
[0278]
[0279] Example 166. A method for improving IgA nephropathy, improving geographic atrophy, reducing CFB protein or reducing CFB RNA in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound: wherein the compound has the following chemical symbols (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es Aes G es m C e (SEQ ID NO:4); wherein,
[0280] A = adenine nucleobase,
[0281] m C = 5-methylcytosine nucleobase,
[0282] G = guanine nucleobase,
[0283] T = thymine nucleobase,
[0284] e = 2'-MOE sugar moiety,
[0285] d = 2'-β-D-deoxyribosyl sugar moiety,
[0286] s = phosphorothioate internucleoside linkage, and
[0287] GalNAc3-7 a-o'=
[0288]
[0289] Example 167. A method of ameliorating IgA nephropathy in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound having the following chemical structure:
[0290]
[0291] or a pharmaceutically acceptable salt thereof.
[0292] Example 168. The method according to Example 167, wherein the compound is a sodium salt or a potassium salt.
[0293] Example 169. A method of ameliorating IgA nephropathy in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 70 mg or about 70 mg of a compound having the following chemical structure:
[0294]
[0295] Example 170. A method of ameliorating IgA nephropathy in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 70 mg or about 70 mg of a compound, wherein the compound has the following chemical symbol (5' to 3'): GalNAc3-7 a-o' A es T esm C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO:4); wherein,
[0296] A = adenine nucleobase,
[0297] m C = 5-methylcytosine nucleobase,
[0298] G = guanine nucleobase,
[0299] T = thymine nucleobase,
[0300] e = 2'-MOE sugar moiety,
[0301] d = 2'-β-D-deoxyribosyl sugar moiety,
[0302] s = phosphorothioate internucleoside linkage, and
[0303] GalNAc3-7 a-o'=
[0304]
[0305] Example 171. A method of ameliorating geographic atrophy in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound having the following chemical structure:
[0306]
[0307] or a pharmaceutically acceptable salt thereof.
[0308] Example 172. The method according to Example 171, wherein the compound is a sodium salt or a potassium salt.
[0309] Example 173. A method of ameliorating geographic atrophy in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound having the following chemical structure:
[0310]
[0311] Example 174. A method of ameliorating geographic atrophy in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound, wherein the compound has the following chemical symbol (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C e s A es G es m C e (SEQ ID NO:4); wherein,
[0312] A = adenine nucleobase,
[0313] m C = 5-methylcytosine nucleobase,
[0314] G = guanine nucleobase,
[0315] T = thymine nucleobase,
[0316] e = 2'-MOE sugar moiety,
[0317] d = a 2'-β-D-deoxyribosyl sugar moiety,
[0318] s = a phosphorothioate internucleoside linkage, and
[0319] GalNAc3-7 a-o'=
[0320]
[0321] Example 175. The method according to any one of Examples 163 to 174, which comprises administering the compound once every 4 weeks.
[0322] Example 176. The method according to any one of Examples 163 to 174, which comprises administering the compound once every 8 weeks.
[0323] Example 177. The method according to any one of Examples 163 to 174, which comprises administering the compound once every 12 weeks.
[0324] Example 178. The method according to any one of Examples 163 to 174, which comprises administering the compound once every 16 weeks.
[0325] Example 179. The method according to any one of Examples 163 to 174, which comprises administering the compound once every 24 weeks.
[0326] Example 180. The method according to any one of Examples 163 to 174, which comprises administering the compound once every 6 months.
[0327] Example 181. The method according to any one of Examples 163 to 174, which comprises administering the compound approximately once every 4 weeks.
[0328] Example 182. The method according to any one of Examples 163 to 174, which comprises administering the compound approximately once every 8 weeks.
[0329] Example 183. The method according to any one of Examples 163 to 174, which comprises administering the compound approximately once every 12 weeks.
[0330] Example 184. The method according to any one of Examples 163 to 174, which comprises administering the compound approximately once every 16 weeks.
[0331] Example 185. The method according to any one of Examples 163 to 174, which comprises administering the compound approximately once every 24 weeks.
[0332] Example 186. The method according to any one of Examples 163 to 174, which comprises administering the compound approximately once every 6 months.
[0333] Example 187. The method according to any one of Examples 163 to 174, which comprises administering a 40 mg dose of the compound to the human subject once every four weeks.
[0334] Example 188. The method according to any one of Examples 163 to 174, which comprises administering a 70 mg dose of the compound to the human subject once every four weeks.
[0335] Example 189. The method according to any one of Examples 163 to 174, which comprises administering a 100 mg dose of the compound to the human subject once every four weeks.
[0336] Example 190. The method according to any one of Examples 163 to 174, wherein the compound is administered by injection.
[0337] Example 191. The method according to any one of Examples 163 to 190, wherein the compound is formulated as a pharmaceutical composition comprising the compound and a pharmaceutically acceptable diluent.
[0338] Example 192. The method according to Example 191, wherein the pharmaceutically acceptable diluent is sterile water, sterile saline, or sterile phosphate buffered saline.
[0339] Example 193. The method according to any one of Examples 163 to 192, wherein administering the compound reduces the level of C3 deposition in the eye, or reduces the accumulation of C3 deposition in the eye, or slows the progression of geographic atrophy in the subject.
[0340] Example 194. The method according to any one of Examples 163 to 192, wherein in the subject, administering the compound reduces the level of plasma CFB protein, reduces serum AP activity, reduces the level of serum functional CFB, reduces the level of urinary factor B cleavage product (Ba), or reduces the level of proteinuria.
[0341] Example 195. The method according to Example 194, wherein the urinary protein / creatinine ratio is reduced after administering the compound.
[0342] Example 196. The method according to Example 194, wherein the level of urinary protein is reduced after administering the compound.
[0343] Example 197. The method according to any one of Examples 163 to 192, wherein administering the compound slows the progression of geographic atrophy in the subject.
[0344] Example 198. The method according to any one of Examples 163 to 193, wherein administering the compound slows the expansion of the geographic atrophy region.
[0345] Example 199. The method according to any one of Examples 163 to 193, wherein administering the compound slows the expansion of geographic atrophy into the foveal region.
[0346] Example 200. The method according to Examples 163 to 193, wherein administering the compound prevents the expansion of geographic atrophy.
[0347] Example 201. The method according to any one of Examples 1 to 200, which comprises detecting the amount of CFB protein or CFB RNA in a biological sample from the human subject.
[0348] Example 202. The method according to Example 201, wherein the biological sample is blood.
[0349] Example 203. The method according to Example 102, wherein the biological sample is serum or plasma.
[0350] Example 204. The method according to Example 201, wherein the biological sample is urine.
[0351] Example 205. The method according to any one of Examples 201 to 204, wherein the detection occurs before administering the compound.
[0352] Example 206. The method according to any one of Examples 201 to 204 to 178, wherein the detection occurs after administering the compound.
[0353] Example 207. The method according to any one of Examples 201 to 204, wherein the detection occurs before and after administering the compound.
[0354] Example 208. The method according to any one of Examples 201 to 207, which comprises adjusting the initial loading dose, loading dose, maintenance dose or therapeutically effective amount of the administered compound after detecting the amount of CFB RNA, CFB protein or a combination thereof.
[0355] Example 209. The method according to any one of Examples 1 to 208, which comprises analyzing the level of plasma CFB protein, the level of serum AP activity, the level of serum functional CFB, the level of urinary factor B cleavage product (Ba), or the level of urinary protein in the subject.
[0356] Example 210. The method according to Example 209, wherein the urine protein / creatinine ratio in a urine sample from the subject is analyzed after administering the compound.
[0357] Example 211. The method according to Example 209, wherein the level of urinary protein in a urine sample from the subject is analyzed after administering the compound.
[0358] Example 212. The method according to Example 210 or Example 211, wherein the analysis occurs before administering the compound, or after administering the compound, or a combination thereof.
[0359] Example 213. The method according to Example 212, which comprises determining or adjusting the therapeutically effective amount of the compound after performing the analysis.
[0360] Example 214. The method according to Example 212 or Example 213, which comprises performing the analysis after administering the compound and adjusting the frequency of administering the compound after performing the analysis.
[0361] I. Complement factor B (CFB)
[0362] In certain embodiments, methods of reducing CFB RNA and / or CFB protein in a cell or biological fluid of a subject are described herein. CFB RNA is encoded by the human CFB gene, which is located at human chromosome 6 positions 31913721-31919861. CFB protein is expressed at a relatively high level in the liver compared to other cell types. A representative nucleobase sequence of human CFB RNA is provided in GENBANK accession number NM_001710.5 (incorporated herein as SEQ ID NO:1). A representative nucleobase sequence of the human CFB gene is provided in GENBANK accession number NT_007592.15, which is truncated from nucleotide 31852000 to 31861000 (incorporated herein as SEQ ID NO:2). A representative nucleobase sequence of the human CFB gene is provided in GENBANK accession number NC_000006.12, which is truncated from nucleotide 31943001 to 31955000 (SEQ ID NO:5). A representative nucleobase sequence of the human CFB gene is provided in ENSEMBL gene ID ENSG00000243649.10, Ensembl Release 108 (October 2022) (SEQ ID NO:6).
[0363] II. Compound 696844
[0364] In certain embodiments, methods are described herein for administering compound 696844 (FB-L Rx ) to a subject in need thereof. In certain embodiments, compound 696844 is characterized by a 5-10-5 MOE gapmer that is covalently linked at the 5' end to a trivalent N-acetylgalactosamine (GalNAc3). Compound 696844 has the sequence (5' to 3') ATCCCACGCCCCTGTCCAGC (SEQ ID NO:3), wherein each of nucleotides 1-5 and 16-20 is a 2'-MOE nucleotide and each of nucleotides 6-15 is a 2'-β-D-deoxynucleotide, wherein all internucleotide linkages are phosphorothioate internucleotide linkages and each cytosine is 5-methylcytosine.
[0365] In certain embodiments, compound 696844 is characterized by the following chemical symbols (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO:4); wherein,
[0366] A = adenine nucleobase,
[0367] m C = 5-methylcytosine nucleobase,
[0368] G = guanine nucleobase,
[0369] T = thymine nucleobase,
[0370] e = 2'-MOE sugar moiety,
[0371] d = 2'-β-D-deoxyribosyl sugar moiety,
[0372] s = phosphorothioate internucleoside bond, and
[0373] GalNAc3-7 a-o'=
[0374]
[0375] In certain embodiments, compound 696844 is characterized by the following chemical structure:
[0376]
[0377] Structure 1. Compound 696844
[0378] In certain embodiments, the sodium salt of compound 696844 is represented by the following chemical structure:
[0379]
[0380] Structure 2. Sodium salt of compound 696844
[0381] In certain embodiments, compound 696844 is characterized by the disodium salt of a 20-base residue (20-mer) oligonucleotide that is conjugated to a GalNAc THA cluster via an aminohexyl phosphate linker at its 5'-end. Each of the 19 internucleotide bonds is a 3'-O to 5'-O phosphorothioate diester. Ten (10) of the 20 sugar residues are 2-deoxy-D-ribose, and the remainder are 2'-O-(2-methoxyethyl)-D-ribose (MOE). The residues are arranged such that five MOE nucleosides are present at the 5'- and 3'-ends of the molecule, flanking a gap of ten 2'-deoxy nucleosides. The cytosine bases are methylated at the 5-position. The sequence can be abbreviated as follows:
[0382] 5'-THA-AH O A Me U Me C Me C Me C A Me CG Me C Me C Me C Me CTGT Me C Me CAG MeC -3'
[0383] The underlined residues are 2'-MOE nucleosides. AH indicates the position of the aminohexyl linker; o indicates a phosphodiester bond; THA is 5-N-[tris({6-[(2-acetamido-2-deoxy-β-D-galactopyranosyl)oxy]-hexylamino}-3-oxopropoxymethyl)methyl]amino-5-oxopentanoyl. 2'-O-(2-methoxyethyl)-methyluridine (2'-MOE Me U) nucleoside is sometimes referred to as 2'-O-(2-methoxyethyl)-thymidine riboside (2'-MOE T).
[0384] In certain embodiments, compound 696844 is characterized by the following nomenclature, which shows each 3'-O-linked phosphorothioate internucleotide bond as follows: 5'-O-(6-{5-N-[tris({6-[(2-acetamido-2-deoxy-β-D-galactopyranosyl)oxy]-hexylamino}-3-oxopropoxymethyl)methyl]amino-5-oxopentanoyl}aminohexyl-1-phosphatidyl)-2-O-(2-methoxyethyl)-P-thioadenosyl-(3-O5-O)-2--(2-methoxyethyl)-5-methyl-P-thiouridyl-(3-O5-O)-2--(2-methoxyethyl)-5-methyl-P-thiocytidyl-(3-O5-O)-2--(2-methoxyethyl)-5-methyl-P-thiocytidyl-(3-O5-O)-2--(2-methoxyethyl)-5-methyl-P-thiocytidyl-(3-O5-O)-2-deoxy-P-thioadenosyl-(3-O5-O)-2-deoxy-5-methyl-P-thiocytidyl-(3-O5-O)-2-deoxy-P-thioguanidyl-(3-O5-O)-2-deoxy-5-methyl-P-thiocytidyl-(3-O5-O)-2-deoxy-5-methyl-P-thiocytidyl-(3-O5-O)-2-deoxy-5-methyl-P-thiocytidyl-(3-O5-O)-2-deoxy-5-methyl-P-thiocytidyl-(3-O5-O)-P-thiothymidyl-(3-O5-O)-2-deoxy-P-thioguanidyl-(3-O5-O)-P-thiothymidyl-(3-O5-O)-2--(2-methoxyethyl)-5-methyl-P-thiocytidyl-(3-O5-O)-2--(2-methoxyethyl)-5-methyl-P-thiocytidyl-(3-O5-O)-2-O-(2-methoxyethyl)-P-thioadenosyl-(3-O5-O)-2--(2-methoxyethyl)-P-thioguanidyl-(3-O5-O)-2--(2-methoxyethyl)-5-methylcytosine 20 sodium salt.
[0385] In certain embodiments, the Compound 696844 pharmaceutical composition is a sterile parenteral solution of 100 mg / mL Compound 696844 in phosphate buffered saline. The formulation contains 100 mg / mL of Compound 696844 and is adjusted to a pH of approximately 7.4 with acid or base during formulation. The solution is clear and colorless to pale yellow in color. In certain embodiments, the pharmaceutical composition is packaged in an ISO 2R Type I clear glass vial with a 0.8 mL deliverable volume, the vial is sealed with a butyl rubber stopper and sealed with an aluminum top seal. In certain embodiments, each vial is filled with approximately 1.0 mL to ensure that the labeled 0.8 mL volume is available for administration. In certain embodiments, the pharmaceutical composition is for single use and contains no preservatives. In certain embodiments, the pharmaceutical composition is stored safely protected from light at 2°C - 8°C.
[0386] Compound 696844 and pharmaceutical compositions containing Compound 696844 are described in WO 2015 / 168635.
[0387] III. Certain pharmaceutical compositions
[0388] In certain embodiments, methods of administering a pharmaceutical composition comprising Compound 696844 to a subject are described herein. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists essentially of a sterile saline solution and Compound 696844. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists essentially of sterile water and Compound 696844. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists essentially of phosphate buffered saline (PBS) and Compound 696844. In certain embodiments, the PBS is pharmaceutical grade. In certain embodiments, the pharmaceutical composition comprises Compound 696844 at a certain concentration in PBS and is diluted in a diluent to achieve the desired clinical dose. In certain embodiments, the diluent is a sterile saline solution, sterile water, or PBS. In certain embodiments, the pharmaceutical composition comprises Compound 696844 at a certain concentration in PBS and is diluted in PBS to achieve the desired clinical dose. In certain embodiments, Compound 696844 is formulated at 100 mg / mL in phosphate buffered saline (PBS). In certain embodiments, Compound 696844 is formulated at 100 mg / mL in PBS and is in a stoppered and sealed glass vial. In certain embodiments, Compound 696844 is formulated at 100 mg / mL in PBS and is provided for clinical use in a deliverable volume of 0.8 mL. In certain embodiments, Compound 696844 is formulated at 100 mg / mL in PBS and is provided for clinical use in a deliverable volume of 0.8 mL in a stoppered and sealed glass vial. In certain embodiments, Compound 696844 is formulated at 100 mg / mL in PBS and is diluted in PBS to achieve the desired clinical dose. The term "deliverable volume" may include an additional amount of the formulation to ensure that the deliverable volume is available for administration. In certain embodiments, for a deliverable volume of 0.8 mL, the glass vial contains 1.0 mL of the formulation.
[0389] In certain embodiments, the pharmaceutical composition comprises one or more excipients and Compound 696844. In certain embodiments, the excipients are selected from water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxy methylcellulose, and polyvinylpyrrolidone.
[0390] In certain embodiments, a pharmaceutical composition comprising compound 696844 encompasses any pharmaceutically acceptable salt of compound 696844, an ester of compound 696844, or a salt of such an ester. In certain embodiments, the pharmaceutically acceptable salts include sodium, potassium, calcium, or magnesium. In certain embodiments, the pharmaceutically acceptable salts include sodium or magnesium. In certain embodiments, the pharmaceutical composition comprises one or more of sodium, potassium, calcium, or magnesium. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable salt of the compound represented by Structure 1, the salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, a pharmaceutical composition comprising compound 696844 is capable of providing (directly or indirectly) its biologically active metabolite or residue after administration to a human subject. Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts of compound 696844, prodrugs of compound 696844, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
[0391] In certain embodiments, the pharmaceutical composition comprises one or more lipid moieties and compound 696844. In certain embodiments, the lipid moiety is used to increase the distribution of compound 696844 to a particular cell or tissue. In certain such methods, compound 696844 is introduced into a preformed liposome or cationic lipid complex made from a mixture of cationic lipid and neutral lipid. In certain methods, a complex of DNA with a mono-cationic lipid or poly-cationic lipid is formed in the absence of neutral lipid.
[0392] In certain embodiments, the pharmaceutical compositions disclosed herein comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems can be used to prepare pharmaceutical compositions, including pharmaceutical compositions comprising hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.
[0393] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules, which are designed to deliver the compounds described herein to a particular tissue or cell type. For example, in certain embodiments, the pharmaceutical composition includes liposomes coated with tissue-specific antibodies.
[0394] In certain embodiments, the pharmaceutical composition comprises a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, non-polar surfactants, water-soluble organic polymers, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a co-solvent system comprising 3% w / v benzyl alcohol, 8% w / v non-polar surfactant polysorbate 80 TMand an absolute ethanol solution of 65% w / v polyethylene glycol 300. The proportions of such cosolvent systems can vary widely without significantly altering their solubility and toxicity characteristics. In addition, the characteristics of the cosolvent components can vary: for example, other surfactants can be used instead of polysorbate 80 TM ; the fraction size of the polyethylene glycol can vary; other biocompatible polymers can replace the polyethylene glycol, for example, polyvinylpyrrolidone; and other sugars or polysaccharides can replace the dextran.
[0395] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV)). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution (such as water) or a physiologically compatible buffer (such as phosphate buffered saline (PBS), Hanks' solution, Ringer's solution, physiological saline buffer, or artificial CSF). In certain embodiments, other ingredients (such as ingredients that aid in dissolution or act as preservatives) are also included. In certain embodiments, injectable suspensions are prepared using a suitable liquid carrier, suspending agent, etc. Certain injectable pharmaceutical compositions are present in unit dosage form, for example, in ampoules or multi-dose containers. Certain injectable pharmaceutical compositions are present in unit dosage form in pre-filled syringes. Certain injectable pharmaceutical compositions are sterile suspensions, solutions, or emulsions in an oily or aqueous vehicle and may contain formulating agents such as suspending agents, stabilizers, and / or dispersing agents. Certain solvents suitable for injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes.
[0396] Under certain conditions, compound 696844 acts as an acid. Although compound 696844 may be depicted or described in its protonated (free acid) form or ionized and associated with a cation (salt) form, the aqueous solution of compound 696844 exists in equilibrium between these forms. For example, the phosphate bond in compound 696844 in aqueous solution exists in equilibrium as free acid, anion, and salt forms. Unless otherwise stated, the term "compound 696844" is intended to include all such forms. In addition, compound 696844 has multiple such bonds, each in equilibrium. Thus, compound 696844 exists in solution in multiple forms that are in equilibrium at multiple positions. The term "compound 696844" is intended to include all such forms. The drawn structure necessarily depicts a single form. However, unless otherwise stated, such drawings are likewise intended to include the corresponding forms. In this document, the structure of the free acid of compound 696844 followed by the term "or its salts" expressly includes all forms that may be fully or partially protonated / deprotonated / associated with a cation. In some cases, one or more specific cations are identified.
[0397] In certain embodiments, compound 696844 is in an aqueous solution containing sodium. In certain embodiments, compound 696844 is in an aqueous solution containing potassium. In certain embodiments, compound 696844 is in PBS. In certain embodiments, compound 696844 is in water. In some such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.
[0398] Certain specific dosages are described herein. For clarity, the dosage of compound 696844 in milligrams indicates the mass of the free acid form of compound 696844. As described above, in aqueous solution, the free acid is in equilibrium with the anion and salt forms. However, for calculating the dosage, it is assumed that compound 696844 exists in a solvent-free, sodium acetate-free, water-free, free acid form. For example, when compound 696844 is in a sodium-containing solution (such as brine), compound 696844 may be partially or fully deprotonated and associated with Na+ ions. However, the mass of the proton is still counted in the weight of the dosage, and the mass of Na+ is not counted in the weight of the dosage. Thus, for example, a 40 mg dosage of compound 696844 is equal to the number of fully protonated molecules weighing 40 mg. This is equivalent to 40.93 mg of solvent-free, sodium acetate-free, sodium-free compound 696844. Similarly, a 70 mg dosage of compound 696844 is equal to the number of fully protonated molecules weighing 70 mg. This is equivalent to 73.37 mg of solvent-free, sodium acetate-free, sodium-free compound 696844.
[0399] IV. Certain dosages
[0400] In certain embodiments, methods of administering a therapeutically effective amount of compound 696844 to a subject are described herein. In certain embodiments, the therapeutically effective amount is 10 mg. In certain embodiments, the therapeutically effective amount is 20 mg. In certain embodiments, the therapeutically effective amount is 40 mg. In certain embodiments, the therapeutically effective amount is 70 mg. In certain embodiments, the therapeutically effective amount is 100 mg.
[0401] In certain embodiments, the therapeutically effective amount is any one of the following: 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, and 350 mg.
[0402] In certain embodiments, a therapeutically effective amount is any of the following: about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, about 185 mg, about 190 mg, about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, about 260 mg, about 265 mg, about 270 mg, about 275 mg, about 280 mg, about 285 mg, about 290 mg, about 295 mg, about 300 mg, about 305 mg, about 310 mg, about 315 mg, about 320 mg, about 325 mg, about 330 mg, about 335 mg, about 340 mg, about 345 mg and about 350 mg.
[0403] In certain embodiments, a therapeutically effective amount is any one of the following: 10 mg, 10.1 mg, 10.2 mg, 10.3 mg, 10.4 mg, 10.5 mg, 10.6 mg, 10.7 mg, 10.8 mg, 10.9 mg, 11 mg, 11.1 mg, 11.2 mg, 11.3 mg, 11.4 mg, 11.5 mg, 11.6 mg, 11.7 mg, 11.8 mg, 11.9 mg, 12 mg, 12.1 mg, 12.2 mg, 12.3 mg, 12.4 mg, 12.5 mg, 12.6 mg, 12.7 mg, 12.8 mg, 12.9 mg, 13 mg, 13.1 mg, 13.2 mg, 13.3 mg, 13.4 mg, 13.5 mg, 13.6 mg, 13.7 mg, 13.8 mg, 13.9 mg, 14 mg, 14.1 mg, 14.2 mg, 14.3 mg, 14.4 mg, 14.5 mg, 14.6 mg, 14.7 mg, 14.8 mg, 14.9 mg, 15 mg, 15.1 mg, 15.2 mg, 15.3 mg, 15.4 mg, 15.5 mg, 15.6 mg, 15.7 mg, 15.8 mg, 15.9 mg, 16 mg, 16.1 mg, 16.2 mg, 16.3 mg, 16.4 mg, 16.5 mg, 16.6 mg, 16.7 mg, 16.8 mg, 16.9 mg, 17 mg, 17.1 mg, 17.2 mg, 17.3 mg, 17.4 mg, 17.5 mg, 17.6 mg, 17.7 mg, 17.8 mg, 17.9 mg, 18 mg, 18.1 mg, 18.2 mg, 18.3 mg, 18.4 mg, 18.5 mg, 18.6 mg, 18.7 mg, 18.8 mg, 18.9 mg, 19 mg, 19.1 mg, 19.2 mg, 19.3 mg, 19.4 mg, 19.5 mg, 19.6 mg, 19.7 mg, 19.8 mg, 19.9 mg, 20 mg, 20.1 mg, 20.2 mg, 20.3 mg, 20.4 mg, 20.5 mg, 20.6 mg, 20.7 mg, 20.8 mg, 20.9 mg, 21 mg, 21.1 mg, 21.2 mg, 21.3 mg, 21.4 mg, 21.5 mg, 21.6 mg, 21.7 mg, 21.8 mg, 21.9 mg, 22 mg, 22.1 mg, 22.2 mg, 22.3 mg, 22.4 mg, 22.5 mg, 22.6 mg, 22.7 mg, 22.8 mg, 22.9 mg, 23 mg, 23.1 mg, 23.2 mg, 23.3 mg, 23.4 mg, 23.5 mg, 23.6 mg, 23.7 mg, 23.8 mg, 23.9 mg, 24 mg, 24.1 mg, 24.2 mg, 24.3 mg, 24.4 mg, 24.5 mg, 24.6 mg, 24.7 mg, 24.8 mg, 24.9 mg, 25 mg, 25.1 mg, 25.2 mg, 25.3 mg, 25.4 mg, 25.5 mg, 25.6 mg, 25.7 mg, 25.8 mg, 25.9 mg, 26 mg, 26.1 mg, 26.2 mg, 26.3 mg, 26.4 mg, 26.5 mg, 26.6 mg, 26.7 mg, 26.8 mg, 26.9 mg, 27 mg, 27.1 mg, 27.2 mg, 27.3 mg, 27.4 mg, 27.5 mg, 27.6 mg, 27.7 mg, 27.8 mg, 27.9 mg, 28 mg, 28.1 mg, 28.2 mg, 28.3 mg, 28.4 mg, 28.5 mg, 28.6 mg, 28.7 mg, 28.8 mg, 28.9 mg, 29 mg, 29.1 mg, 29.2 mg, 29.3 mg, 29.4 mg, 29.5 mg, 29.6 mg, 29.7 mg, 29.8 mg, 29.9 mg, 30 mg, 30.1 mg, 30.2 mg, 30.3 mg, 30.4 mg, 30.5 mg, 30.6 mg, 30.7 mg, 30.8 mg, 30.9 mg, 31 mg, 31.1 mg, 31.2 mg, 31.3 mg, 31.4 mg, 31.5 mg, 31.6 mg, 31.7 mg, 31.8 mg, 31.9 mg, 32 mg, 32.1 mg, 32.2 mg, 32.3 mg, 32.4 mg, 32.5 mg, 32.6 mg, 32.7 mg, 32.8 mg, 32.9 mg, 33 mg, 33.1 mg, 33.2 mg, 33.3 mg, 33.4 mg, 33.5 mg, 33.6 mg, 33.7 mg, 33.8 mg, 33.9 mg, 34 mg, 34.1 mg, 34.2 mg, 34.3 mg, 34.4 mg, 34.5 mg, 34.6 mg, 34.7 mg, 34.8 mg, 34.9 mg, 35 mg, 35.1 mg, 35.2 mg, 35.3 mg, 35.4 mg, 35.5 mg, 35.6 mg, 35.7 mg, 35.8 mg, 35.9 mg, 36 mg, 36.1 mg, 36.2 mg, 36.3 mg, 36.4 mg, 36.5 mg, 36.6 mg, 36.7 mg, 36.8 mg, 36.9 mg, 37 mg, 37.1 mg, 37.2 mg, 37.3 mg, 37.4 mg, 37.5 mg, 37.6 mg, 37.7 mg, 37.8 mg, 37.9 mg, 38 mg, 38.1 mg, 38.2 mg, 38.3 mg, 38.4 mg, 38.5 mg, 38.6 mg, 38.7 mg, 38.8 mg, 38.9 mg, 39 mg, 39.1 mg, 39.2 mg, 39.3 mg, 39.4 mg, 39.5 mg, 39.6 mg, 39.7 mg, 39.8 mg, 39.9 mg, 40 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, 42.8 mg, 42.9 mg, 43 mg, 43.1 mg, 43.2 mg, 43.3 mg, 43.4 mg, 43.5 mg, 43.6 mg, 43.7 mg, 43.8 mg, 43.9 mg, 44 mg, 44.1 mg, 44.2 mg, 44.3 mg, 44.4 mg, 44.5 mg, 44.6 mg, 44.7 mg, 44.8 mg, 44.9 mg, 45 mg, 45.1 mg, 45.2 mg, 45.3 mg, 45.4 mg, 45.5 mg, 45.6 mg, 45.7 mg, 45.8 mg, 45.9 mg, 46 mg, 46.1 mg, 46.2 mg, 46.3 mg, 46.4 mg, 46.5 mg, 46.6 mg, 46.7 mg, 46.8 mg, 46.9 mg, 47 mg, 47.1 mg, 47.2 mg, 47.3 mg, 47.4 mg, 47.5 mg, 47.6 mg, 47.7 mg, 47.8 mg, 47.9 mg, 48 mg, 48.1 mg, 48.2 mg, 48.3 mg, 48.4 mg, 48.5 mg, 48.6 mg, 48.7 mg, 48.8 mg, 48.9 mg, 49 mg, 49.1 mg, 49.2 mg, 49.3 mg, 49.4 mg, 49.5 mg, 49.6 mg, 49.7 mg, 49.8 mg, 49.9 mg, 50 mg, 50.1 mg, 50.2 mg, 50.3 mg, 50.4 mg, 50.5 mg, 50.6 mg, 50.7 mg, 50.8 mg, 50.9 mg, 51 mg, 51.1 mg, 51.2 mg, 51.3 mg, 51.4 mg, 51.5 mg, 51.6 mg, 51.7 mg, 51.8 mg, 51.9 mg, 52 mg, 52.1 mg, 52.2 mg, 52.3 mg, 52.4 mg, 52.5 mg, 52.6 mg, 52.7 mg, 52.8 mg, 52.9 mg, 53 mg, 53.1 mg, 53.2 mg, 53.3 mg, 53.4 mg, 53.5 mg, 53.6 mg, 53.7 mg, 53.8 mg, 53.9 mg, 54 mg, 54.1 mg, 54.2 mg, 54.3 mg, 54.4 mg, 54.5 mg, 54.6 mg, 54.7 mg, 54.8 mg, 54.9 mg, 55 mg, 55.1 mg, 55.2 mg, 55.3 mg, 55.4 mg, 55.5 mg, 55.6 mg, 55.7 mg, 55.8 mg, 55.9 mg, 56 mg, 56.1 mg, 56.2 mg, 56.3 mg, 56.4 mg, 56.5 mg, 56.6 mg, 56.7 mg, 56.8 mg, 56.9 mg, 57 mg, 57.1 mg, 57.2 mg, 57.3 mg, 57.4 mg, 57.5 mg, 57.6 mg, 57.7 mg, 57.8 mg, 57.9 mg, 58 mg, 58.1 mg, 58.2 mg, 58.3 mg, 58.4 mg, 58.5 mg, 58.6 mg, 58.7 mg, 58.8 mg, 58.9 mg, 59 mg, 59.1 mg, 59.2 mg, 59.3 mg, 59.4 mg, 59.5 mg, 59.6 mg, 59.7 mg, 59.8 mg, 59.9 mg, 60 mg, 60.1 mg, 60.2 mg, 60.3 mg, 60.4 mg, 60.5 mg, 60.6 mg, 60.7 mg, 60.8 mg, 60.9 mg, 61 mg, 61.1 mg, 61.2 mg, 61.3 mg, 61.4 mg, 61.5 mg, 61.6 mg, 61.7 mg, 61.8 mg, 61.9 mg, 62 mg, 62.1 mg, 62.2 mg, 62.3 mg, 62.4 mg, 62.5 mg, 62.6 mg, 62.7 mg, 62.8 mg, 62.9 mg, 63 mg, 63.1 mg, 63.2 mg, 63.3 mg, 63.4 mg, 63.5 mg, 63.6 mg, 63.7 mg, 63.8 mg, 63.9 mg, 64 mg, 64.1 mg, 64.2 mg, 64.3 mg, 64.4 mg, 64.5 mg, 64.6 mg, 64.7 mg, 64.8 mg, 64.9 mg, 65 mg, 65.1 mg, 65.2 mg, 65.3 mg, 65.4 mg, 65.5 mg, 65.6 mg, 65.7 mg, 65.8 mg, 65.9 mg, 66 mg, 66.1 mg, 66.2 mg, 66.3 mg, 66.4 mg, 66.5 mg, 66.6 mg, 66.7 mg, 66.8 mg, 66.9 mg, 67 mg, 67.1 mg, 67.2 mg, 67.3 mg, 67.4 mg, 67.5 mg, 67.6 mg, 67.7 mg, 67.8 mg, 67.9 mg, 68 mg, 68.1 mg, 68.2 mg, 68.3 mg, 68.4 mg, 68.5 mg, 68.6 mg, 68.7 mg, 68.8 mg, 68.9 mg, 69 mg, 69.1 mg, 69.2 mg, 69.3 mg, 69.4 mg, 69.5 mg, 69.6 mg, 69.7 mg, 69.8 mg, 69.9 mg and 70 mg.
[0404] In some embodiments, a therapeutically effective amount is any of the following: about 10 mg, about 10.1 mg, about 10.2 mg, about 10.3 mg, about 10.4 mg, about 10.5 mg, about 10.6 mg, about 10.7 mg, about 10.8 mg, about 10.9 mg, about 11 mg, about 11.1 mg, about 11.2 mg, about 11.3 mg, about 11.4 mg, about 11.5 mg, about 11.6 mg, about 11.7 mg, about 11.8 mg, about 11.9 mg, about 12 mg, about 12.1 mg, about 12.2 mg, about 12.3 mg, about 12.4 mg, about 12.5 mg, about 12.6 mg, about 12.7 mg, about 12.8 mg, about 12.9 mg, about 13 mg, about 13.1 mg, about 13.2 mg, about 13.3 mg, about 13.4 mg, about 13.5 mg, about 13.6 mg, about 13.7 mg, about 13.8 mg, about 13.9 mg, about 14 mg, about 14.1 mg, about 14.2 mg, about 14.3 mg, about 14.4 mg, about 14.5 mg, about 14.6 mg, about 14.7 mg, about 14.8 mg, about 14.9 mg, about 15 mg, about 15.1 mg, about 15.2 mg, about 15.3 mg, about 15.4 mg, about 15.5 mg, about 15.6 mg, about 15.7 mg, about 15.8 mg, about 15.9 mg, about 16 mg, about 16.1 mg, about 16.2 mg, about 16.3 mg, about 16.4 mg, about 16.5 mg, about 16.6 mg, about 16.7 mg, about 16.8 mg, about 16.9 mg, about 17 mg, about 17.1 mg, about 17.2 mg, about 17.3 mg, about 17.4 mg, about 17.5 mg, about 17.6 mg, about 17.7 mg, about 17.8 mg, about 17.9 mg, about 18 mg, about 18.1 mg, about 18.2 mg, about 18.3 mg, about 18.4 mg, about 18.5 mg, about 18.6 mg, about 18.7 mg, about 18.8 mg, about 18.9 mg, about 19 mg, about 19.1 mg, about 19.2 mg, about 19.3 mg, about 19.4 mg, about 19.5 mg, about 19.6 mg, about 19.7 mg, about 19.8 mg, about 19.9 mg, about 20 mg, about 20.1 mg, about 20.2 mg, about 20.3 mg, about 20.4 mg, about 20.5 mg, about 20.6 mg, about 20.7 mg, about 20.8 mg, about 20.9 mg, about 21 mg, about 21.1 mg, about 21.2 mg, about 21.3 mg, about 21.4 mg, about 21.5 mg, about 21.6 mg, about 21.7 mg, about 21.8 mg, about 21.9 mg, about 22 mg, about 22.1 mg, about 22.2 mg, about 22.3 mg, about 22.4 mg, about 22.5 mg, approximately 22.6 mg, approximately 22.7 mg, approximately 22.8 mg, approximately 22.9 mg, approximately 23 mg, approximately 23.1 mg, approximately 23.2 mg, approximately 23.3 mg, approximately 23.4 mg, approximately 23.5 mg, approximately 23.6 mg, approximately 23.7 mg, approximately 23.8 mg, approximately 23.9 mg, approximately 24 mg, approximately 24.1 mg, approximately 24.2 mg, approximately 24.3 mg, approximately 24.4 mg, approximately 24.5 mg, approximately 24.6 mg, approximately 24.7 mg, approximately 24.8 mg, approximately 24.9 mg, approximately 25 mg, approximately 25.1 mg, approximately 25.2 mg, approximately 25.3 mg, approximately 25.4 mg, approximately 25.5 mg, approximately 25.6 mg, approximately 25.7 mg, approximately 25.8 mg, approximately 25.9 mg, approximately 26 mg, approximately 26.1 mg, approximately 26.2 mg, approximately 26.3 mg, approximately 26.4 mg, approximately 26.5 mg, approximately 26.6 mg, approximately 26.7 mg, approximately 26.8 mg, approximately 26.9 mg, approximately 27 mg, approximately 27.1 mg, approximately 27.2 mg, approximately 27.3 mg, approximately 27.4 mg, approximately 27.5 mg, approximately 27.6 mg, approximately 27.7 mg, approximately 27.8 mg, approximately 27.9 mg, approximately 28 mg, approximately 28.1 mg, approximately 28.2 mg, approximately 28.3 mg, approximately 28.4 mg, approximately 28.5 mg, approximately 28.6 mg, approximately 28.7 mg, approximately 28.8 mg, approximately 28.9 mg, approximately 29 mg, approximately 29.1 mg, approximately 29.2 mg, approximately 29.3 mg, approximately 29.4 mg, approximately 29.5 mg, approximately 29.6 mg, approximately 29.7 mg, approximately 29.8 mg, approximately 29.9 mg, approximately 30 mg, approximately 30.1 mg, approximately 30.2 mg, approximately 30.3 mg, approximately 30.4 mg, approximately 30.5 mg, approximately 30.6 mg, approximately 30.7 mg, approximately 30.8 mg, approximately 30.9 mg, approximately 31 mg, approximately 31.1 mg, approximately 31.2 mg, approximately 31.3 mg, approximately 31.4 mg, approximately 31.5 mg, approximately 31.6 mg, approximately 31.7 mg, approximately 31.8 mg, approximately 31.9 mg, approximately 32 mg, approximately 32.1 mg, approximately 32.2 mg, approximately 32.3 mg, approximately 32.4 mg, approximately 32.5 mg, approximately 32.6 mg, approximately 32.7 mg, approximately 32.8 mg, approximately 32.9 mg, approximately 33 mg, approximately 33.1 mg, approximately 33.2 mg, approximately 33.3 mg, approximately 33.4 mg, approximately 33.5 mg, approximately 33.6 mg, approximately 33.7 mg, approximately 33.8 mg, approximately 33.9 mg, approximately 34 mg, approximately 34.1 mg, approximately 34.2 mg, approximately 34.3 mg, approximately 34.4 mg, approximately 34.5 mg, approximately 34.6 mg, approximately 34.7 mg, approximately 34.8 mg, approximately 34.9 mg, approximately 35 mg, approximately 35.1 mg, approximately 35.2 mg, approximately 35.3 mg, approximately 35.4 mg, approximately 35.5 mg, approximately 35.6 mg, approximately 35.7 mg, approximately 35.8 mg, approximately 35.9 mg, approximately 36 mg, approximately 36.1 mg, approximately 36.2 mg, approximately 36.3 mg, approximately 36.4 mg, approximately 36.5 mg, approximately 36.6 mg, approximately 36.7 mg, approximately 36.8 mg, approximately 36.9 mg, approximately 37 mg, approximately 37.1 mg, approximately 37.2 mg, approximately 37.3 mg, approximately 37.4 mg, approximately 37.5 mg, approximately 37.6 mg, approximately 37.7 mg, approximately 37.8 mg, approximately 37.9 mg, approximately 38 mg, approximately 38.1 mg, approximately 38.2 mg, approximately 38.3 mg, approximately 38.4 mg, approximately 38.5 mg, approximately 38.6 mg, approximately 38.7 mg, approximately 38.8 mg, approximately 38.9 mg, approximately 39 mg, approximately 39.1 mg, approximately 39.2 mg, approximately 39.3 mg, approximately 39.4 mg, approximately 39.5 mg, approximately 39.6 mg, approximately 39.7 mg, approximately 39.8 mg, approximately 39.9 mg, approximately 40 mg, approximately 40.1 mg, approximately 40.2 mg, approximately 40.3 mg, approximately 40.4 mg, approximately 40.5 mg, approximately 40.6 mg, approximately 40.7 mg, approximately 40.8 mg, approximately 40.9 mg, approximately 41 mg, approximately 41.1 mg, approximately 41.2 mg, approximately 41.3 mg, approximately 41.4 mg, approximately 41.5 mg, approximately 41.6 mg, approximately 41.7 mg, approximately 41.8 mg, approximately 41.9 mg, approximately 42 mg, approximately 42.1 mg, approximately 42.2 mg, approximately 42.3 mg, approximately 42.4 mg, approximately 42.5 mg, approximately 42.6 mg, approximately 42.7 mg, approximately 42.8 mg, approximately 42.9 mg, approximately 43 mg, approximately 43.1 mg, approximately 43.2 mg, approximately 43.3 mg, approximately 43.4 mg, approximately 43.5 mg, approximately 43.6 mg, approximately 43.7 mg, approximately 43.8 mg, approximately 43.9 mg, approximately 44 mg, approximately 44.1 mg, approximately 44.2 mg, approximately 44.3 mg, approximately 44.4 mg, approximately 44.5 mg, approximately 44.6 mg, approximately 44.7 mg, approximately 44.8 mg, approximately 44.9 mg, approximately 45 mg, approximately 45.1 mg, approximately 45.2 mg, approximately 45.3 mg, approximately 45.4 mg, approximately 45.5 mg, approximately 45.6 mg, approximately 45.7 mg, approximately 45.8 mg, approximately 45.9 mg, approximately 46 mg, approximately 46.1 mg, approximately 46.2 mg, approximately 46.3 mg, approximately 46.4 mg, approximately 46.5 mg, approximately 46.6 mg, approximately 46.7 mg, approximately 46.8 mg, approximately 46.9 mg, approximately 47 mg, approximately 47.1 mg, approximately 47.2 mg, approximately 47.3 mg, approximately 47.4 mg, approximately 47.5 mg, approximately 47.6 mg, approximately 47.7 mg, approximately 47.8 mg, approximately 47.9 mg, approximately 48 mg, approximately 48.1 mg, approximately 48.2 mg, approximately 48.3 mg, approximately 48.4 mg, approximately 48.5 mg, approximately 48.6 mg, approximately 48.7 mg, approximately 48.8 mg, approximately 48.9 mg, approximately 49 mg, approximately 49.1 mg, approximately 49.2 mg, approximately 49.3 mg, approximately 49.4 mg, approximately 49.5 mg, approximately 49.6 mg, approximately 49.7 mg, approximately 49.8 mg, approximately 49.9 mg, approximately 50 mg, approximately 50.1 mg, approximately 50.2 mg, approximately 50.3 mg, approximately 50.4 mg, approximately 50.5 mg, approximately 50.6 mg, approximately 50.7 mg, approximately 50.8 mg, approximately 50.9 mg, approximately 51 mg, approximately 51.1 mg, approximately 51.2 mg, approximately 51.3 mg, approximately 51.4 mg, approximately 51.5 mg, approximately 51.6 mg, approximately 51.7 mg, approximately 51.8 mg, approximately 51.9 mg, approximately 52 mg, approximately 52.1 mg, approximately 52.2 mg, approximately 52.3 mg, approximately 52.4 mg, approximately 52.5 mg, approximately 52.6 mg, approximately 52.7 mg, approximately 52.8 mg, approximately 52.9 mg, approximately 53 mg, approximately 53.1 mg, approximately 53.2 mg, approximately 53.3 mg, approximately 53.4 mg, approximately 53.5 mg, approximately 53.6 mg, approximately 53.7 mg, approximately 53.8 mg, approximately 53.9 mg, approximately 54 mg, approximately 54.1 mg, approximately 54.2 mg, approximately 54.3 mg, approximately 54.4 mg, approximately 54.5 mg, approximately 54.6 mg, approximately 54.7 mg, approximately 54.8 mg, approximately 54.9 mg, approximately 55 mg, approximately 55.1 mg, approximately 55.2 mg, approximately 55.3 mg, approximately 55.4 mg, approximately 55.5 mg, approximately 55.6 mg, approximately 55.7 mg, approximately 55.8 mg, approximately 55.9 mg, approximately 56 mg, approximately 56.1 mg, approximately 56.2 mg, approximately 56.3 mg, approximately 56.4 mg, approximately 56.5 mg, approximately 56.6 mg, approximately 56.7 mg, approximately 56.8 mg, approximately 56.9 mg, approximately 57 mg, approximately 57.1 mg, approximately 57.2 mg, approximately 57.3 mg, approximately 57.4 mg, approximately 57.5 mg, approximately 57.6 mg, approximately 57.7 mg, approximately 57.8 mg, approximately 57.9 mg, approximately 58 mg, approximately 58.1 mg, approximately 58.2 mg, approximately 58.3 mg, approximately 58.4 mg, approximately 58.5 mg, approximately 58.6 mg, approximately 58.7 mg, approximately 58.8 mg, approximately 58.9 mg, approximately 59 mg, approximately 59.1 mg, approximately 59.2 mg, approximately 59.3 mg, approximately 59.4 mg, approximately 59.5 mg, approximately 59.6 mg, approximately 59.7 mg, approximately 59.8 mg, approximately 59.9 mg, approximately 60 mg, approximately 60.1 mg, approximately 60.2 mg, approximately 60.3 mg, approximately 60.4 mg, approximately 60.5 mg, approximately 60.6 mg, approximately 60.7 mg, approximately 60.8 mg, approximately 60.9 mg, about 61 mg, about 61.1 mg, about 61.2 mg, about 61.3 mg, about 61.4 mg, about 61.5 mg, about 61.6 mg, about 61.7 mg, about 61.8 mg, about 61.9 mg, about 62 mg, about 62.1 mg, about 62.2 mg, about 62.3 mg, about 62.4 mg, about 62.5 mg, about 62.6 mg, about 62.7 mg, about 62.8 mg, about 62.9 mg, about 63 mg, about 63.1 mg, about 63.2 mg, about 63.3 mg, about 63.4 mg, about 63.5 mg, about 63.6 mg, about 63.7 mg, about 63.8 mg, about 63.9 mg, about 64 mg, about 64.1 mg, about 64.2 mg, about 64.3 mg, about 64.4 mg, about 64.5 mg, about 64.6 mg, about 64.7 mg, about 64.8 mg, about 64.9 mg, about 65 mg, about 65.1 mg, about 65.2 mg, about 65.3 mg, about 65.4 mg, about 65.5 mg, about 65.6 mg, about 65.7 mg, about 65.8 mg, about 65.9 mg, about 66 mg, about 66.1 mg, about 66.2 mg, about 66.3 mg, about 66.4 mg, about 66.5 mg, about 66.6 mg, about 66.7 mg, about 66.8 mg, about 66.9 mg, about 67 mg, about 67.1 mg, about 67.2 mg, about 67.3 mg, about 67.4 mg, about 67.5 mg, about 67.6 mg, about 67.7 mg, about 67.8 mg, about 67.9 mg, about 68 mg, about 68.1 mg, about 68.2 mg, about 68.3 mg, about 68.4 mg, about 68.5 mg, about 68.6 mg, about 68.7 mg, about 68.8 mg, about 68.9 mg, about 69 mg, about 69.1 mg, about 69.2 mg, about 69.3 mg, about 69.4 mg, about 69.5 mg, about 69.6 mg, about 69.7 mg, about 69.8 mg and about 69.9 mg.
[0405] In some embodiments, a therapeutically effective amount is any of the following: 70 mg, 70.1 mg, 70.2 mg, 70.3 mg, 70.4 mg, 70.5 mg, 70.6 mg, 70.7 mg, 70.8 mg, 70.9 mg, 71 mg, 71.1 mg, 71.2 mg, 71.3 mg, 71.4 mg, 71.5 mg, 71.6 mg, 71.7 mg, 71.8 mg, 71.9 mg, 72 mg, 72.1 mg, 72.2 mg, 72.3 mg, 72.4 mg, 72.5 mg, 72.6 mg, 72.7 mg, 72.8 mg, 72.9 mg, 73 mg, 73.1 mg, 73.2 mg, 73.3 mg, 73.4 mg, 73.5 mg, 73.6 mg, 73.7 mg, 73.8 mg, 73.9 mg, 74 mg, 74.1 mg, 74.2 mg, 74.3 mg, 74.4 mg, 74.5 mg, 74.6 mg, 74.7 mg, 74.8 mg, 74.9 mg, 75 mg, 75.1 mg, 75.2 mg, 75.3 mg, 75.4 mg, 75.5 mg, 75.6 mg, 75.7 mg, 75.8 mg, 75.9 mg, 76 mg, 76.1 mg, 76.2 mg, 76.3 mg, 76.4 mg, 76.5 mg, 76.6 mg, 76.7 mg, 76.8 mg, 76.9 mg, 77 mg, 77.1 mg, 77.2 mg, 77.3 mg, 77.4 mg, 77.5 mg, 77.6 mg, 77.7 mg, 77.8 mg, 77.9 mg, 78 mg, 78.1 mg, 78.2 mg, 78.3 mg, 78.4 mg, 78.5 mg, 78.6 mg, 78.7 mg, 78.8 mg, 78.9 mg, 79 mg, 79.1 mg, 79.2 mg, 79.3 mg, 79.4 mg, 79.5 mg, 79.6 mg, 79.7 mg, 79.8 mg, 79.9 mg, 80 mg, 80.1 mg, 80.2 mg, 80.3 mg, 80.4 mg, 80.5 mg, 80.6 mg, 80.7 mg, 80.8 mg, 80.9 mg, 81 mg, 81.1 mg, 81.2 mg, 81.3 mg, 81.4 mg, 81.5 mg, 81.6 mg, 81.7 mg, 81.8 mg, 81.9 mg, 82 mg, 82.1 mg, 82.2 mg, 82.3 mg, 82.4 mg, 82.5 mg, 82.6 mg, 82.7 mg, 82.8 mg, 82.9 mg, 83 mg, 83.1 mg, 83.2 mg, 83.3 mg, 83.4 mg, 83.5 mg, 83.6 mg, 83.7 mg, 83.8 mg, 83.9 mg, 84 mg, 84.1 mg, 84.2 mg, 84.3 mg, 84.4 mg, 84.5 mg, 84.6 mg, 84.7 mg, 84.8 mg, 84.9 mg, 85 mg, 85.1 mg, 85.2 mg, 85.3 mg, 85.4 mg, 85.5 mg, 85.6 mg, 85.7 mg, 85.8 mg, 85.9 mg, 86 mg, 86.1 mg, 86.2 mg, 86.3 mg, 86.4 mg, 86.5 mg, 86.6 mg, 86.7 mg, 86.8 mg, 86.9 mg, 87 mg, 87.1 mg, 87.2 mg, 87.3 mg, 87.4 mg, 87.5 mg, 87.6 mg, 87.7 mg, 87.8 mg, 87.9 mg, 88 mg, 88.1 mg, 88.2 mg, 88.3 mg, 88.4 mg, 88.5 mg, 88.6 mg, 88.7 mg, 88.8 mg, 88.9 mg, 89 mg, 89.1 mg, 89.2 mg, 89.3 mg, 89.4 mg, 89.5 mg, 89.6 mg, 89.7 mg, 89.8 mg, 89.9 mg, 90 mg, 90.1 mg, 90.2 mg, 90.3 mg, 90.4 mg, 90.5 mg, 90.6 mg, 90.7 mg, 90.8 mg, 90.9 mg, 91 mg, 91.1 mg, 91.2 mg, 91.3 mg, 91.4 mg, 91.5 mg, 91.6 mg, 91.7 mg, 91.8 mg, 91.9 mg, 92 mg, 92.1 mg, 92.2 mg, 92.3 mg, 92.4 mg, 92.5 mg, 92.6 mg, 92.7 mg, 92.8 mg, 92.9 mg, 93 mg, 93.1 mg, 93.2 mg, 93.3 mg, 93.4 mg, 93.5 mg, 93.6 mg, 93.7 mg, 93.8 mg, 93.9 mg, 94 mg, 94.1 mg, 94.2 mg, 94.3 mg, 94.4 mg, 94.5 mg, 94.6 mg, 94.7 mg, 94.8 mg, 94.9 mg, 95 mg, 95.1 mg, 95.2 mg, 95.3 mg, 95.4 mg, 95.5 mg, 95.6 mg, 95.7 mg, 95.8 mg, 95.9 mg, 96 mg, 96.1 mg, 96.2 mg, 96.3 mg, 96.4 mg, 96.5 mg, 96.6 mg, 96.7 mg, 96.8 mg, 96.9 mg, 97 mg, 97.1 mg, 97.2 mg, 97.3 mg, 97.4 mg, 97.5 mg, 97.6 mg, 97.7 mg, 97.8 mg, 97.9 mg, 98 mg, 98.1 mg, 98.2 mg, 98.3 mg, 98.4 mg, 98.5 mg, 98.6 mg, 98.7 mg, 98.8 mg, 98.9 mg, 99 mg, 99.1 mg, 99.2 mg, 99.3 mg, 99.4 mg, 99.5 mg, 99.6 mg, 99.7 mg, 99.8 mg and 99.9 mg.
[0406] In some embodiments, a therapeutically effective amount is any of the following: about 70 mg, about 70.1 mg, about 70.2 mg, about 70.3 mg, about 70.4 mg, about 70.5 mg, about 70.6 mg, about 70.7 mg, about 70.8 mg, about 70.9 mg, about 71 mg, about 71.1 mg, about 71.2 mg, about 71.3 mg, about 71.4 mg, about 71.5 mg, about 71.6 mg, about 71.7 mg, about 71.8 mg, about 71.9 mg, about 72 mg, about 72.1 mg, about 72.2 mg, about 72.3 mg, about 72.4 mg, about 72.5 mg, about 72.6 mg, about 72.7 mg, about 72.8 mg, about 72.9 mg, about 73 mg, about 73.1 mg, about 73.2 mg, about 73.3 mg, about 73.4 mg, about 73.5 mg, about 73.6 mg, about 73.7 mg, about 73.8 mg, about 73.9 mg, about 74 mg, about 74.1 mg, about 74.2 mg, about 74.3 mg, about 74.4 mg, about 74.5 mg, about 74.6 mg, about 74.7 mg, about 74.8 mg, about 74.9 mg, about 75 mg, about 75.1 mg, about 75.2 mg, about 75.3 mg, about 75.4 mg, about 75.5 mg, about 75.6 mg, about 75.7 mg, about 75.8 mg, about 75.9 mg, about 76 mg, about 76.1 mg, about 76.2 mg, about 76.3 mg, about 76.4 mg, about 76.5 mg, about 76.6 mg, about 76.7 mg, about 76.8 mg, about 76.9 mg, about 77 mg, about 77.1 mg, about 77.2 mg, about 77.3 mg, about 77.4 mg, about 77.5 mg, about 77.6 mg, about 77.7 mg, about 77.8 mg, about 77.9 mg, about 78 mg, about 78.1 mg, about 78.2 mg, about 78.3 mg, about 78.4 mg, about 78.5 mg, about 78.6 mg, about 78.7 mg, about 78.8 mg, about 78.9 mg, about 79 mg, about 79.1 mg, about 79.2 mg, about 79.3 mg, about 79.4 mg, about 79.5 mg, about 79.6 mg, about 79.7 mg, about 79.8 mg, about 79.9 mg, about 80 mg, about 80.1 mg, about 80.2 mg, about 80.3 mg, about 80.4 mg, about 80.5 mg, about 80.6 mg, about 80.7 mg, about 80.8 mg, about 80.9 mg, about 81 mg, about 81.1 mg, about 81.2 mg, about 81.3 mg, about 81.4 mg, about 81.5 mg, about 81.6 mg, about 81.7 mg, about 81.8 mg, about 81.9 mg, about 82 mg, about 82.1 mg, about 82.2 mg, about 82.3 mg, about 82.4 mg, about 82.5 mg, approximately 82.6 mg, approximately 82.7 mg, approximately 82.8 mg, approximately 82.9 mg, approximately 83 mg, approximately 83.1 mg, approximately 83.2 mg, approximately 83.3 mg, approximately 83.4 mg, approximately 83.5 mg, approximately 83.6 mg, approximately 83.7 mg, approximately 83.8 mg, approximately 83.9 mg, approximately 84 mg, approximately 84.1 mg, approximately 84.2 mg, approximately 84.3 mg, approximately 84.4 mg, approximately 84.5 mg, approximately 84.6 mg, approximately 84.7 mg, approximately 84.8 mg, approximately 84.9 mg, approximately 85 mg, approximately 85.1 mg, approximately 85.2 mg, approximately 85.3 mg, approximately 85.4 mg, approximately 85.5 mg, approximately 85.6 mg, approximately 85.7 mg, approximately 85.8 mg, approximately 85.9 mg, approximately 86 mg, approximately 86.1 mg, approximately 86.2 mg, approximately 86.3 mg, approximately 86.4 mg, approximately 86.5 mg, approximately 86.6 mg, approximately 86.7 mg, approximately 86.8 mg, approximately 86.9 mg, approximately 87 mg, approximately 87.1 mg, approximately 87.2 mg, approximately 87.3 mg, approximately 87.4 mg, approximately 87.5 mg, approximately 87.6 mg, approximately 87.7 mg, approximately 87.8 mg, approximately 87.9 mg, approximately 88 mg, approximately 88.1 mg, approximately 88.2 mg, approximately 88.3 mg, approximately 88.4 mg, approximately 88.5 mg, approximately 88.6 mg, approximately 88.7 mg, approximately 88.8 mg, approximately 88.9 mg, approximately 89 mg, approximately 89.1 mg, approximately 89.2 mg, approximately 89.3 mg, approximately 89.4 mg, approximately 89.5 mg, approximately 89.6 mg, approximately 89.7 mg, approximately 89.8 mg, approximately 89.9 mg, approximately 90 mg, approximately 90.1 mg, approximately 90.2 mg, approximately 90.3 mg, approximately 90.4 mg, approximately 90.5 mg, approximately 90.6 mg, approximately 90.7 mg, approximately 90.8 mg, approximately 90.9 mg, approximately 91 mg, approximately 91.1 mg, approximately 91.2 mg, approximately 91.3 mg, approximately 91.4 mg, approximately 91.5 mg, approximately 91.6 mg, approximately 91.7 mg, approximately 91.8 mg, approximately 91.9 mg, approximately 92 mg, approximately 92.1 mg, approximately 92.2 mg, approximately 92.3 mg, approximately 92.4 mg, approximately 92.5 mg, approximately 92.6 mg, approximately 92.7 mg, approximately 92.8 mg, approximately 92.9 mg, approximately 93 mg, approximately 93.1 mg, approximately 93.2 mg, approximately 93.3 mg, approximately 93.4 mg, approximately 93.5 mg, approximately 93.6 mg, approximately 93.7 mg, approximately 93.8 mg, approximately 93.9 mg, approximately 94 mg, approximately 94.1 mg, approximately 94.2 mg, approximately 94.3 mg, approximately 94.4 mg, approximately 94.5 mg, approximately 94.6 mg, approximately 94.7 mg, approximately 94.8 mg, approximately 94.9 mg, approximately 95 mg, approximately 95.1 mg, approximately 95.2 mg, approximately 95.3 mg, about 95.4 mg, about 95.5 mg, about 95.6 mg, about 95.7 mg, about 95.8 mg, about 95.9 mg, about 96 mg, about 96.1 mg, about 96.2 mg, about 96.3 mg, about 96.4 mg, about 96.5 mg, about 96.6 mg, about 96.7 mg, about 96.8 mg, about 96.9 mg, about 97 mg, about 97.1 mg, about 97.2 mg, about 97.3 mg, about 97.4 mg, about 97.5 mg, about 97.6 mg, about 97.7 mg, about 97.8 mg, about 97.9 mg, about 98 mg, about 98.1 mg, about 98.2 mg, about 98.3 mg, about 98.4 mg, about 98.5 mg, about 98.6 mg, about 98.7 mg, about 98.8 mg, about 98.9 mg, about 99 mg, about 99.1 mg, about 99.2 mg, about 99.3 mg, about 99.4 mg, about 99.5 mg, about 99.6 mg, about 99.7 mg, about 99.8 mg and about 99.9 mg.
[0407] In some embodiments, the therapeutically effective amount is any one of the following: 100 mg, 100.1 mg, 100.2 mg, 100.3 mg, 100.4 mg, 100.5 mg, 100.6 mg, 100.7 mg, 100.8 mg, 100.9 mg, 101 mg, 101.1 mg, 101.2 mg, 101.3 mg, 101.4 mg, 101.5 mg, 101.6 mg, 101.7 mg, 101.8 mg, 101.9 mg, 102 mg, 102.1 mg, 102.2 mg, 102.3 mg, 102.4 mg, 102.5 mg, 102.6 mg, 102.7 mg, 102.8 mg, 102.9 mg, 103 mg, 103.1 mg, 103.2 mg, 103.3 mg, 103.4 mg, 103.5 mg, 103.6 mg, 103.7 mg, 103.8 mg, 103.9 mg, 104 mg, 104.1 mg, 104.2 mg, 104.3 mg, 104.4 mg, 104.5 mg, 104.6 mg, 104.7 mg, 104.8 mg, 104.9 mg, 105 mg, 105.1 mg, 105.2 mg, 105.3 mg, 105.4 mg, 105.5 mg, 105.6 mg, 105.7 mg, 105.8 mg, 105.9 mg, 106 mg, 106.1 mg, 106.2 mg, 106.3 mg, 106.4 mg, 106.5 mg, 106.6 mg, 106.7 mg, 106.8 mg, 106.9 mg, 107 mg, 107.1 mg, 107.2 mg, 107.3 mg, 107.4 mg, 107.5 mg, 107.6 mg, 107.7 mg, 107.8 mg, 107.9 mg, 108 mg, 108.1 mg, 108.2 mg, 108.3 mg, 108.4 mg, 108.5 mg, 108.6 mg, 108.7 mg, 108.8 mg, 108.9 mg, 109 mg, 109.1 mg, 109.2 mg, 109.3 mg, 109.4 mg, 109.5 mg, 109.6 mg, 109.7 mg, 109.8 mg, 109.9 mg, 110 mg, 110.1 mg, 110.2 mg, 110.3 mg, 110.4 mg, 110.5 mg, 110.6 mg, 110.7 mg, 110.8 mg, 110.9 mg, 111 mg, 111.1 mg, 111.2 mg, 111.3 mg, 111.4 mg, 111.5 mg, 111.6 mg, 111.7 mg, 111.8 mg, 111.9 mg, 112 mg, 112.1 mg, 112.2 mg, 112.3 mg, 112.4 mg, 112.5 mg, 112.6 mg, 112.7 mg, 112.8 mg, 112.9 mg, 113 mg, 113.1 mg, 113.2 mg, 113.3 mg, 113.4 mg, 113.5 mg, 113.6 mg, 113.7 mg, 113.8 mg, 113.9 mg, 114 mg, 114.1 mg, 114.2 mg, 114.3 mg, 114.4 mg, 114.5 mg, 114.6 mg, 114.7 mg, 114.8 mg, 114.9 mg, 115 mg, 115.1 mg, 115.2 mg, 115.3 mg, 115.4 mg, 115.5 mg, 115.6 mg, 115.7 mg, 115.8 mg, 115.9 mg, 116 mg, 116.1 mg, 116.2 mg, 116.3 mg, 116.4 mg, 116.5 mg, 116.6 mg, 116.7 mg, 116.8 mg, 116.9 mg, 117 mg, 117.1 mg, 117.2 mg, 117.3 mg, 117.4 mg, 117.5 mg, 117.6 mg, 117.7 mg, 117.8 mg, 117.9 mg, 118 mg, 118.1 mg, 118.2 mg, 118.3 mg, 118.4 mg, 118.5 mg, 118.6 mg, 118.7 mg, 118.8 mg, 118.9 mg, 119 mg, 119.1 mg, 119.2 mg, 119.3 mg, 119.4 mg, 119.5 mg, 119.6 mg, 119.7 mg, 119.8 mg, 119.9 mg, 120 mg, 120.1 mg, 120.2 mg, 120.3 mg, 120.4 mg, 120.5 mg, 120.6 mg, 120.7 mg, 120.8 mg, 120.9 mg, 121 mg, 121.1 mg, 121.2 mg, 121.3 mg, 121.4 mg, 121.5 mg, 121.6 mg, 121.7 mg, 121.8 mg, 121.9 mg, 122 mg, 122.1 mg, 122.2 mg, 122.3 mg, 122.4 mg, 122.5 mg, 122.6 mg, 122.7 mg, 122.8 mg, 122.9 mg, 123 mg, 123.1 mg, 123.2 mg, 123.3 mg, 123.4 mg, 123.5 mg, 123.6 mg, 123.7 mg, 123.8 mg, 123.9 mg, 124 mg, 124.1 mg, 124.2 mg, 124.3 mg, 124.4 mg, 124.5 mg, 124.6 mg, 124.7 mg, 124.8 mg, 124.9 mg and 125 mg.
[0408] In some embodiments, a therapeutically effective amount is any of the following: about 100 mg, about 100.1 mg, about 100.2 mg, about 100.3 mg, about 100.4 mg, about 100.5 mg, about 100.6 mg, about 100.7 mg, about 100.8 mg, about 100.9 mg, about 101 mg, about 101.1 mg, about 101.2 mg, about 101.3 mg, about 101.4 mg, about 101.5 mg, about 101.6 mg, about 101.7 mg, about 101.8 mg, about 101.9 mg, about 102 mg, about 102.1 mg, about 102.2 mg, about 102.3 mg, about 102.4 mg, about 102.5 mg, about 102.6 mg, about 102.7 mg, about 102.8 mg, about 102.9 mg, about 103 mg, about 103.1 mg, about 103.2 mg, about 103.3 mg, about 103.4 mg, about 103.5 mg, about 103.6 mg, about 103.7 mg, about 103.8 mg, about 103.9 mg, about 104 mg, about 104.1 mg, about 104.2 mg, about 104.3 mg, about 104.4 mg, about 104.5 mg, about 104.6 mg, about 104.7 mg, about 104.8 mg, about 104.9 mg, about 105 mg, about 105.1 mg, about 105.2 mg, about 105.3 mg, about 105.4 mg, about 105.5 mg, about 105.6 mg, about 105.7 mg, about 105.8 mg, about 105.9 mg, about 106 mg, about 106.1 mg, about 106.2 mg, about 106.3 mg, about 106.4 mg, about 106.5 mg, about 106.6 mg, about 106.7 mg, about 106.8 mg, about 106.9 mg, about 107 mg, about 107.1 mg, about 107.2 mg, about 107.3 mg, about 107.4 mg, about 107.5 mg, about 107.6 mg, about 107.7 mg, about 107.8 mg, about 107.9 mg, about 108 mg, about 108.1 mg, about 108.2 mg, about 108.3 mg, about 108.4 mg, about 108.5 mg, about 108.6 mg, about 108.7 mg, about 108.8 mg, about 108.9 mg, about 109 mg, about 109.1 mg, about 109.2 mg, about 109.3 mg, about 109.4 mg, about 109.5 mg, about 109.6 mg, about 109.7 mg, about 109.8 mg, about 109.9 mg, about 110 mg, about 110.1 mg, about 110.2 mg, about 110.3 mg, about 110.4 mg, about 110.5 mg, about 110.6 mg, about 110.7 mg, about 110.8 mg, about 110.9 mg, about 111 mg, about 111.1 mg, about 111.2 mg, about 111.3 mg, about 111.4 mg, about 111.5 mg, about 111.6 mg, about 111.7 mg, about 111.8 mg, about 111.9 mg, about 112 mg, about 112.1 mg, about 112.2 mg, about 112.3 mg, about 112.4 mg, about 112.5 mg, about 112.6 mg, about 112.7 mg, about 112.8 mg, about 112.9 mg, about 113 mg, about 113.1 mg, about 113.2 mg, about 113.3 mg, about 113.4 mg, about 113.5 mg, about 113.6 mg, about 113.7 mg, about 113.8 mg, about 113.9 mg, about 114 mg, about 114.1 mg, about 114.2 mg, about 114.3 mg, about 114.4 mg, about 114.5 mg, about 114.6 mg, about 114.7 mg, about 114.8 mg, about 114.9 mg, about 115 mg, about 115.1 mg, about 115.2 mg, about 115.3 mg, about 115.4 mg, about 115.5 mg, about 115.6 mg, about 115.7 mg, about 115.8 mg, about 115.9 mg, about 116 mg, about 116.1 mg, about 116.2 mg, about 116.3 mg, about 116.4 mg, about 116.5 mg, about 116.6 mg, about 116.7 mg, about 116.8 mg, about 116.9 mg, about 117 mg, about 117.1 mg, about 117.2 mg, about 117.3 mg, about 117.4 mg, about 117.5 mg, about 117.6 mg, about 117.7 mg, about 117.8 mg, about 117.9 mg, about 118 mg, about 118.1 mg, about 118.2 mg, about 118.3 mg, about 118.4 mg, about 118.5 mg, about 118.6 mg, about 118.7 mg, about 118.8 mg, about 118.9 mg, about 119 mg, about 119.1 mg, about 119.2 mg, about 119.3 mg, about 119.4 mg, about 119.5 mg, about 119.6 mg, about 119.7 mg, about 119.8 mg, about 119.9 mg, about 120 mg, about 120.1 mg, about 120.2 mg, about 120.3 mg, about 120.4 mg, about 120.5 mg, about 120.6 mg, about 120.7 mg, about 120.8 mg, about 120.9 mg, about 121 mg, about 121.1 mg, about 121.2 mg, about 121.3 mg, about 121.4 mg, about 121.5 mg, about 121.6 mg, about 121.7 mg, about 121.8 mg, about 121.9 mg, about 122 mg, about 122.1 mg, about 122.2 mg, about 122.3 mg, about 122.4 mg, about 122.5 mg, about 122.6 mg, about 122.7 mg, about 122.8 mg, about 122.9 mg, about 123 mg, about 123.1 mg, about 123.2 mg, about 123.3 mg, about 123.4 mg, about 123.5 mg, about 123.6 mg, about 123.7 mg, about 123.8 mg, about 123.9 mg, about 124 mg, about 124.1 mg, about 124.2 mg, about 124.3 mg, about 124.4 mg, about 124.5 mg, about 124.6 mg, about 124.7 mg, about 124.8 mg, about 124.9 mg and 125 mg.
[0409] In some embodiments, the therapeutically effective amount is any of the following: 10 mg to 200 mg, 10 mg to 190 mg, 10 mg to 180 mg, 10 mg to 170 mg, 10 mg to 160 mg, 10 mg to 150 mg, 10 mg to 140 mg, 10 mg to 120 mg, 10 mg to 110 mg, 10 mg to 100 mg, 10 mg to 80 mg, 10 mg to 70 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, 10 mg to 20 mg, 20 mg to 200 mg, 20 mg to 190 mg, 20 mg to 180 mg, 20 mg to 170 mg, 20 mg to 160 mg, 20 mg to 150 mg, 20 mg to 140 mg, 20 mg to 120 mg, 20 mg to 110 mg, 20 mg to 100 mg, 20 mg to 80 mg, 20 mg to 70 mg, 20 mg to 60 mg, 20 mg to 50 mg, 20 mg to 10 mg, 20 mg to 30 mg, 30 mg to 200 mg, 30 mg to 190 mg, 30 mg to 180 mg, 30 mg to 170 mg, 30 mg to 160 mg, 30 mg to 150 mg, 30 mg to 140 mg, 30 mg to 120 mg, 30 mg to 110 mg, 30 mg to 100 mg, 30 mg to 80 mg, 30 mg to 70 mg, 30 mg to 60 mg, 30 mg to 50 mg, 30 mg to 20 mg, 40 mg to 200 mg, 40 mg to 190 mg, 40 mg to 180 mg, 40 mg to 170 mg, 40 mg to 160 mg, 40 mg to 150 mg, 40 mg to 140 mg, 40 mg to 120 mg, 40 mg to 110 mg, 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 200 mg, 50 mg to 190 mg, 50 mg to 180 mg, 50 mg to 170 mg, 50 mg to 160 mg, 50 mg to 150 mg, 50 mg to 140 mg, 50 mg to 120 mg, 50 mg to 110 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 200 mg, 60 mg to 190 mg, 60 mg to 180 mg, 60 mg to 170 mg, 60 mg to 160 mg, 60 mg to 150 mg, 60 mg to 140 mg, 60 mg to 120 mg, 60 mg to 115 mg, 60 mg to 110 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 200 mg, 70 mg to 190 mg, 70 mg to 180 mg,70 mg to 170 mg, 70 mg to 160 mg, 70 mg to 150 mg, 70 mg to 140 mg, 70 mg to 120 mg, 70 mg to 110 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 200 mg, 80 mg to 190 mg, 80 mg to 180 mg, 80 mg to 170 mg, 80 mg to 160 mg, 80 mg to 150 mg, 80 mg to 140 mg, 80 mg to 120 mg, 80 mg to 110 mg, 80 mg to 100 mg, 80 mg to 90 mg, 90 mg to 200 mg, 90 mg to 190 mg, 90 mg to 180 mg, 90 mg to 170 mg, 90 mg to 160 mg, 90 mg to 150 mg, 90 mg to 140 mg, 90 mg to 120 mg, 90 mg to 110 mg, 90 mg to 100 mg, 100 mg to 200 mg, 100 mg to 190 mg, 100 mg to 180 mg, 100 mg to 170 mg, 100 mg to 160 mg, 100 mg to 150 mg, 100 mg to 140 mg, 100 mg to 120 mg, 100 mg to 110 mg, 110 mg to 200 mg, 110 mg to 190 mg, 110 mg to 180 mg, 110 mg to 170 mg, 110 mg to 160 mg, 110 mg to 150 mg, 110 mg to 140 mg, 110 mg to 130 mg, 110 mg to 120 mg, 120 mg to 200 mg, 120 mg to 190 mg, 120 mg to 180 mg, 120 mg to 170 mg, 120 mg to 160 mg, 120 mg to 150 mg, 120 mg to 140 mg, 120 mg to 130 mg, 130 mg to 200 mg, 130 mg to 190 mg, 130 mg to 180 mg, 130 mg to 170 mg, 130 mg to 160 mg, 130 mg to 150 mg, 130 mg to 140 mg, 140 mg to 200 mg, 140 mg to 190 mg, 140 mg to 180 mg, 140 mg to 170 mg, 140 mg to 160 mg, 140 mg to 150 mg, 150 mg to 200 mg, 150 mg to 190 mg, 150 mg to 180 mg, 150 mg to 170 mg, 150 mg to 160 mg, 160 mg to 200 mg, 160 mg to 190 mg, 160 mg to 180 mg, 160 mg to 170 mg, 180 mg to 200 mg, 180 mg to 190 mg, 190 mg to 200 mg, 105 mg to 135 mg, 105 mg to 130 mg, 105 mg to 125 mg, 105 mg to 120 mg, 110 mg to 135 mg, 110 mg to 130 mg110 mg to 125 mg, 110 mg to 120 mg, 115 mg to 135 mg, 115 mg to 130 mg, 115 mg to 125 mg, 115 mg to 120 mg, 115 mg to 125 mg, 115 mg to 120 mg, 120 mg to 135 mg, 120 mg to 125 mg, 125 mg to 140 mg, 125 mg to 130 mg, 130 mg to 135 mg, 135 mg to 140 mg, 120 mg to 129 mg, 120 mg to 128 mg, 120 mg to 127 mg, 120 mg to 86 mg, 120 mg to 124 mg, 120 mg to 123 mg, 120 mg to 122 mg, 120 mg to 121 mg, 121 mg to 130 mg, 122 mg to 129 mg, 122 mg to 128 mg, 122 mg to 127 mg, 122 mg to 126 mg, 122 mg to 125 mg, 122 mg to 124 mg, 122 mg to 123 mg, 123 mg to 130 mg, 123 mg to 129 mg, 123 mg to 128 mg, 123 mg to 127 mg, 123 mg to 126 mg, 123 mg to 125 mg, 123 mg to 124 mg, 124 mg to 130 mg, 124 mg to 129 mg, 124 mg to 128 mg, 124 mg to 127 mg, 124 mg to 126 mg, 124 mg to 125 mg, 125 mg to 129 mg, 125 mg to 128 mg, 125 mg to 127 mg, 125 mg to 126 mg, 126 mg to 130 mg, 126 mg to 129 mg, 126 mg to 128 mg, 126 mg to 127 mg, 127 mg to 130 mg, 127 mg to 129 mg, 127 mg to 128 mg, 128 mg to 130 mg, 128 mg to 129 mg, and 129 mg to 130 mg.
[0410] In certain embodiments, a therapeutically effective amount is any of the following: less than 350 mg, less than 345 mg, less than 340 mg, less than 335 mg, less than 330 mg, less than 325 mg, less than 320 mg, less than 315 mg, less than 310 mg, less than 305 mg, less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg, less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.
[0411] In certain embodiments, a therapeutically effective amount is any of the following: less than about 350 mg, less than about 345 mg, less than about 340 mg, less than about 335 mg, less than about 330 mg, less than about 325 mg, less than about 320 mg, less than about 315 mg, less than about 310 mg, less than about 305 mg, less than about 300 mg, less than about 295 mg, less than about 290 mg, less than about 285 mg, less than about 280 mg, less than about 275 mg, less than about 270 mg, less than about 265 mg, less than about 260 mg, less than about 255 mg, less than about 250 mg, less than about 245 mg, less than about 240 mg, less than about 235 mg, less than about 230 mg, less than about 225 mg, less than about 220 mg, less than about 215 mg, less than about 210 mg, less than about 205 mg, less than about 200 mg, less than about 195 mg, less than about 190 mg, less than about 185 mg, less than about 180 mg, less than about 175 mg, less than about 170 mg, less than about 165 mg, less than about 160 mg, less than about 150 mg, less than about 145 mg, less than about 140 mg, less than about 135 mg, less than about 130 mg, less than about 125 mg, less than about 120 mg, less than about 115 mg, less than about 110 mg, less than about 105 mg, less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, less than about 40 mg, less than about 35 mg, less than about 30 mg, less than about 25 mg, less than about 20 mg, less than about 15 mg, less than about 10 mg, and less than about 5 mg.
[0412] In certain embodiments, a therapeutically effective amount is any of the following: at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, at least 150 mg, at least 155 mg, at least 160 mg, at least 165 mg, at least 170 mg, at least 175 mg, at least 180 mg, at least 185, at least 190 mg, at least 195 mg, and at least 200 mg.
[0413] In certain embodiments, a therapeutically effective amount is any of the following: at least about 5 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, or at least about 150 mg, at least about 155 mg, at least about 160 mg, at least about 165 mg, at least about 170 mg, at least about 175 mg, at least about 180 mg, at least about 185, at least about 190 mg, at least about 195 mg, and at least about 200 mg.
[0414] V. Certain dosing regimens
[0415] In certain embodiments, methods are described herein of administering a therapeutically effective amount of compound 696844 to a subject one or more times. In certain embodiments, the method comprises administering a therapeutically effective amount at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 50, 61, 62, 63, 64, 65, 66, 67, 68, 69 or 70 times. In certain embodiments, the method comprises administering a therapeutically effective amount once a week. In certain embodiments, the method comprises administering a therapeutically effective amount once every 2 weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every 3 weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every 4 weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every 8 weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every 12 weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every 16 weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every 20 weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every 24 weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every 6 months. In certain embodiments, the method comprises administering a therapeutically effective amount monthly. In certain embodiments, the method comprises administering a therapeutically effective amount once every two months. In certain embodiments, the method comprises administering a therapeutically effective amount once every three months. In certain embodiments, the method comprises administering a therapeutically effective amount quarterly. In certain embodiments, the method comprises administering a therapeutically effective amount semi-annually. In certain embodiments, the method comprises administering a therapeutically effective amount annually. In certain embodiments, the method comprises administering a therapeutically effective amount once every two years.
[0416] In certain embodiments, the method comprises administering a therapeutically effective amount about once every 1 week, about once every 2 weeks, about once every 3 weeks, about once every 4 weeks, about once every 5 weeks, about once every 6 weeks, about once every 7 weeks, about once every 8 weeks, about once every 9 weeks, about once every 10 weeks, about once every 11 weeks, about once every 12 weeks, about once every 13 weeks, about once every 14 weeks, about once every 15 weeks, about once every 16 weeks, about once every 17 weeks, about once every 18 weeks, about once every 19 weeks, about once every 20 weeks, about once every 21 weeks, about once every 22 weeks, about once every 23 weeks, about once every 24 weeks, or about once every 6 months. In certain embodiments, the method comprises administering a therapeutically effective amount about once a month. In certain embodiments, the method comprises administering a therapeutically effective amount about once every two months. In certain embodiments, the method comprises administering a therapeutically effective amount about once every three months. In certain embodiments, the method comprises administering a therapeutically effective amount about once a quarter. In certain embodiments, the method comprises administering a therapeutically effective amount about once every six months. In certain embodiments, the method comprises administering a therapeutically effective amount about once a year. In certain embodiments, the method comprises administering a therapeutically effective amount about once every two years.
[0417] In some embodiments, the method comprises administering a therapeutically effective amount at a therapeutically effective frequency that is maintained for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months.
[0418] Loading dose and maintenance dose
[0419] In certain embodiments, the therapeutically effective amount is administered as a loading dose and / or a maintenance dose. In certain embodiments, the loading dose is a dose level different from the maintenance dose. In certain embodiments, the loading dose is a higher dose level than the maintenance dose. In certain embodiments, the loading dose and the maintenance dose are at the same dose level. In certain embodiments, the method comprises administering one or more loading doses and subsequently administering one or more maintenance doses. In certain embodiments, the method comprises administering a loading dose about once every 4 weeks and subsequently administering a maintenance dose about once every 4 weeks, about once every 8 weeks, about once every 12 weeks, about once every 16 weeks, about once every 20 weeks, about once every 24 weeks, or about once every 6 months. In certain embodiments, the method comprises administering a loading dose about once every 4 weeks and subsequently administering a maintenance dose about once every 6 months. In certain embodiments, the method comprises administering a loading dose about once every 12 weeks and subsequently administering a maintenance dose about once every 6 months.
[0420] In certain embodiments, the method comprises administering at least 2 loading doses, at least 3 loading doses, at least 4 loading doses, at least 5 loading doses, or at least 6 loading doses. In certain embodiments, the method comprises administering 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 loading doses. In certain embodiments, the method comprises administering one or more loading doses approximately every 1 week, approximately every 2 weeks, approximately every 3 weeks, approximately every 4 weeks, approximately every 5 weeks, approximately every 6 weeks, approximately every 7 weeks, approximately every 8 weeks, approximately every 9 weeks, approximately every 10 weeks, approximately every 11 weeks, or approximately every 12 weeks. In certain embodiments, the method comprises administering an initial loading dose, and a second loading dose approximately 1 week, approximately 2 weeks, approximately 3 weeks, approximately 4 weeks, approximately 5 weeks, approximately 6 weeks, approximately 7 weeks, approximately 8 weeks, approximately 9 weeks, approximately 10 weeks, approximately 11 weeks, or approximately 12 weeks after administering the initial loading dose.
[0421] In certain embodiments, the method comprises administering at least 2 maintenance doses, at least 3 maintenance doses, at least 4 maintenance doses, at least 5 maintenance doses, or at least 6 maintenance doses. In certain embodiments, the method comprises administering 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 maintenance doses. In some cases, the method comprises administering one or more maintenance doses approximately every 4 weeks, approximately every 5 weeks, approximately every 6 weeks, approximately every 7 weeks, approximately every 8 weeks, approximately every 9 weeks, approximately every 10 weeks, approximately every 11 weeks, approximately every 12 weeks, approximately every 13 weeks, approximately every 14 weeks, approximately every 15 weeks, approximately every 16 weeks, approximately every 17 weeks, approximately every 18 weeks, approximately every 19 weeks, approximately every 20 weeks, approximately every 21 weeks, approximately every 22 weeks, approximately every 23 weeks, approximately every 24 weeks, or approximately every 6 months. In certain embodiments, the method comprises administering a first maintenance dose, and a second maintenance dose approximately 4 weeks, approximately 5 weeks, approximately 6 weeks, approximately 7 weeks, approximately 8 weeks, approximately 9 weeks, approximately 10 weeks, approximately 11 weeks, approximately 12 weeks, approximately 13 weeks, approximately 14 weeks, approximately 15 weeks, approximately 16 weeks, approximately 17 weeks, approximately 18 weeks, approximately 19 weeks, approximately 20 weeks, approximately 21 weeks, approximately 22 weeks, approximately 23 weeks, approximately 24 weeks, or approximately 6 months after administering the first maintenance dose.
[0422] In certain embodiments, the method comprises administering one or more first maintenance doses approximately 1 week, approximately 2 weeks, approximately 3 weeks, approximately 4 weeks, approximately 5 weeks, approximately 6 weeks, approximately 7 weeks, approximately 8 weeks, approximately 9 weeks, approximately 10 weeks, approximately 11 weeks, approximately 12 weeks, approximately 13 weeks, approximately 14 weeks, approximately 15 weeks, approximately 16 weeks, approximately 17 weeks, approximately 18 weeks, approximately 19 weeks, approximately 20 weeks, approximately 21 weeks, approximately 22 weeks, approximately 23 weeks, or approximately 24 weeks after administering the last loading dose.
[0423] VI. Potency and efficacy
[0424] In certain embodiments, methods are described herein for reducing CFB RNA and / or CFB protein in the cells or biological fluids of a human subject, wherein the method comprises administering to the subject a therapeutically effective amount of compound 696844. In certain embodiments, the method reduces CFB RNA and / or CFB protein in the serum or plasma of a human subject. The reduction of CFB RNA and / or CFB protein can be determined, for example, by detecting / quantifying a first amount of CFB RNA or CFB protein in a first biological sample obtained before administration, and detecting / quantifying a second amount of CFB RNA or CFB protein in a second biological sample obtained after administration, and detecting or quantifying the reduction of CFB RNA or CFB protein by comparing the first amount with the second amount.
[0425] In certain embodiments, the method comprises reducing CFB RNA and / or CFB protein by 1% - 100%, or a range defined by any two of these values. In certain embodiments, the method comprises reducing CFB RNA and / or CFB protein by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
[0426] In certain embodiments, the method comprises reducing CFB RNA or CFB protein by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95%.
[0427] In certain embodiments, the method comprises reducing CFB RNA or CFB protein by about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95% or about 95% to 100%.
[0428] In certain embodiments, the method comprises administering compound 696844 to a subject and detecting or quantifying the amount of CFB RNA or CFB protein in a cell or biological fluid of the subject. In certain embodiments, the method comprises detecting / quantifying a first amount of CFB RNA or CFB protein in a first biological sample obtained prior to administration and detecting / quantifying a second amount of CFB RNA or CFB protein in a second biological sample obtained after administration, and detecting or quantifying the reduction of CFB RNA or CFB protein by comparing the first amount with the second amount. In certain embodiments, the second biological sample is obtained less than about 24 hours after administration. In certain embodiments, the second biological sample is obtained less than about 1 week after administration. In certain embodiments, the second biological sample is obtained about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks or about 18 weeks after administration. In certain embodiments, the method comprises increasing or decreasing the dose after comparing the first amount with the second amount. In certain embodiments, the method comprises administering more frequently or less frequently after comparing the first amount with the second amount. In certain embodiments, the biological sample is plasma. In certain embodiments, the biological fluid is serum.
[0429] VII. Overview of diseases and disorders associated with dysregulation of the complement alternative pathway
[0430] Certain embodiments provided herein relate to methods of treating, preventing or ameliorating a disease or disorder associated with a dysregulation of the complement alternative pathway in a subject by administering a therapeutically effective amount of compound 696844.
[0431] Studies have shown that the kidney and eye share developmental pathways and structural features, including the composition of basement membrane collagen IV protomers and vascular distribution (Savige et al., J Am Soc Nephrol. (2011) 22(8):1403-15). Hereditary deficiencies in complement regulatory proteins lead to susceptibility to atypical hemolytic uremic syndrome and AMD (Richards A et al., Adv Immunol. (2007) 96:141-77). In addition, chronic kidney disease has been associated with AMD (Nitsch, D. et al., Ophthalmic Epidemiol. (2009) 16(3):181-6; Choi, J. et al., Ophthalmic Epidemiol. (2011) 18(6):259-63). Dense deposit disease (DDD) is a kidney disease associated with dysregulated alternative complement pathway, characterized by acute nephritic syndrome and ocular drusen (Martín B, Smith RJH, C3 Glomerulopathy. July 20, 2007 [updated April 5, 2018]. In: Adam MP, Everman DB, Mirzaa GM, et al. editors. [Internet]. Seattle(WA): University of Washington, Seattle; 1993-2022; ncbi.nlm.nih.gov / books / NBK1425 / Cruz and Smith, GeneReviews (2007) July 20). In addition, mice carrying deletions in genes encoding components of the alternative complement pathway have co-existing kidney and eye disease phenotypes. CFH homozygous null mice have been reported to develop DDD and exhibit retinal abnormalities and visual dysfunction (Pickering et al., Nat Genet. (2002) 31(4):424-8). Mouse models of kidney disease associated with dysregulation of the alternative complement pathway have also been accepted as models of AMD (Pennesi ME et al., Mol Aspects Med (2012) 33:487-509). For example, CFH knockout mice are an accepted model of kidney diseases such as DDD and AMD. In addition, AMD has been reported to be associated with systemic sources of complement factors that accumulate locally within the eye, driving alternative complement pathway activation (Loyet et al., Invest OphthalmolVis Sci. (2012) 53(10):6628-37).
[0432] Certain embodiments provided herein relate to methods of treating, preventing, or ameliorating an ocular disease or disorder associated with dysregulation of the complement alternative pathway in a subject by administering a CFB-specific inhibitor, such as an antisense compound targeting CFB. In certain aspects, the ocular disease or disorder is macular degeneration, age-related macular degeneration (AMD) (including wet AMD, intermediate AMD, and dry AMD), including geographic atrophy; neuromyelitis optica; corneal diseases, such as corneal inflammation; autoimmune uveitis; or diabetic retinopathy; or a combination thereof. In certain embodiments, the antisense compound is Compound 696844.
[0433] Certain embodiments provided herein relate to methods of treating, preventing, or ameliorating a kidney disease or disorder associated with dysregulation of the complement alternative pathway in a subject by administering a CFB-specific inhibitor, such as an antisense compound targeting CFB. In certain aspects, the kidney disease or disorder is C3 glomerulopathy; atypical hemolytic uremic syndrome (aHUS); dense deposit disease (DDD, also known as MPGN type II or C3Neph), CFHR5 nephropathy; IgA nephropathy (IgAN); mesangiocapillary (membranoproliferative) glomerulonephritis (MPGN); autoimmune disorders, including lupus nephritis and systemic lupus erythematosus (SLE); dense deposit disease (DDD); glomerulonephritis caused by infection (also known as post-infectious glomerulonephritis); C3 glomerulonephritis (C3GN); CFHR5 nephropathy; atypical hemolytic uremic syndrome (aHUS); renal ischemia-reperfusion injury, such as post-transplant renal ischemia-reperfusion injury, or a combination thereof. In certain embodiments, the antisense compound is Compound 696844.
[0434] Certain embodiments provided herein relate to methods of treating, preventing, or ameliorating a disease or disorder associated with dysregulation of the complement alternative pathway in a subject by administering a CFB-specific inhibitor, such as an antisense compound targeting CFB. In certain aspects, the disease or disorder is ANCA-associated vasculitis, antiphospholipid syndrome (also known as antiphospholipid antibody syndrome (APS)), asthma, rheumatoid arthritis, myasthenia gravis, multiple sclerosis, preeclampsia, or a metabolic disorder (such as non-alcoholic steatohepatitis (NASH)). In certain embodiments, the antisense compound is Compound 696844.
[0435] Age-related macular degeneration
[0436] Age-related macular degeneration (AMD) is a progressive macular disease and the leading cause of central vision impairment in people over 50 years old in developed countries (Ratnapriya and Chew 2013, Clinical Genet. 2: 160-166). The disease is characterized by a gradual loss of central vision, distortion of images and straight lines, and the presence of blurred and dark areas in central vision (Cascella et al. 2014, Ophthalmol. 582842). AMD is associated with dysregulation of the complement alternative pathway. Complement components are common components of drusen (extracellular material that accumulates in the macula of AMD patients) in the choroid of the eye. In addition, CFH and CFB variants are reported to account for nearly 75% of AMD cases in Northern Europe and North America. Studies have also found that specific CFB polymorphisms protect against AMD (Patel, N. et al., Eye (2008) 22(6): 768-76). In addition, CFB homozygous null mice have lower complement pathway activity, exhibit smaller eye lesions, and develop choroidal neovascularization (CNV) after laser photocoagulation (Rohrer, B. et al., Invest Ophthalmol Vis Sci. (2009) 50(7): 3056-64). Administration of siRNA targeting CFB protects mice from laser-induced CNV (Bora, NS et al., J Immunol. (2006) 177(3): 1872-8). Administration of single-stranded antisense oligonucleotides reduces CFB levels in the eyes and plasma of C57BL / 6 mice, reduces CFB RNA and plasma C3 levels in CFH + / - mice, and reduces plasma levels of CFB and CFB RNA in cynomolgus monkeys (WO 2015 / 168635).
[0437] The underlying pathophysiological drivers of AMD are complex and the symptoms present in multiple related but distinct forms. In the early and intermediate stages of AMD, the disease is characterized by the deposition of extracellular deposits rich in drusen, proteins, and lipids between the retinal pigment epithelium (RPE) cells and Bruch's membrane (Bird et al. 1995, Ophthalmol 39:367-374; van Lookeren Campagne et al. 2014, J Pathol 232:151-164). As part of the natural course of the disease, there are areas of atrophy that develop, expand, and correspond to absolute scotomas / geographic atrophy (Lindblad et al. 2009, Arch Ophthalmol 127:1168-1174; Grunwald et al. 2017, Ophthalmology 124:97-104). The areas of geographic atrophy associated with late AMD correspond to regions of the retina where visual function is impaired due to photoreceptor and RPE cell atrophy (Klein et al. 1991, 98:1128-1134; Sunness et al. 2007, Ophthalmology 114:271-277; Schmitz-Valckenberg et al. 2016, Ophthalmology 123:361-368).
[0438] The complement system is an important part of innate immunity and is the most widely accepted pathogenic pathway of the immune system associated with AMD. Genome-wide association studies (GWAS) and rare variant analyses have shown that the alternative pathway (AP) of complement is overactive in AMD (Kijlstra et al., 2005, Ocul Immunol Inflamm 13:3-11; Donoso et al., 2006, Surv Ophthalmol 51:137-152; Anderson et al., 2010, Prog Retin Eye Res 29:95-112; Whitmore et al., 2015, Prog Retin Eye Res 45:1-29; Cao et al., 2016, Br J Ophthalmol 100:713-718; Geerlings et al., 2017, Mol Immunol 84:65-76). Specific polymorphisms of complement factor H (CFH), a negative regulator of AP, increase the risk of developing AMD (Donoso et al., 2010, Surv Ophthalmol 55:227-246; Heurich et al., 2011, Proc Natl Acad Sci US A 108:8761-8766). In contrast, specific polymorphisms of factor B, a positive regulator, protect against AMD (Gold et al., 2006, Nat Genet 38:458-462; Montes et al., 2009, Proc Natl Acad Sci U S A 106:4366-4371; Heurich et al., 2011; Mantel et al., 2014, Ophthalmic Genetics 35:12-17).
[0439] CFB is mainly synthesized by the liver (Koskimies et al., Complement Inflamm 1991; 8:257-260; Morgan and Gasque Clin Exp Immunol 1997; 107:1-7.; Marsh et al. Atherosclerosis 2002; 162:227-244), and is present at very low levels in several extrahepatic sites (Whaley J Exp Med 1980; 151:501-516; Ripoche et al. J Exp Med 1988; 168:1917-1922; Strunk et al. J Clin Invest 1988; 81:1419-1426; Matsumoto et al. Proc Natl Acad Sci U S A 1997; 94:8720-8725). Ocular CFB is mainly located in the choroidal capillaries and Bruch's membrane regions and is not apparent in the neural retina (Loyet et al. Invest Ophthalmol Vis Sci 2012; 53:6628-6637). Thus, choroidal CFB appears to be of systemic origin. Plasma concentrations of complement alternative pathway activation products were found to be significantly elevated in AMD patients compared to controls (Scholl et al. PLoS One 2008; 3:e2593; Reynolds et al. Invest Ophthalmol Vis Sci 2009; 50:5818-5827; Loyet et al. 2012; Paun et al. Sci Rep 2016; 6:26568; PLoS One 2016; 11:e0144367). This suggests continuous systemic activation of the complement alternative pathway in AMD pathogenesis and further demonstrates that AMD is a systemic disease with local disease manifestations in the aging macula (Smailhodzic et al. 2012, Ophthalmology 119:339-346; Br J Ophthalmol 2016; 100:713-718).
[0440] IgA nephropathy
[0441] IgA nephropathy (IgAN) is the most common primary chronic glomerulonephritis worldwide and is an important cause of chronic kidney failure (Maillard et al. 2015, J Am Soc Nephrol 26:1503-1512). IgAN is characterized by dominant or codominant IgA immune deposits in the mesangium of the kidney glomeruli, leading to inflammation and tissue damage (Maillard et al. 2015). Although IgAN can occur at any age, it generally presents in the second or third decade of life. The clinical manifestations, disease progression, and histological findings in affected individuals vary widely.
[0442] IgAN is characterized by microscopic and / or gross hematuria sometimes in the context of an acute illness such as a respiratory infection or gastroenteritis. Over time, affected individuals may develop proteinuria and hypertension. Up to 40% of affected individuals experience a gradual decline in renal function, developing end-stage kidney disease (ESKD) up to 20 years from the date of their diagnostic kidney biopsy (Maillard et al. 2015). Patients with ESKD require dialysis or kidney transplantation, and ESKD is associated with a significant risk of premature death and reduced quality of life, comparable to that of certain cancers and heart diseases (Chen et al. 2016, Blood Purif. 41(1-3):218-24).
[0443] IgAN is roughly divided into primary or secondary (i.e., associated with a systemic disease) (Rizk et al. 2019, Frontiers Immunol 10:504). IgAN can present without extrarenal involvement or as part of a systemic vasculitis phenotype, currently called IgA vasculitis with nephritis (previously called Henoch purpura nephritis). IgAN can be diagnosed by kidney biopsy. The hallmark of IgA nephropathy is the deposition of IgA in the glomerular mesangium. Renal biopsy samples from 90% of IgAN patients also contain C3 that is distributed identically to the IgA deposits (Maillard et al. 2015). Plasma C3 levels are usually within the normal range; although complement activation products may be elevated in plasma, supporting the role of the alternative pathway in IgAN. In kidney biopsies, in addition to IgA deposits, there are glomerular deposits caused by the overactivity of the alternative pathway (C3 and properdin), the lectin pathway (C4d), and the terminal products of the complement cascade (membrane attack complex C5b-9C) (Wyatt and Julian 2013, N Engl J Med 368:2402-2414). Deposition of C1q is not usually observed (Wyatt and Julian 2013). Thus, the data support a role for both the complement alternative and lectin complement pathways in triggering IgAN kidney injury.
[0444] CFB circulates in the blood as a zymogen and is a key protease in the alternative pathway (AP) of complement. CFB associates with C3 in the fluid phase via continuous generation or spontaneous hydrolysis of C3 or "tick-over", or with complement protein C3b (C3b) (the activated form of C3) attached to a target; it is cleaved by factor D into Ba, and Bb causes activation of CFB (Maillard et al. 2015). This causes the formation of C3Bb or amplification of the C3 convertase (C3bBb), which in turn triggers the amplification loop of the AP. As a result, C3b molecules attach to the target surface, activating the terminal complement cascade and causing the formation of C5b-9 (Maillard et al. 2015; Thurman 2017, Nephrol Dial Transplant 32:i57-i64). The C5b-9 membrane attack complex creates pores in the cell membrane, leading to calcium influx, cell activation, and glomerular damage. Notably, deposition of the membrane attack complex has been observed in renal biopsies of individuals with IgAN (Maillard et al. 2015). Reduction of CFB may reduce the formation of complement protein C3a (C3a), complement factor C5a (C5a), and the membrane attack complex, and thus may mitigate the inflammatory damage to the kidney.
[0445] In certain embodiments, provided herein are methods for ameliorating IgA nephropathy and / or delaying the progression of renal failure associated with primary IgA nephropathy by systemic administration of compound 696844. Compound 696844 targets CFB messenger ribonucleic acid (mRNA) in the liver and reduces plasma FB levels. Reduction of plasma CFB (an important component of the AP) attenuates the overactivation of the AP that leads to the pathology of primary IgA nephropathy. As shown in Example 2, reduction of plasma CFB levels in subjects with IgAN attenuates the overactivation of the AP, thereby reducing proteinuria. Administration of single-stranded antisense oligonucleotides reduces CFB levels in the plasma of C57BL / 6 mice, CFB RNA and plasma C3 levels in CFH+ / - mice, reduces renal C3 accumulation in a murine lupus model, and reduces plasma levels of CFB and CFB RNA in cynomolgus monkeys (WO 2015 / 168635).
[0446] VIII. Assessing the efficacy of compound 696844
[0447] Reduction in plasma CFB
[0448] In certain embodiments, the methods described herein are sufficient to effectively reduce the level of plasma CFB in a subject. In certain embodiments, the methods described herein are sufficient to effectively reduce the level of plasma CFB in a subject, as assessed by the percent reduction in plasma CFB between one time point and a later time point after administration of compound 696844. In some embodiments, the percent reduction in the level of plasma CFB is assessed by comparing the level of plasma CFB measured before the first administration of compound 696844 (baseline) with the level of plasma CFB measured at a time point after administration of one or more doses of compound 696844. In certain embodiments, the percent reduction is calculated as the percent reduction in the level of plasma CFB at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of compound 696844 relative to the baseline 24-hour protein excretion. In certain embodiments, the percent reduction is calculated as the percent reduction in the level of plasma CFB between one time point after administration of one or more doses of compound 696844 and a second time point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after that first time point. In certain embodiments, the level of CFB can be determined by radial immunodiffusion assay, ELISA assay, or by turbidimetry.
[0449] Reduction in serum AH50 activity
[0450] In certain embodiments, the methods described herein are sufficient to effectively reduce the serum AH50 activity of a subject. In certain embodiments, the methods described herein are sufficient to effectively reduce the serum AH50 activity of a subject, as assessed by the percent reduction in serum AH50 activity between one time point and a later time point after administration of compound 696844. In some embodiments, the percent reduction in serum AH50 activity is assessed by comparing the level of serum AH50 activity measured prior to the first administration of compound 696844 (baseline) with the level of serum AH50 activity measured at a time point after administration of one or more doses of compound 696844. In certain embodiments, the percent reduction is calculated as the percent reduction in serum AH50 activity relative to the baseline serum AH50 activity at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of compound 696844. In certain embodiments, the percent reduction is calculated as the percent reduction in serum AH50 activity between one time point after administration of one or more doses of compound 696844 and a second time point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after that first time point. In certain embodiments, AH50 activity can be determined by using a hemolysis assay (AH50 hemolysis). In some embodiments, AH50 activity can be determined by using the WIESLAB complement system alternative pathway assay (SVAR LIFE SCIENCE) (AH50 WAP).
[0451] Reduction in urinary protein excretion
[0452] In certain embodiments, the methods described herein are sufficient to effectively reduce the urinary protein excretion (proteinuria) in a subject. In certain embodiments, the methods described herein are sufficient to effectively reduce the urinary protein excretion in a subject, as assessed by the percent reduction in 24-hour urinary protein excretion between one time point after administration of Compound 696844 and a later time point. In some embodiments, the percent reduction in 24-hour protein excretion is assessed by comparing the 24-hour protein excretion measured before the first administration of Compound 696844 (baseline) with the 24-hour urinary protein excretion measured at a time point after administration of one or more doses of Compound 696844. In certain embodiments, the percent reduction is calculated as the percent reduction in 24-hour protein excretion at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of Compound 696844 relative to the baseline 24-hour protein excretion. In certain embodiments, the percent reduction is calculated as the percent reduction in 24-hour protein excretion between one time point after administration of one or more doses of Compound 696844 and a second time point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after that first time point.
[0453] In certain embodiments, the methods described herein are sufficient to reduce the urinary protein excretion in a subject, as assessed by the absolute reduction in urinary protein excretion between baseline and a time point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after administration of one or more doses of Compound 696844. In certain embodiments, the methods described herein are sufficient to reduce the albumin excretion in a subject, as assessed by the absolute reduction in albuminuria ("urinary albumin / creatinine" or "UAC ratio") between baseline and a time point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after administration of one or more doses of Compound 696844. In certain embodiments, the methods described herein are sufficient to reduce the protein excretion in a subject, as assessed by the absolute reduction in proteinuria (UPC ratio) between baseline and a time point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after administration of one or more doses of Compound 696844.
[0454] In certain embodiments, the methods described herein are sufficient to reduce the urinary protein excretion in a subject, as assessed by the absolute reduction in urinary protein excretion between a time point after administration of one or more doses of Compound 696844 and a second time point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first time point. In certain embodiments, the methods described herein are sufficient to reduce the albumin excretion in a subject, as assessed by the absolute reduction in albuminuria (UAC ratio) between a time point after administration of one or more doses of Compound 696844 and a second time point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first time point.
[0455] In some embodiments, urinary protein excretion can be measured in a single sample (spot sample), such as a first void or first morning urine sample, or in aliquots of a collection of multiple samples (e.g., from a 24-hour collection). Urinary protein excretion can be measured as urinary protein ((grams per day)2 (g / day) 2 ) and by the urinary protein to creatinine ratio (UPCr) 2 .
[0456] Reduction in serum CH50 activity
[0457] In certain embodiments, the methods described herein are sufficient to effectively reduce serum CH50 activity in a subject. In certain embodiments, the methods described herein are sufficient to effectively reduce serum CH50 activity in a subject, as assessed by the percent reduction or absolute reduction in serum CH50 activity between one time point and a later time point after administration of compound 696844. In some embodiments, the percent reduction in serum CH50 activity is assessed by comparing the level of serum CH50 activity measured prior to the first administration of compound 696844 (baseline) with the level of serum CH50 activity measured at a time point after administration of one or more doses of compound 696844. In certain embodiments, the percent reduction is calculated as the percent reduction or absolute reduction in serum CH50 activity relative to the serum CH50 activity baseline at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of compound 696844. In certain embodiments, the percent reduction or absolute reduction is calculated as the percent reduction or absolute reduction in serum CH50 activity between one time point after administration of one or more doses of compound 696844 and a second time point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after that first time point. In some embodiments, the level of CH50 activity can be determined by a hemolysis assay.
[0458] Reduction in urinary Ba and sC5b-9
[0459] In certain embodiments, the methods described herein are sufficient to effectively reduce the levels of urinary Ba or sC5b-9 in a subject. In certain embodiments, the methods described herein are sufficient to effectively reduce the levels of urinary Ba or sC5b-9 in a subject, as assessed by the percent decrease or absolute decrease in the levels of urinary Ba or sC5b-9 between one time point and a later time point after administration of Compound 696844. In some embodiments, the percent decrease in the levels of urinary Ba or sC5b-9 is assessed by comparing the level of urinary Ba or sC5b-9 measured before the first administration of Compound 696844 (baseline) with the level of urinary Ba or sC5b-9 measured at a time point after administration of one or more doses of Compound 696844. In certain embodiments, the percent decrease is calculated as the percent decrease or absolute decrease in the level of urinary Ba or sC5b-9 relative to the baseline level of urinary Ba or sC5b-9 at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of Compound 696844. In certain embodiments, the percent decrease or absolute decrease is calculated as the percent decrease or absolute decrease in the level of urinary Ba or sC5b-9 between one time point after administration of one or more doses of Compound 696844 and a second time point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after that first time point. In certain embodiments, an assay such as the QUIDEL MICROVUE sC5b-9PLUS EIA can be used to determine the level of Bb.
[0460] Reduction in Bb
[0461] In certain embodiments, the methods described herein are sufficient to effectively reduce the level of Bb in a subject's serum, plasma, or urine. In certain embodiments, the methods described herein are sufficient to effectively reduce the level of Bb in a subject, as assessed by the percent reduction in Bb between one time point and a later time point after administration of Compound 696844. In some embodiments, the percent reduction in the level of Bb is assessed by comparing the level of Bb measured before the first administration of Compound 696844 (baseline) with the level of Bb measured at a time point after administration of one or more doses of Compound 696844. In certain embodiments, the percent reduction is calculated as the percent reduction in the level of Bb relative to the baseline 24-hour protein excretion at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of Compound 696844. In certain embodiments, the percent reduction is calculated as the percent reduction in the level of Bb between one time point after administration of one or more doses of Compound 696844 and a second time point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after that first time point. In certain embodiments, an assay such as the QUIDEL MICROVUE Bb PLUS EIA can be used to determine the level of Bb.
[0462] Slowing of the progression of geographic atrophy areas
[0463] In certain embodiments, the methods described herein are sufficient to effectively slow the progression of geographic atrophy regions in a subject. In certain embodiments, administration of Compound 696844 delays the progression of the entire geographic atrophy region in the eye. In certain embodiments, administration of Compound 696844 delays the appearance of additional geographic atrophy regions in the eye. In certain embodiments, the methods described herein are sufficient to effectively slow the progression of geographic atrophy regions in a subject, as assessed by the percent decrease in the rate of change of GA area measured by fundus autofluorescence (FAF) or spectral domain optical coherence tomography (SD-OCT) between a time point after administration of Compound 696844 and a later time point. In some embodiments, the rate of change of GA area is assessed by comparing the GA area measured (baseline) prior to the first administration of Compound 696844 with the GA area measured at a time point after administration of one or more doses of Compound 696844. In some embodiments, the rate of change of GA area is assessed by comparing the rate of change of GA area (baseline) calculated from two or more measurements at two or more time points prior to the first administration of Compound 696844 with the rate of change of GA area calculated from two or more measurements at two or more time points after administration of one or more doses of Compound 696844. In certain embodiments, the percent decrease is calculated as the percent decrease in the GA area or rate of change of GA area at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of Compound 696844 relative to the baseline of the GA area or rate of change of GA area.
[0464] Slowing of the decline in low luminance visual acuity (LLVA).
[0465] In certain embodiments, the methods described herein are sufficient to effectively slow the decline of LLVA in a subject. In certain embodiments, administration of Compound 696844 delays the decline of LLVA in the eye. In certain embodiments, the methods described herein are sufficient to effectively slow the decline of LLVA in a subject, as assessed by the percent reduction in LLVA score measured between one time point and a later time point after administration of Compound 696844. In some embodiments, the rate of change of the LLVA score is assessed by comparing the LLVA (baseline) measured before the first administration of Compound 696844 with the LLVA measured at a time point after administration of one or more doses of Compound 696844. In some embodiments, the rate of change of LLVA is assessed by comparing the rate of change of the LLVA score (baseline) calculated from two or more measurements at two or more time points before the first administration of Compound 696844 with the rate of change of the LLVA score calculated from two or more measurements at two or more time points after administration of one or more doses of Compound 696844. In some embodiments, the percent reduction is calculated as the percent reduction of the LLVA score or the rate of change of the LLVA score at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of Compound 696844 relative to the baseline rate of change of the LLVA or the LLVA score.
[0466] Slowing of the morphological changes in the choroidal capillaries
[0467] In certain embodiments, the methods described herein are sufficient to effectively slow the progression of choroidal capillary morphological changes in a subject. In certain embodiments, administration of compound 696844 delays the progression of choroidal capillary morphological changes in the eye. In certain embodiments, the methods described herein are sufficient to effectively slow the progression of choroidal capillary morphological changes in a subject, as assessed by the percentage of choroidal capillary morphological changes measured by optical coherence tomography angiography (OCTA) between one time point after administration of compound 696844 and a later time point. In certain embodiments, the rate of change of choroidal capillary morphological changes is assessed by comparing the choroidal capillary morphological changes measured (baseline) before the first administration of compound 696844 with the choroidal capillary morphological changes measured at a time point after administration of one or more doses of compound 696844. In certain embodiments, the rate of change of choroidal capillary morphological changes is assessed by comparing the rate of change of choroidal capillary morphological changes (baseline) calculated from two or more measurements at two or more time points before the first administration of compound 696844 with the rate of change of choroidal capillary morphological changes calculated from two or more measurements at two or more time points after administration of one or more doses of compound 696844. In certain embodiments, the percent decrease is calculated as the percent decrease of the choroidal capillary morphological changes or the rate of choroidal capillary morphological changes at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of compound 696844 relative to the baseline of the choroidal capillary morphological changes or the rate of choroidal capillary morphological changes.
[0468] Slowing of the decline in best corrected visual acuity (BCVA)
[0469] In certain embodiments, the methods described herein are sufficient to effectively slow the decline in BCVA in a subject. In certain embodiments, administration of compound 696844 delays the decline in BCVA in the eye. In certain embodiments, the methods described herein are sufficient to effectively slow the decline in BCVA in a subject, as assessed by a vision chart or computer between one time point and a later time point after administration of compound 696844. In some embodiments, the rate of change in BCVA is assessed by comparing the BCVA (baseline) measured before the first administration of compound 696844 with the BCVA measured at a time point after administration of one or more doses of compound 696844. In some embodiments, the rate of change in BCVA is assessed by comparing the rate of change in BCVA (baseline) calculated from two or more measurements at two or more time points before the first administration of compound 696844 with the rate of change in BCVA calculated from two or more measurements at two or more times after administration of one or more doses of compound 696844. In some embodiments, the percent decrease is calculated as the percent decrease in BCVA or the rate of change in BCVA at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of compound 696844 relative to the baseline rate of change in BCVA or the rate of change in BCVA.
[0470] In certain embodiments, the methods described herein are sufficient to effectively improve at least one symptom or feature of a disease or disorder associated with CFB protein in a human subject. In certain embodiments, the methods described herein are sufficient to effectively arrest or reduce the rate of progression of at least one symptom or sign associated with CFB protein in a human subject, or delay the onset of the symptom or sign. In certain embodiments, the disease or disorder is an ocular disease or disorder or a renal disease or disorder. In certain embodiments, the disease or disorder is age-related macular degeneration (AMD), wet AMD, intermediate AMD, dry AMD, geographic atrophy (GA) associated with AMD, IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, atypical hemolytic uremic syndrome (aHUS), aHUS characterized by thrombotic microangiopathy, ANCA-associated vasculitis, antiphospholipid syndrome (also known as antiphospholipid antibody syndrome (APS)), asthma, rheumatoid arthritis, myasthenia gravis, multiple sclerosis, preeclampsia, or a metabolic disorder such as NASH. In certain embodiments, at least one symptom or feature is proteinuria, decreased kidney function, C3 deposition in the kidney, hematuria, hypertension, kidney inflammation, IgA deposition in the glomerular mesangium, overactive alternative complement pathway, elevated plasma CFB, elevated serum, plasma, or urine Bb, elevated serum, plasma, or urine Ba, elevated serum, plasma, or urine sC5b-9, elevated serum, plasma, or urine C3, elevated serum, plasma, or urine C4, elevated serum AH50 activity, decreased vision, decreased low-luminance vision, decreased best-corrected vision, loss of central vision, geographic atrophy area, number of geographic atrophy areas, or choroidal capillary morphological changes.
[0471] IX. Certain combination therapies
[0472] In certain embodiments, the method comprises co-administering compound 696844 with at least one other agent. In certain embodiments, the at least one other agent ameliorates a disease or disorder associated with dysregulation of the complement pathway. In certain embodiments, the at least one other agent ameliorates a disease or disorder associated with dysregulation of the alternative complement pathway. In certain embodiments, the at least one other agent ameliorates a disease or disorder associated with CFB protein. In certain embodiments, the at least one other agent ameliorates the symptoms or features of a disease or disorder associated with an overactive alternative complement pathway. In certain embodiments, compound 696844 is co-administered with at least one other agent to produce a combined effect. In certain embodiments, compound 696844 is co-administered with at least one other agent to produce a synergistic effect.
[0473] In certain embodiments, compound 696844 is administered concomitantly with at least one other agent. In certain embodiments, compound 696844 and at least one other agent are administered at different times. In certain embodiments, compound 696844 and at least one other agent are prepared together in a single formulation. In certain embodiments, compound 696844 and at least one other agent to be administered are prepared in separate formulations.
[0474] In certain embodiments, agents that may be co-administered with compound 696844 include agents such as angiotensin-converting enzyme inhibitors (ACEi), angiotensin receptor blockers (ARB), or sodium / glucose co-transporter-2 inhibitors (SGLT2i), or agents for kidney diseases or disorders; anti-complement agents or complement inhibitors; agents for AMD, or other agents for eye diseases or disorders.
[0475] Examples
[0476] The following examples illustrate certain embodiments of the present disclosure and are not limiting. In addition, in providing specific embodiments, the inventors have envisioned the general application of those specific embodiments. For example, the disclosure of an oligonucleotide having a specific motif provides reasonable support for other oligonucleotides having the same or similar motifs. And, for example, when a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable unless otherwise stated.
[0477] Example 1: Phase 1 Human Clinical Trial of Compound 696844
[0478] Compound 696844 was formulated as a sterile parenteral solution of 100 mg / mL compound in phosphate-buffered saline (adjusted to approximately pH 7.4 with acid or base during formulation) for administration. The solution was clear and colorless to pale yellow in color. The drug was packaged in ISO 2RI type clear glass vials with a 0.8 mL deliverable volume, sealed with a butyl rubber stopper and an aluminum top seal. Each vial was filled with approximately 1.0 mL to ensure that the labeled 0.8 mL volume was available for dosing.
[0479] Compound 696844 was evaluated in two Phase 1, double-blind, placebo-controlled, dose-escalation studies in which single or multiple doses of compound 696844 were administered subcutaneously to healthy adult human subjects.
[0480] A total of 54 healthy human subjects aged 27 - 65 years were randomly assigned to receive either placebo (phosphate - buffered saline (PBS)) or compound 696844 in PBS. In a single - ascending - dose study, 10 mg, 20 mg, or 40 mg of compound 696844 was administered subcutaneously to eighteen (18) subjects, and placebo was administered to 6 subjects, and follow - up was conducted during a 90 - day post - treatment phase.
[0481] In a multiple - ascending - dose study, 10 mg of compound 696844 was administered subcutaneously to 12 subjects, 20 mg of compound 696844 was administered subcutaneously to 12 subjects, and placebo was administered to 6 subjects. Eight doses were administered to each subject over 36 days, 4 loading doses in the first two weeks (days 1, 4, 8, and 12), and then once a week for the next 4 weeks (days 15, 22, 29, and 36).
[0482] Table 1: Phase 1 Study in Healthy Volunteers
[0483]
[0484] Ocular and systemic safety, pharmacokinetic (PK) activity, and pharmacodynamic activity (CFB and ACP activity (AH50)) were evaluated in both single - and multiple - ascending - dose studies.
[0485] All subjects completed the Phase 1 study (week 19). After administration of compound 696844, there were no safety signals or clinically relevant changes in ocular endpoints (BCVA, IOP, comprehensive examination), blood chemistry, hematology, or vital signs. Compared to placebo, administration of single - and multiple - doses of compound 696844 to healthy volunteers resulted in a statistically significant dose - dependent decrease in plasma CFB levels, with the nadir after multiple doses occurring on day 43 (56% decrease for 10 mg and 72% decrease for 20 mg)( Figure 1B 、Figure 2). Serum factor B function (factor BF) activity and factor B cleavage products were similarly decreased.
[0486] The complement assays used were as follows: CFB level (radial immunodiffusion); factor B function, AH50 activity, and CH50 activity (hemolytic assays); Bb level (QUIDEL MICROVUE Bb PLUS EIA; ELISA immunoassay); AH50 activity WAP (Weislab ELISA); sC5b-9 level (MICROVUE sC5b-9 PLUS enzyme immunoassay); C5a level (QUIDEL C5a ELISA); C2 (radial immunodiffusion); C3 (SPAplus (binding site)); C3a (QUIDEL C3a PLUS EIA; ELISA immunoassay); C4 (SPAplus (binding site)); factor D level (R&D SYSTEMS QUANTIKINE kit; ELISA immunoassay).
[0487] Single administration of compound 696844 resulted in a dose-dependent decrease in plasma CFB levels, shown as the percent change relative to baseline over time in the treatment groups ( Figure 1A ). Results for placebo-treated subjects varied over time but remained within 2 SD of normal values. The nadir of CFB reduction was generally reached between 15 and 30 days after dosing. When averaging days 15, 22, and 30, the mean percent change relative to baseline for compound 696844 was: -15% for 10 mg, -31% for 20 mg, and -39% for 40 mg, compared to -11% for placebo. For 40 mg, the difference compared to placebo was statistically significant (p = 0.030), and for 20 mg, the difference compared to placebo was borderline statistically significant (p = 0.054).
[0488] After single administration of compound 696844, serum CFB functional levels (reported as factor B function) and factor B cleavage product (Bb) decreased similarly in the compound 696844-treated cases. However, the degree of reduction in factor B function was not sufficient to cause a consistent change in serum alternative pathway activity (AH50). In addition, no consistent changes occurred in serum classical complement activity (measured by CH50 and sC5b-9) or in compensatory changes in factor D or C3 levels.
[0489] Multiple administrations of compound 696844 to healthy subjects resulted in a dose-dependent decrease in plasma CFB, as shown by the actual values in Figure 1B and as Figure 1CThe results of placebo-treated subjects changed over time but remained within 2SD of normal values. The lowest point of CFB reduction was reached on day 43 (56% reduction for 10 mg and 72% reduction for 20 mg). When averaging the values at days 29, 36, 43, and 57, the mean percentage change of compound 696844 relative to baseline was: 51% for 10 mg and 70% for 20 mg, compared to 10% for placebo.
[0490] Greater reduction of CFB levels after multiple administrations led to greater reduction of serum factor B functional levels and Bb levels ( Figure 6 and Figure 7 ).
[0491] Multiple administrations of compound 696844 led to reduction of plasma CFB levels and serum Bb levels ( Figure 2A and Figure 2B ). A slight reduction (about 25%) of AH50 hemolytic activity was observed with multiple doses of 10 mg SC, and a greater reduction (about 55%) of this activity was observed with the 20 mg dose. AH50 hemolytic activity was correlated with plasma CFB levels ( Figure 2C ). Even with substantial reduction of CFB, the maximum reduction of CH50 was only 11% for 10 mg (day 85) and 12% for 20 mg (day 43) in the case of compound 696844 treatment. No clinically relevant changes were observed in other complement components, including factor D, C2, C3, and C4. On day 43 (7 days after the last administration), for the 20 mg dose, the mean percentage reduction (+ / -SE) of AH50 and classical component pathway activity (CH50) levels were -62 (+ / -5)% and -12 (+ / -5)%, respectively ( Figure 2B ).
[0492] After 2 months of exposure to compound 696844, no meaningful safety or tolerability findings were noted, no serious adverse events occurred, and the incidence of mild to moderate adverse events was comparable to that of the placebo-treated group. No increase in the incidence of infections was found. No injection site reactions or clinically relevant changes in hematology, serum chemistry, liver function, or kidney function were recorded.
[0493] Example 2: Phase 2a human clinical trial of compound 696844 for the treatment of kidney disease
[0494] An exploratory, single-arm, open-label Phase 2 study was conducted to evaluate compound 696844 in patients with primary IgA nephropathy. Subjects were diagnosed with biopsy-confirmed IgA nephropathy (IgAN) within 12 months, with ≤50% interstitial fibrosis, ≤50% crescents, and the presence of C3 deposition; proteinuria collected over 24 hours was between 1.5 g / day and 5.0 g / day; hematuria; eGFR > 40 mL / min / 1.73m 2 ; and had not been treated with immunosuppressive / immunomodulatory drugs within 12 months.
[0495] After administering compound 696844 by subcutaneous injection (70 mg / month, two administrations during the first month, two weeks apart), a mid-term analysis of the ongoing open-label study was conducted. The compound was administered to the subjects at weeks 1, 3, 5, and then every 4 weeks thereafter for 20 weeks (7 administrations). The last administration was at week 25. The primary outcome was a reduction in 24-hour proteinuria at week 29 (4 weeks after the last dose) compared to baseline (BL (before administering compound 696844)). Proteinuria was measured as urinary protein ((grams / day) 2 (grams / day) 2 ) and the urinary protein-to-creatinine ratio (UPCr) 2 . Secondary outcome measures included: safety, complement levels, and estimated glomerular flow rate (eGFR).
[0496] Complement assays included those listed in Example 1.
[0497] The study enrolled 10 subjects, aged 25 - 59 years, 40% female, 6 Asians and 4 Caucasians.
[0498] Table 2: Phase 2 kidney disease study, individual demographics
[0499]
[0500]
[0501] 1 - eGFR at day 1 (mL / min / 1.73m 2 ), based on CKD-EPI 2009
[0502] 2 - Baseline proteinuria determined by two 24-hour collections during baseline / screening
[0503] Table 3: Individual kidney histological analysis
[0504] Patient MHS EHS SSS TAIFS CS C3 A M0 E0 S1 T1 C0 3+ B M1 E0 S1 T1 C1 3+ C M0 E0 S1 T0 C1 2+ D M1 E1 S1 T0 C0 2 E M1 E0 S1 T1 C0 1+ F M1 E0 S1 T1 C0 2 G M1 E0 S1 T0 C0 3+ H M0 E0 S1 T0 C1 1 I M1 E0 S1 T1 C0 2 J M1 E0 S1 T1 C0 2-3
[0505] C3: C3 deposition score; CS: crescent score; EHS: endocapillary cell hyperplasia score; MHS: mesangial cell hyperplasia score; SSS: segmental sclerosis score; TAIFS: tubulointerstitial atrophy / fibrosis score.
[0506] Compound 696844 decreased the plasma CFB level in subjects with IgAN, attenuated the over-activation of AP, and reduced proteinuria in subjects diagnosed with IgAN. The plasma CFB level of IgAN patients was measured after multiple administrations of 70 mg compound 696844 by subcutaneous injection at weeks 1, 3, 5, 9, 13, 17, 21, and 25. The plasma CFB level of IgAN patients decreased by 71% at week 9 (at the first sampling), and was maintained at a low level during the treatment, as measured by nephelometry ( Figure 6 ). At week 37 (12 weeks after the last administration), the plasma CFB level was below the LLN. The steady-state (average of weeks 21, 25, and 27) level of plasma CFB decreased by 69%.
[0507] From baseline to the end of treatment, the plasma CFB protein level, serum AP activity, and urinary Ba decreased selectively (average percentage changes were -69%, -39%, and -88%, respectively) ( Figure 8 ). The median proteinuria at baseline (24-hour urine collection) was 1.89 g / d (IQR 1.09, 3.51 g / d). At week 29, the change in proteinuria was -1.00 g / d (IQR -1.82, -0.79 g / d), corresponding to a 52% reduction (Figure 4). Compared with baseline, there was no change in eGFR at week 29 (mean ± SD; BL 69 ± 30; Wk29 70 ± 24 mL / min / 1.73 m2) ( Figure 5 ). The reduction of other complement components in IgA nephropathy patients was similar to that observed in healthy subjects. The plasma level of factor B cleavage product Bb decreased by 78%. In addition, the urinary level of Ba decreased by 88% ( Figure 7 ). The serum alternative pathway activity measured using the modified AH50 Wieslab alternative pathway ELISA assay (AH50 WAP) decreased to -40%. The CH50 WAP activity decreased only by 8%. In addition, plasma CFBb decreased by approximately 69%, and the serum AH50 activity decreased, while no change was observed in CH50.
[0508] In the interim analysis, eight out of ten subjects administered compound 696844 showed a reduction in proteinuria as measured by 24-hour urine protein / creatinine ratio. In an ongoing open-label clinical study of compound 696844, 10 IgAN patients were first maintained on the maximum dose of ACE / ARB and then had a baseline 24-hour urine collection. The baseline UPCr levels in the 24-hour collections ranged from 1.00 to 3.58 g / g. The median UPCr at baseline was 1.49 g / g (Q1, Q3 were 1.12 and 1.90 g / g). After a monthly dose of 70 mg SC, at the assessment at week 29, the median reduction in proteinuria (UPCr from 24-hour urine collection) was -45%. The range of change in proteinuria was from -87% to +26%. At week 29, the median eGFR (estimated creatinine-adjusted CKD-EPI 2021) remained unchanged (+4%) compared to baseline (67.7 mL / 1.73 m2).
[0509] Compound 696844 demonstrated a favorable safety profile with no treatment-emergent serious adverse events, and the only safety signal of clinical significance (treatment-emergent moderate adverse event (TEAE)) was an elevation in ALT (3 - 5 times ULN) in one subject and transient erythema at the injection site in 1 subject. All subjects completed the study (week 29).
[0510] Example 3: Phase 2 human clinical trial of compound 696844 for the treatment of AMD-associated geographic atrophy
[0511] A randomized, placebo-controlled, double-blind phase 2 study was conducted in patients with secondary geographic atrophy of AMD. Subjects 50 years or older were recruited with study eyes having AMD-associated geographic atrophy, BCVA > 35 letters, and GA area of 1.9 mm 2 to ≤ 17 mm2 and no choroidal neovascularization. Two screening visits were conducted three months apart to assess the initial growth rate for random stratification. The median age of the participants was 76 years and approximately 58% were female. Approximately 67% of the GA lesions were subfoveal, 65% were multifocal, 95% were bilateral, and the baseline GA area was 7.6 mm 2 . The annualized GA area change was approximately 2.0 mm 2 . The growth rate was fastest for non-foveal central multifocal lesions and slowest for non-foveal central unifocal lesions. The BCVA for multifocal lesions was more than 2 lines better than for unifocal lesions, and
[0512] as expected, worse for foveal central lesions.
[0513] Subjects were administered subcutaneous injections of compound 696844 every four weeks, with a primary analysis conducted 12 months after the start of treatment. In phase 1, subjects received 40 mg, 70 mg, or 100 mg of compound 696844, or a placebo-matched solution ("placebo") from week 1 to week 45; in phase 2, the dosing cohorts of 40 mg and 70 mg were expanded in a new group of randomly assigned participants based on a status 1 interim analysis at week 45. Subjects were evaluated for the primary outcome measure, which included the absolute change in the area of geographic atrophy (GA) at week 49 relative to baseline, as assessed by retinal imaging. Retinal imaging was assessed by fundus autofluorescence (FAF). Subjects were evaluated for secondary outcome measures, which included the percentage change in complement relative to baseline, including the change in the level of factor B (CFB) in plasma (baseline and up to week 49); and the percentage change in serum AH50 activity level relative to baseline (baseline and up to week 49); and the absolute change in low luminance visual acuity (LLVA) relative to baseline (baseline and up to week 49).
[0514] Complement assays can include the assays listed in Example 1 and can also include the following assessments: FB level (BECKMAN IMMAGE 800; turbidimetry / turbidity); AH50 WAP (Weislab ELISA; deposition function ELISA); CH50WCP (Weislab Elisa; deposition function ELISA); C3 level (BECKMAN IMMAGE 800; turbidimetry / turbidity); Bb level (QUIDEL MICROVUE Bb PLUS EIA; ELISA immunoassay); MBL level (BIOPORTO (distributed by QUIDEL); ELISA immunoassay); sC5b-9 level (QUIDEL MICROVUE sC5b-9PLUS EIA; ELISA immunoassay); factor D level (MILLIPORE Complement Panel #1; multiplex Luminex immunoassay); C2 level (MILLIPORE Complement Panel #1; multiplex Luminex immunoassay); and C4 level (BECKMAN IMMAGE 800; turbidimetry / turbidity).
[0515] Example 4: Phase 3 human clinical trial of compound 696844 for the treatment of IgA nephropathy
[0516] A randomized, double-blind, placebo-controlled phase 3 clinical trial was conducted to evaluate the efficacy and safety of subcutaneously administered compound 696844 in adult human subjects with IgA nephropathy. Example 5: Phase 3 human clinical trial of compound 696844 for the treatment of geographic atrophy associated with AMD
[0517] A randomized, double-blind, placebo-controlled Phase 3 clinical trial was conducted to evaluate the efficacy and safety of subcutaneously administered compound 696844 in adult human subjects with geographic atrophy associated with AMD.
Claims
1. A method of ameliorating a disease or disorder associated with dysregulation of the complement alternative pathway in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical structure: (SEQ ID NO:4), or a pharmaceutically acceptable salt thereof.
2. The method according to claim 1, wherein the compound is a sodium salt or a potassium salt.
3. A method of ameliorating a disease or disorder associated with dysregulation of the complement alternative pathway in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical structure: (SEQ ID NO:4).
4. A method of ameliorating a disease or disorder associated with dysregulation of the complement alternative pathway in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound, wherein the compound has the following chemical symbol: GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO:4); wherein, A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and GalNAc3-7 a-o'= 5. A method of reducing the expression of complement factor B (CFB) RNA in a human subject suffering from or at risk of suffering from a disease or disorder associated with dysregulation of the complement alternative pathway, the method comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical structure: (SEQ ID NO:4, or a pharmaceutically acceptable salt thereof.
6. The method according to claim 1, wherein the compound is a sodium salt or a potassium salt.
7. A method of reducing the expression of complement factor B (CFB) RNA in a human subject suffering from or at risk of suffering from a disease or disorder associated with dysregulation of the complement alternative pathway, the method comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical structure: (SEQ ID NO:4).
8. A method of reducing Complement Factor B (CFB) RNA in a human subject having a disease or disorder associated with dysregulation of the alternative complement pathway or at risk of having said disease or disorder, said method comprising administering to said human subject a therapeutically effective amount of a compound, wherein said compound has the following chemical symbol (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO:4); wherein, A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and GalNAc3-7 a-o'= 9. The method according to any one of claims 6 to 8, wherein CFB mRNA is reduced.
10. The method according to any one of claims 6 to 8, wherein CFB protein is reduced.
11. The method according to any one of claims 6 to 10, wherein administration of the compound reduces CFB protein in one or both eyes.
12. The method according to any one of claims 6 to 11, wherein administration of the compound reduces CFB protein in one or both kidneys.
13. The method according to claim 12, wherein administration of the compound reduces CFB protein in glomeruli.
14. A method of reducing the level of complement components in the eyes or kidneys of a human subject suffering from or at risk of suffering from a disease or disorder associated with dysregulation of the complement alternative pathway, the method comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical structure: (SEQ ID NO:4), or a pharmaceutically acceptable salt thereof.
15. The method according to claim 14, wherein the compound is a sodium salt or a potassium salt.
16. A method for reducing the level of complement components in the eyes or kidneys of a human subject suffering from or at risk of suffering from a disease associated with dysregulation of the alternative complement pathway, the method comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical structure: (SEQ ID NO:4).
17. A method of reducing the level of complement components in the eyes or kidneys of a human subject suffering from or at risk of suffering from a disease or disorder associated with dysregulation of the alternative complement pathway, the method comprising administering to the human subject a therapeutically effective amount of a compound, wherein the compound has the following chemical symbol (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO:4); wherein, A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and GalNAc3-7 a-o'= 18. The method according to any one of claims 14 to 17, wherein the complement component is any one of C3, C3a, C3b, C4b, C3dg, C5, C5a, C5b, C6, C7, C8 and C9.
19. A method for reducing complement factor B (CFB) protein in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical structure: (SEQ ID NO:4, or a pharmaceutically acceptable salt thereof.
20. The method according to claim 19, wherein the compound is a sodium salt or a potassium salt.
21. A method for reducing complement factor B (CFB) protein in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical structure: (SEQ ID NO:4).
22. A method of reducing Complement Factor B (CFB) protein in human subjects in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a compound, wherein the compound has the following chemical symbol (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A e s G es m C e (SEQ ID NO:4); wherein, A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and GalNAc3-7 a-o'= 23. The method according to any one of claims 19 to 22, wherein the human subject suffers from a disease or disorder associated with dysregulation of the alternative complement pathway.
24. The method according to any one of claims 1 to 23, wherein the activity of the complement pathway is elevated.
25. The method according to any one of claims 1 to 24, wherein the activity of the alternative complement activity is elevated.
26. The method according to claim 24 or claim 25, wherein the elevated activity is associated with the disease or disorder of the human subject.
27. The method according to any one of claims 1 to 26, wherein reducing the CFB protein improves the disease or disorder.
28. The method according to any one of claims 1 to 18 or 23 to 27, wherein the disease or disorder is an eye disease or disorder.
29. The method according to any one of claims 1 to 18 or 23 to 28, wherein the disease or disorder is macular degeneration, neuromyelitis optica; corneal disease, corneal inflammation; autoimmune uveitis; or diabetic retinopathy.
30. The method according to claim 29, wherein the macular degeneration is age-related macular degeneration (AMD).
31. The method according to claim 30, wherein the AMD is wet AMD or intermediate AMD.
32. The method according to claim 30, wherein the AMD is dry AMD.
33. The method according to any one of claims 1 to 18 or 23 to 32, wherein the disease or disorder is geographic atrophy associated with AMD.
34. The method according to any one of claims 1 to 18 or 23 to 27, wherein the disease or disorder is a kidney disease or disorder.
35. The method according to claim 34, wherein the kidney disease or disorder is IgA nephropathy.
36. The method according to claim 34, wherein the disease is lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS).
37. The method according to claim 36, wherein the aHUS is characterized by thrombotic microangiopathy.
38. The method according to any one of claims 34 to 36, wherein the disease or disorder is a kidney disease or disorder associated with C3 deposition.
39. The method according to claim 38, wherein the kidney disease or disorder is associated with C3 deposition in the glomerulus.
40. The method according to any one of claims 34 to 39, wherein the disease or disorder is a kidney disease or disorder associated with a below-normal circulating C3 level.
41. The method according to claim 40, wherein the circulating C3 level is a serum or plasma C3 level.
42. The method according to any one of claims 1 to 41, wherein administering the compound reduces the accumulation of C3 levels in the eye.
43. The method according to claim 42, wherein the accumulation is in the blood vessels.
44. The method according to any one of claims 1 to 41, wherein administering the compound reduces the accumulation of C3 in the kidney.
45. The method according to any one of claims 1 to 41 or 44, wherein administering the compound reduces the level of C3 in the kidney or reduces the accumulation of renal C3 deposition.
46. The method according to claim 41 or 44 to 45, wherein administering the compound reduces the level of C3 or reduces the accumulation of C3 in the glomerulus.
47. The method according to any one of claims 1 to 18 or 23 to 27, wherein the disease or disorder is ANCA-associated vasculitis, antiphospholipid syndrome (also known as antiphospholipid antibody syndrome (APS)), asthma, rheumatoid arthritis, myasthenia gravis, multiple sclerosis, preeclampsia, or a metabolic disorder (such as NASH).
48. The method according to any one of claims 1 to 47, wherein the subject is identified as having a disease or disorder associated with dysregulation of the alternative complement pathway or at risk of developing the disease or disorder.
49. The method according to claim 48, wherein the identification comprises detecting the complement level or the membrane attack complex level in the blood of the subject.
50. The method according to claim 49, wherein the identification comprises detecting the complement level or the membrane attack complex level in the serum or plasma of the subject.
51. The method according to claim 49, wherein said identification comprises performing a genetic test for a gene mutation of a complement factor associated with said disease or disorder.
52. The method according to any one of claims 1 to 18 or 23 to 51, wherein at least one symptom or feature of said disease or disorder associated with the dysregulation of the alternative complement pathway is improved.
53. The method according to claim 52, wherein said symptom or feature is proteinuria; progressive decline in kidney function; C3 deposition in the kidney; hematuria; hypertension; kidney inflammation; IgA deposition in the glomerular mesangium; overactivity of the alternative complement pathway; elevated plasma CFB protein; elevated serum, plasma or urine Bb; elevated serum, plasma or urine Ba; elevated serum, plasma or urine sC5b-9; elevated or reduced serum, plasma or urine C3; elevated serum, plasma or urine C4; or elevated serum AH50 activity.
54. The method according to claim 52, wherein said symptom or feature is progressive decline in visual acuity; progressive decline in low-luminance visual acuity; progressive decline in best-corrected visual acuity; progressive decline in central vision; morphological changes in the choroidal capillaries; geographic atrophy of the eye; C3 deposition in the eye; overactivity of the alternative complement pathway; elevated plasma CFB protein; elevated serum, plasma or urine Bb; elevated serum, plasma or urine Ba; elevated serum, plasma or urine sC5b-9; elevated or reduced serum, plasma or urine C3; elevated serum, plasma or urine C4; or elevated serum AH50 activity.
55. The method according to any one of claims 1 to 54, wherein administration of said compound slows or prevents decline in visual acuity; slows or prevents decline in low-luminance visual acuity; slows or prevents decline in best-corrected visual acuity; slows or prevents decline in central vision; slows or prevents morphological changes in the choroidal capillaries; slows or prevents geographic atrophy of the eye; reduces C3 deposition in the eye; reduces the activity of the alternative complement pathway; reduces plasma CFB protein; reduces serum, plasma or urine Bb; reduces serum, plasma or urine Ba; reduces serum, plasma or urine sC5b-9; regulates, increases or reduces serum, plasma or urine C3; reduces serum, plasma or urine C4; or reduces serum AH50 activity.
56. The method according to any one of claims 1 to 53, wherein administration of said compound reduces proteinuria; slows or prevents decline in kidney function; reduces C3 deposition in the kidney; reduces hematuria; reduces hypertension; reduces kidney inflammation; reduces IgA deposition in the glomerular mesangium; reduces the activity of the alternative complement pathway; reduces plasma CFB protein; reduces serum, plasma or urine Bb; reduces serum, plasma or urine Ba; reduces serum, plasma or urine sC5b-9; regulates, increases or reduces serum, plasma or urine C3; reduces serum, plasma or urine C4; or reduces serum AH50 activity.
57. The method according to any one of claims 1 to 56, wherein the urinary protein / creatinine ratio is reduced after administration of said compound.
58. The method according to any one of claims 1 to 57, wherein the level of urinary protein is decreased after administration of the compound.
59. The method according to any one of claims 28 to 33, wherein in the subject, administration of the compound slows or prevents the progression or development of geographic atrophy.
60. The method according to any one of claims 28 to 33, wherein in the subject, administration of the compound slows the expansion of the area of geographic atrophy.
61. The method according to claim 60, wherein administration of the compound slows the expansion of geographic atrophy into the foveal region.
62. The method according to any one of claims 28 to 33, wherein administration of the compound arrests the expansion of geographic atrophy.
63. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is 10 mg.
64. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is 20 mg.
65. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is 40 mg.
66. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is 70 mg.
67. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is 100 mg.
68. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is about 10 mg.
69. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is about 20 mg.
70. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is about 40 mg.
71. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is about 70 mg.
72. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is about 100 mg.
73. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, and 350 mg.
74. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, about 185 mg, about 190 mg, about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, about 260 mg, about 265 mg, about 270 mg, about 275 mg, about 280 mg, about 285 mg, about 290 mg, about 295 mg, about 300 mg, about 305 mg, about 310 mg, about 315 mg, about 320 mg, about 325 mg, about 330 mg, about 335 mg, about 340 mg, about 345 mg, and about 350 mg.
75. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: 10 mg, 10.1 mg, 10.2 mg, 10.3 mg, 10.4 mg, 10.5 mg, 10.6 mg, 10.7 mg, 10.8 mg, 10.9 mg, 11 mg, 11.1 mg, 11.2 mg, 11.3 mg, 11.4 mg, 11.5 mg, 11.6 mg, 11.7 mg, 11.8 mg, 11.9 mg, 12 mg, 12.1 mg, 12.2 mg, 12.3 mg, 12.4 mg, 12.5 mg, 12.6 mg, 12.7 mg, 12.8 mg, 12.9 mg, 13 mg, 13.1 mg, 13.2 mg, 13.3 mg, 13.4 mg, 13.5 mg, 13.6 mg, 13.7 mg, 13.8 mg, 13.9 mg, 14 mg, 14.1 mg, 14.2 mg, 14.3 mg, 14.4 mg, 14.5 mg, 14.6 mg, 14.7 mg, 14.8 mg, 14.9 mg, 15 mg, 15.1 mg, 15.2 mg, 15.3 mg, 15.4 mg, 15.5 mg, 15.6 mg, 15.7 mg, 15.8 mg, 15.9 mg, 16 mg, 16.1 mg, 16.2 mg, 16.3 mg, 16.4 mg, 16.5 mg, 16.6 mg, 16.7 mg, 16.8 mg, 16.9 mg, 17 mg, 17.1 mg, 17.2 mg, 17.3 mg, 17.4 mg, 17.5 mg, 17.6 mg, 17.7 mg, 17.8 mg, 17.9 mg, 18 mg, 18.1 mg, 18.2 mg, 18.3 mg, 18.4 mg, 18.5 mg, 18.6 mg, 18.7 mg, 18.8 mg, 18.9 mg, 19 mg, 19.1 mg, 19.2 mg, 19.3 mg, 19.4 mg, 19.5 mg, 19.6 mg, 19.7 mg, 19.8 mg, 19.9 mg, 20 mg, 20.1 mg, 20.2 mg, 20.3 mg, 20.4 mg, 20.5 mg, 20.6 mg, 20.7 mg, 20.8 mg, 20.9 mg, 21 mg, 21.1 mg, 21.2 mg, 21.3 mg, 21.4 mg, 21.5 mg, 21.6 mg, 21.7 mg, 21.8 mg, 21.9 mg, 22 mg, 22.1 mg, 22.2 mg, 22.3 mg, 22.4 mg, 22.5 mg, 22.6 mg, 22.7 mg, 22.8 mg, 22.9 mg, 23 mg, 23.1 mg, 23.2 mg, 23.3 mg, 23.4 mg, 23.5 mg, 23.6 mg, 23.7 mg, 23.8 mg, 23.9 mg, 24 mg, 24.1 mg, 24.2 mg, 24.3 mg, 24.4 mg, 24.5 mg, 24.6 mg, 24.7 mg, 24.8 mg, 24.9 mg, 25 mg, 25.1 mg, 25.2 mg, 25.3 mg, 25.4 mg, 25.5 mg, 25.6 mg, 25.7 mg, 25.8 mg, 25.9 mg, 26 mg, 26.1 mg, 26.2 mg, 26.3 mg, 26.4 mg, 26.5 mg, 26.6 mg, 26.7 mg, 26.8 mg, 26.9 mg, 27 mg, 27.1 mg, 27.2 mg, 27.3 mg, 27.4 mg, 27.5 mg, 27.6 mg, 27.7 mg, 27.8 mg, 27.9 mg, 28 mg, 28.1 mg, 28.2 mg, 28.3 mg, 28.4 mg, 28.5 mg, 28.6 mg, 28.7 mg, 28.8 mg, 28.9 mg, 29 mg, 29.1 mg, 29.2 mg, 29.3 mg, 29.4 mg, 29.5 mg, 29.6 mg, 29.7 mg, 29.8 mg, 29.9 mg, 30 mg, 30.1 mg, 30.2 mg, 30.3 mg, 30.4 mg, 30.5 mg, 30.6 mg, 30.7 mg, 30.8 mg, 30.9 mg, 31 mg, 31.1 mg, 31.2 mg, 31.3 mg, 31.4 mg, 31.5 mg, 31.6 mg, 31.7 mg, 31.8 mg, 31.9 mg, 32 mg, 32.1 mg, 32.2 mg, 32.3 mg, 32.4 mg, 32.5 mg, 32.6 mg, 32.7 mg, 32.8 mg, 32.9 mg, 33 mg, 33.1 mg, 33.2 mg, 33.3 mg, 33.4 mg, 33.5 mg, 33.6 mg, 33.7 mg, 33.8 mg, 33.9 mg, 34 mg, 34.1 mg, 34.2 mg, 34.3 mg, 34.4 mg, 34.5 mg, 34.6 mg, 34.7 mg, 34.8 mg, 34.9 mg, 35 mg, 35.1 mg, 35.2 mg, 35.3 mg, 35.4 mg, 35.5 mg, 35.6 mg, 35.7 mg, 35.8 mg, 35.9 mg, 36 mg, 36.1 mg, 36.2 mg, 36.3 mg, 36.4 mg, 36.5 mg, 36.6 mg, 36.7 mg, 36.8 mg, 36.9 mg, 37 mg, 37.1 mg, 37.2 mg, 37.3 mg, 37.4 mg, 37.5 mg, 37.6 mg, 37.7 mg, 37.8 mg, 37.9 mg, 38 mg, 38.1 mg, 38.2 mg, 38.3 mg, 38.4 mg, 38.5 mg, 38.6 mg, 38.7 mg, 38.8 mg, 38.9 mg, 39 mg, 39.1 mg, 39.2 mg, 39.3 mg, 39.4 mg, 39.5 mg, 39.6 mg, 39.7 mg, 39.8 mg, 39.9 mg, 40 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, 42.8 mg, 42.9 mg, 43 mg, 43.1 mg, 43.2 mg, 43.3 mg, 43.4 mg, 43.5 mg, 43.6 mg, 43.7 mg, 43.8 mg, 43.9 mg, 44 mg, 44.1 mg, 44.2 mg, 44.3 mg, 44.4 mg, 44.5 mg, 44.6 mg, 44.7 mg, 44.8 mg, 44.9 mg, 45 mg, 45.1 mg, 45.2 mg, 45.3 mg, 45.4 mg, 45.5 mg, 45.6 mg, 45.7 mg, 45.8 mg, 45.9 mg, 46 mg, 46.1 mg, 46.2 mg, 46.3 mg, 46.4 mg, 46.5 mg, 46.6 mg, 46.7 mg, 46.8 mg, 46.9 mg, 47 mg, 47.1 mg, 47.2 mg, 47.3 mg, 47.4 mg, 47.5 mg, 47.6 mg, 47.7 mg, 47.8 mg, 47.9 mg, 48 mg, 48.1 mg, 48.2 mg, 48.3 mg, 48.4 mg, 48.5 mg, 48.6 mg, 48.7 mg, 48.8 mg, 48.9 mg, 49 mg, 49.1 mg, 49.2 mg, 49.3 mg, 49.4 mg, 49.5 mg, 49.6 mg, 49.7 mg, 49.8 mg, 49.9 mg, 50 mg, 50.1 mg, 50.2 mg, 50.3 mg, 50.4 mg, 50.5 mg, 50.6 mg, 50.7 mg, 50.8 mg, 50.9 mg, 51 mg, 51.1 mg, 51.2 mg, 51.3 mg, 51.4 mg, 51.5 mg, 51.6 mg, 51.7 mg, 51.8 mg, 51.9 mg, 52 mg, 52.1 mg, 52.2 mg, 52.3 mg, 52.4 mg, 52.5 mg, 52.6 mg, 52.7 mg, 52.8 mg, 52.9 mg, 53 mg, 53.1 mg, 53.2 mg, 53.3 mg, 53.4 mg, 53.5 mg, 53.6 mg, 53.7 mg, 53.8 mg, 53.9 mg, 54 mg, 54.1 mg, 54.2 mg, 54.3 mg, 54.4 mg, 54.5 mg, 54.6 mg, 54.7 mg, 54.8 mg, 54.9 mg, 55 mg, 55.1 mg, 55.2 mg, 55.3 mg, 55.4 mg, 55.5 mg, 55.6 mg, 55.7 mg, 55.8 mg, 55.9 mg, 56 mg, 56.1 mg, 56.2 mg, 56.3 mg, 56.4 mg, 56.5 mg, 56.6 mg, 56.7 mg, 56.8 mg, 56.9 mg, 57 mg, 57.1 mg, 57.2 mg, 57.3 mg, 57.4 mg, 57.5 mg, 57.6 mg, 57.7 mg, 57.8 mg, 57.9 mg, 58 mg, 58.1 mg, 58.2 mg, 58.3 mg, 58.4 mg, 58.5 mg, 58.6 mg, 58.7 mg, 58.8 mg, 58.9 mg, 59 mg, 59.1 mg, 59.2 mg, 59.3 mg, 59.4 mg, 59.5 mg, 59.6 mg, 59.7 mg, 59.8 mg, 59.9 mg, 60 mg, 60.1 mg, 60.2 mg, 60.3 mg, 60.4 mg, 60.5 mg, 60.6 mg, 60.7 mg, 60.8 mg, 60.9 mg, 61 mg, 61.1 mg, 61.2 mg, 61.3 mg, 61.4 mg, 61.5 mg, 61.6 mg, 61.7 mg, 61.8 mg, 61.9 mg, 62 mg, 62.1 mg, 62.2 mg, 62.3 mg, 62.4 mg, 62.5 mg, 62.6 mg, 62.7 mg, 62.8 mg, 62.9 mg, 63 mg, 63.1 mg, 63.2 mg, 63.3 mg, 63.4 mg, 63.5 mg, 63.6 mg, 63.7 mg, 63.8 mg, 63.9 mg, 64 mg, 64.1 mg, 64.2 mg, 64.3 mg, 64.4 mg, 64.5 mg, 64.6 mg, 64.7 mg, 64.8 mg, 64.9 mg, 65 mg, 65.1 mg, 65.2 mg, 65.3 mg, 65.4 mg, 65.5 mg, 65.6 mg, 65.7 mg, 65.8 mg, 65.9 mg, 66 mg, 66.1 mg, 66.2 mg, 66.3 mg, 66.4 mg, 66.5 mg, 66.6 mg, 66.7 mg, 66.8 mg, 66.9 mg, 67 mg, 67.1 mg, 67.2 mg, 67.3 mg, 67.4 mg, 67.5 mg, 67.6 mg, 67.7 mg, 67.8 mg, 67.9 mg, 68 mg, 68.1 mg, 68.2 mg, 68.3 mg, 68.4 mg, 68.5 mg, 68.6 mg, 68.7 mg, 68.8 mg, 68.9 mg, 69 mg, 69.1 mg, 69.2 mg, 69.3 mg, 69.4 mg, 69.5 mg, 69.6 mg, 69.7 mg, 69.8 mg and 69.9 mg.
76. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: about 10 mg, about 10.1 mg, about 10.2 mg, about 10.3 mg, about 10.4 mg, about 10.5 mg, about 10.6 mg, about 10.7 mg, about 10.8 mg, about 10.9 mg, about 11 mg, about 11.1 mg, about 11.2 mg, about 11.3 mg, about 11.4 mg, about 11.5 mg, about 11.6 mg, about 11.7 mg, about 11.8 mg, about 11.9 mg, about 12 mg, about 12.1 mg, about 12.2 mg, about 12.3 mg, about 12.4 mg, about 12.5 mg, about 12.6 mg, about 12.7 mg, about 12.8 mg, about 12.9 mg, about 13 mg, about 13.1 mg, about 13.2 mg, about 13.3 mg, about 13.4 mg, about 13.5 mg, about 13.6 mg, about 13.7 mg, about 13.8 mg, about 13.9 mg, about 14 mg, about 14.1 mg, about 14.2 mg, about 14.3 mg, about 14.4 mg, about 14.5 mg, about 14.6 mg, about 14.7 mg, about 14.8 mg, about 14.9 mg, about 15 mg, about 15.1 mg, about 15.2 mg, about 15.3 mg, about 15.4 mg, about 15.5 mg, about 15.6 mg, about 15.7 mg, about 15.8 mg, about 15.9 mg, about 16 mg, about 16.1 mg, about 16.2 mg, about 16.3 mg, about 16.4 mg, about 16.5 mg, about 16.6 mg, about 16.7 mg, about 16.8 mg, about 16.9 mg, about 17 mg, about 17.1 mg, about 17.2 mg, about 17.3 mg, about 17.4 mg, about 17.5 mg, about 17.6 mg, about 17.7 mg, about 17.8 mg, about 17.9 mg, about 18 mg, about 18.1 mg, about 18.2 mg, about 18.3 mg, about 18.4 mg, about 18.5 mg, about 18.6 mg, about 18.7 mg, about 18.8 mg, about 18.9 mg, about 19 mg, about 19.1 mg, about 19.2 mg, about 19.3 mg, about 19.4 mg, about 19.5 mg, about 19.6 mg, about 19.7 mg, about 19.8 mg, about 19.9 mg, about 20 mg, about 20.1 mg, about 20.2 mg, about 20.3 mg, about 20.4 mg, about 20.5 mg, about 20.6 mg, about 20.7 mg, about 20.8 mg, about 20.9 mg, about 21 mg, about 21.1 mg, about 21.2 mg, about 21.3 mg, about 21.4 mg, about 21.5 mg, about 21.6 mg, about 21.7 mg, about 21.8 mg, about 21.9 mg, about 22 mg, about 22.1 mg, about 22.2 mg, approximately 22.3 mg, approximately 22.4 mg, approximately 22.5 mg, approximately 22.6 mg, approximately 22.7 mg, approximately 22.8 mg, approximately 22.9 mg, 23 mg, approximately 23.1 mg, approximately 23.2 mg, approximately 23.3 mg, approximately 23.4 mg, approximately 23.5 mg, approximately 23.6 mg, approximately 23.7 mg, approximately 23.8 mg, approximately 23.9 mg, 24 mg, approximately 24.1 mg, approximately 24.2 mg, approximately 24.3 mg, approximately 24.4 mg, approximately 24.5 mg, approximately 24.6 mg, approximately 24.7 mg, approximately 24.8 mg, approximately 24.9 mg, 25 mg, approximately 25.1 mg, approximately 25.2 mg, approximately 25.3 mg, approximately 25.4 mg, approximately 25.5 mg, approximately 25.6 mg, approximately 25.7 mg, approximately 25.8 mg, approximately 25.9 mg, 26 mg, approximately 26.1 mg, approximately 26.2 mg, approximately 26.3 mg, approximately 26.4 mg, approximately 26.5 mg, approximately 26.6 mg, approximately 26.7 mg, approximately 26.8 mg, approximately 26.9 mg, 27 mg, approximately 27.1 mg, approximately 27.2 mg, approximately 27.3 mg, approximately 27.4 mg, approximately 27.5 mg, approximately 27.6 mg, approximately 27.7 mg, approximately 27.8 mg, approximately 27.9 mg, 28 mg, approximately 28.1 mg, approximately 28.2 mg, approximately 28.3 mg, approximately 28.4 mg, approximately 28.5 mg, approximately 28.6 mg, approximately 28.7 mg, approximately 28.8 mg, approximately 28.9 mg, 29 mg, approximately 29.1 mg, approximately 29.2 mg, approximately 29.3 mg, approximately 29.4 mg, approximately 29.5 mg, approximately 29.6 mg, approximately 29.7 mg, approximately 29.8 mg, approximately 29.9 mg, 30 mg, approximately 30.1 mg, approximately 30.2 mg, approximately 30.3 mg, approximately 30.4 mg, approximately 30.5 mg, approximately 30.6 mg, approximately 30.7 mg, approximately 30.8 mg, approximately 30.9 mg, 31 mg, approximately 31.1 mg, approximately 31.2 mg, approximately 31.3 mg, approximately 31.4 mg, approximately 31.5 mg, approximately 31.6 mg, approximately 31.7 mg, approximately 31.8 mg, approximately 31.9 mg, 32 mg, approximately 32.1 mg, approximately 32.2 mg, approximately 32.3 mg, approximately 32.4 mg, approximately 32.5 mg, approximately 32.6 mg, approximately 32.7 mg, approximately 32.8 mg, approximately 32.9 mg, 33 mg, approximately 33.1 mg, approximately 33.2 mg, approximately 33.3 mg, approximately 33.4 mg, approximately 33.5 mg, approximately 33.6 mg, approximately 33.7 mg, approximately 33.8 mg, approximately 33.9 mg, 34 mg, approximately 34.1 mg, approximately 34.2 mg, approximately 34.3 mg, approximately 34.4 mg, approximately 34.5 mg, approximately 34.6 mg, approximately 34.7 mg, approximately 34.8 mg, approximately 34.9 mg, about 35 mg, about 35.1 mg, about 35.2 mg, about 35.3 mg, about 35.4 mg, about 35.5 mg, about 35.6 mg, about 35.7 mg, about 35.8 mg, about 35.9 mg, about 36 mg, about 36.1 mg, about 36.2 mg, about 36.3 mg, about 36.4 mg, about 36.5 mg, about 36.6 mg, about 36.7 mg, about 36.8 mg, about 36.9 mg, about 37 mg, about 37.1 mg, about 37.2 mg, about 37.3 mg, about 37.4 mg, about 37.5 mg, about 37.6 mg, about 37.7 mg, about 37.8 mg, about 37.9 mg, about 38 mg, about 38.1 mg, about 38.2 mg, about 38.3 mg, about 38.4 mg, about 38.5 mg, about 38.6 mg, about 38.7 mg, about 38.8 mg, about 38.9 mg, about 39 mg, about 39.1 mg, about 39.2 mg, about 39.3 mg, about 39.4 mg, about 39.5 mg, about 39.6 mg, about 39.7 mg, about 39.8 mg, about 39.9 mg, about 40 mg, about 40.1 mg, about 40.2 mg, about 40.3 mg, about 40.4 mg, about 40.5 mg, about 40.6 mg, about 40.7 mg, about 40.8 mg, about 40.9 mg, about 41 mg, about 41.1 mg, about 41.2 mg, about 41.3 mg, about 41.4 mg, about 41.5 mg, about 41.6 mg, about 41.7 mg, about 41.8 mg, about 41.9 mg, about 42 mg, about 42.1 mg, about 42.2 mg, about 42.3 mg, about 42.4 mg, about 42.5 mg, about 42.6 mg, about 42.7 mg, about 42.8 mg, about 42.9 mg, about 43 mg, about 43.1 mg, about 43.2 mg, about 43.3 mg, about 43.4 mg, about 43.5 mg, about 43.6 mg, about 43.7 mg, about 43.8 mg, about 43.9 mg, about 44 mg, about 44.1 mg, about 44.2 mg, about 44.3 mg, about 44.4 mg, about 44.5 mg, about 44.6 mg, about 44.7 mg, about 44.8 mg, about 44.9 mg, about 45 mg, about 45.1 mg, about 45.2 mg, about 45.3 mg, about 45.4 mg, about 45.5 mg, about 45.6 mg, about 45.7 mg, about 45.8 mg, about 45.9 mg, about 46 mg, about 46.1 mg, about 46.2 mg, about 46.3 mg, about 46.4 mg, about 46.5 mg, about 46.6 mg, about 46.7 mg, about 46.8 mg, about 46.9 mg, about 47 mg, about 47.1 mg, about 47.2 mg, about 47.3 mg, about 47.4 mg, about 47.5 mg, about 47.6 mg, about 47.7 mg, about 47.8 mg, about 47.9 mg, about 48 mg, about 48.1 mg, about 48.2 mg, about 48.3 mg, about 48.4 mg, about 48.5 mg, about 48.6 mg, about 48.7 mg, about 48.8 mg, about 48.9 mg, about 49 mg, about 49.1 mg, about 49.2 mg, about 49.3 mg, about 49.4 mg, about 49.5 mg, about 49.6 mg, about 49.7 mg, about 49.8 mg, about 49.9 mg, about 50 mg, about 50.1 mg, about 50.2 mg, about 50.3 mg, about 50.4 mg, about 50.5 mg, about 50.6 mg, about 50.7 mg, about 50.8 mg, about 50.9 mg, about 51 mg, about 51.1 mg, about 51.2 mg, about 51.3 mg, about 51.4 mg, about 51.5 mg, about 51.6 mg, about 51.7 mg, about 51.8 mg, about 51.9 mg, about 52 mg, about 52.1 mg, about 52.2 mg, about 52.3 mg, about 52.4 mg, about 52.5 mg, about 52.6 mg, about 52.7 mg, about 52.8 mg, about 52.9 mg, about 53 mg, about 53.1 mg, about 53.2 mg, about 53.3 mg, about 53.4 mg, about 53.5 mg, about 53.6 mg, about 53.7 mg, about 53.8 mg, about 53.9 mg, about 54 mg, about 54.1 mg, about 54.2 mg, about 54.3 mg, about 54.4 mg, about 54.5 mg, about 54.6 mg, about 54.7 mg, about 54.8 mg, about 54.9 mg, about 55 mg, about 55.1 mg, about 55.2 mg, about 55.3 mg, about 55.4 mg, about 55.5 mg, about 55.6 mg, about 55.7 mg, about 55.8 mg, about 55.9 mg, about 56 mg, about 56.1 mg, about 56.2 mg, about 56.3 mg, about 56.4 mg, about 56.5 mg, about 56.6 mg, about 56.7 mg, about 56.8 mg, about 56.9 mg, about 57 mg, about 57.1 mg, about 57.2 mg, about 57.3 mg, about 57.4 mg, about 57.5 mg, about 57.6 mg, about 57.7 mg, about 57.8 mg, about 57.9 mg, about 58 mg, about 58.1 mg, about 58.2 mg, about 58.3 mg, about 58.4 mg, about 58.5 mg, about 58.6 mg, about 58.7 mg, about 58.8 mg, about 58.9 mg, about 59 mg, about 59.1 mg, about 59.2 mg, about 59.3 mg, about 59.4 mg, about 59.5 mg, about 59.6 mg, about 59.7 mg, about 59.8 mg, about 59.9 mg, about 60 mg, about 60.1 mg, about 60.2 mg, about 60.3 mg, about 60.4 mg, about 60.5 mg, approximately 60.6 mg, approximately 60.7 mg, approximately 60.8 mg, approximately 60.9 mg, approximately 61 mg, approximately 61.1 mg, approximately 61.2 mg, approximately 61.3 mg, approximately 61.4 mg, approximately 61.5 mg, approximately 61.6 mg, approximately 61.7 mg, approximately 61.8 mg, approximately 61.9 mg, approximately 62 mg, approximately 62.1 mg, approximately 62.2 mg, approximately 62.3 mg, approximately 62.4 mg, approximately 62.5 mg, approximately 62.6 mg, approximately 62.7 mg, approximately 62.8 mg, approximately 62.9 mg, approximately 63 mg, approximately 63.1 mg, approximately 63.2 mg, approximately 63.3 mg, approximately 63.4 mg, approximately 63.5 mg, approximately 63.6 mg, approximately 63.7 mg, approximately 63.8 mg, approximately 63.9 mg, approximately 64 mg, approximately 64.1 mg, approximately 64.2 mg, approximately 64.3 mg, approximately 64.4 mg, approximately 64.5 mg, approximately 64.6 mg, approximately 64.7 mg, approximately 64.8 mg, approximately 64.9 mg, approximately 65 mg, approximately 65.1 mg, approximately 65.2 mg, approximately 65.3 mg, approximately 65.4 mg, approximately 65.5 mg, approximately 65.6 mg, approximately 65.7 mg, approximately 65.8 mg, approximately 65.9 mg, approximately 66 mg, approximately 66.1 mg, approximately 66.2 mg, approximately 66.3 mg, approximately 66.4 mg, approximately 66.5 mg, approximately 66.6 mg, approximately 66.7 mg, approximately 66.8 mg, approximately 66.9 mg, approximately 67 mg, approximately 67.1 mg, approximately 67.2 mg, approximately 67.3 mg, approximately 67.4 mg, approximately 67.5 mg, approximately 67.6 mg, approximately 67.7 mg, approximately 67.8 mg, approximately 67.9 mg, approximately 68 mg, approximately 68.1 mg, approximately 68.2 mg, approximately 68.3 mg, approximately 68.4 mg, approximately 68.5 mg, approximately 68.6 mg, approximately 68.7 mg, approximately 68.8 mg, approximately 68.9 mg, approximately 69 mg, approximately 69.1 mg, approximately 69.2 mg, approximately 69.3 mg, approximately 69.4 mg, approximately 69.5 mg, approximately 69.6 mg, approximately 69.7 mg, approximately 69.8 mg and approximately 69.9 mg.
77. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: 20 mg, 20.1 mg, 20.2 mg, 20.3 mg, 20.4 mg, 20.5 mg, 20.6 mg, 20.7 mg, 20.8 mg, 20.9 mg, 21 mg, 21.1 mg, 21.2 mg, 21.3 mg, 21.4 mg, 21.5 mg, 21.6 mg, 21.7 mg, 21.8 mg, 21.9 mg, 22 mg, 22.1 mg, 22.2 mg, 22.3 mg, 22.4 mg, 22.5 mg, 22.6 mg, 22.7 mg, 22.8 mg, 22.9 mg, 23 mg, 23.1 mg, 23.2 mg, 23.3 mg, 23.4 mg, 23.5 mg, 23.6 mg, 23.7 mg, 23.8 mg, 23.9 mg, 24 mg, 24.1 mg, 24.2 mg, 24.3 mg, 24.4 mg, 24.5 mg, 24.6 mg, 24.7 mg, 24.8 mg, 24.9 mg, 25 mg, 25.1 mg, 25.2 mg, 25.3 mg, 25.4 mg, 25.5 mg, 25.6 mg, 25.7 mg, 25.8 mg, 25.9 mg, 26 mg, 26.1 mg, 26.2 mg, 26.3 mg, 26.4 mg, 26.5 mg, 26.6 mg, 26.7 mg, 26.8 mg, 26.9 mg, 27 mg, 27.1 mg, 27.2 mg, 27.3 mg, 27.4 mg, 27.5 mg, 27.6 mg, 27.7 mg, 27.8 mg, 27.9 mg, 28 mg, 28.1 mg, 28.2 mg, 28.3 mg, 28.4 mg, 28.5 mg, 28.6 mg, 28.7 mg, 28.8 mg, 28.9 mg, 29 mg, 29.1 mg, 29.2 mg, 29.3 mg, 29.4 mg, 29.5 mg, 29.6 mg, 29.7 mg, 29.8 mg, 29.9 mg, 30 mg, 30.1 mg, 30.2 mg, 30.3 mg, 30.4 mg, 30.5 mg, 30.6 mg, 30.7 mg, 30.8 mg, 30.9 mg, 31 mg, 31.1 mg, 31.2 mg, 31.3 mg, 31.4 mg, 31.5 mg, 31.6 mg, 31.7 mg, 31.8 mg, 31.9 mg, 32 mg, 32.1 mg, 32.2 mg, 32.3 mg, 32.4 mg, 32.5 mg, 32.6 mg, 32.7 mg, 32.8 mg, 32.9 mg, 33 mg, 33.1 mg, 33.2 mg, 33.3 mg, 33.4 mg, 33.5 mg, 33.6 mg, 33.7 mg, 33.8 mg, 33.9 mg, 34 mg, 34.1 mg, 34.2 mg, 34.3 mg, 34.4 mg, 34.5 mg, 34.6 mg, 34.7 mg, 34.8 mg, 34.9 mg, 35 mg, 35.1 mg, 35.2 mg, 35.3 mg, 35.4 mg, 35.5 mg, 35.6 mg, 35.7 mg, 35.8 mg, 35.9 mg, 36 mg, 36.1 mg, 36.2 mg, 36.3 mg, 36.4 mg, 36.5 mg, 36.6 mg, 36.7 mg, 36.8 mg, 36.9 mg, 37 mg, 37.1 mg, 37.2 mg, 37.3 mg, 37.4 mg, 37.5 mg, 37.6 mg, 37.7 mg, 37.8 mg, 37.9 mg, 38 mg, 38.1 mg, 38.2 mg, 38.3 mg, 38.4 mg, 38.5 mg, 38.6 mg, 38.7 mg, 38.8 mg, 38.9 mg, 39 mg, 39.1 mg, 39.2 mg, 39.3 mg, 39.4 mg, 39.5 mg, 39.6 mg, 39.7 mg, 39.8 mg, 39.9 mg and 40 mg.
78. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: about 20 mg, about 20.1 mg, about 20.2 mg, about 20.3 mg, about 20.4 mg, about 20.5 mg, about 20.6 mg, about 20.7 mg, about 20.8 mg, about 20.9 mg, about 21 mg, about 21.1 mg, about 21.2 mg, about 21.3 mg, about 21.4 mg, about 21.5 mg, about 21.6 mg, about 21.7 mg, about 21.8 mg, about 21.9 mg, about 22 mg, about 22.1 mg, about 22.2 mg, about 22.3 mg, about 22.4 mg, about 22.5 mg, about 22.6 mg, about 22.7 mg, about 22.8 mg, about 22.9 mg, about 23 mg, about 23.1 mg, about 23.2 mg, about 23.3 mg, about 23.4 mg, about 23.5 mg, about 23.6 mg, about 23.7 mg, about 23.8 mg, about 23.9 mg, about 24 mg, about 24.1 mg, about 24.2 mg, about 24.3 mg, about 24.4 mg, about 24.5 mg, about 24.6 mg, about 24.7 mg, about 24.8 mg, about 24.9 mg, about 25 mg, about 25.1 mg, about 25.2 mg, about 25.3 mg, about 25.4 mg, about 25.5 mg, about 25.6 mg, about 25.7 mg, about 25.8 mg, about 25.9 mg, about 26 mg, about 26.1 mg, about 26.2 mg, about 26.3 mg, about 26.4 mg, about 26.5 mg, about 26.6 mg, about 26.7 mg, about 26.8 mg, about 26.9 mg, about 27 mg, about 27.1 mg, about 27.2 mg, about 27.3 mg, about 27.4 mg, about 27.5 mg, about 27.6 mg, about 27.7 mg, about 27.8 mg, about 27.9 mg, about 28 mg, about 28.1 mg, about 28.2 mg, about 28.3 mg, about 28.4 mg, about 28.5 mg, about 28.6 mg, about 28.7 mg, about 28.8 mg, about 28.9 mg, about 29 mg, about 29.1 mg, about 29.2 mg, about 29.3 mg, about 29.4 mg, about 29.5 mg, about 29.6 mg, about 29.7 mg, about 29.8 mg, about 29.9 mg, about 30 mg, about 30.1 mg, about 30.2 mg, about 30.3 mg, about 30.4 mg, about 30.5 mg, about 30.6 mg, about 30.7 mg, about 30.8 mg, about 30.9 mg, about 31 mg, about 31.1 mg, about 31.2 mg, about 31.3 mg, about 31.4 mg, about 31.5 mg, about 31.6 mg, about 31.7 mg, about 31.8 mg, about 31.9 mg, about 32 mg, about 32.1 mg, about 32.2 mg, about 32.3 mg, about 32.4 mg, about 32.5 mg, about 32.6 mg, about 32.7 mg, about 32.8 mg, about 32.9 mg, about 33 mg, about 33.1 mg, about 33.2 mg, about 33.3 mg, about 33.4 mg, about 33.5 mg, about 33.6 mg, about 33.7 mg, about 33.8 mg, about 33.9 mg, about 34 mg, about 34.1 mg, about 34.2 mg, about 34.3 mg, about 34.4 mg, about 34.5 mg, about 34.6 mg, about 34.7 mg, about 34.8 mg, about 34.9 mg, about 35 mg, about 35.1 mg, about 35.2 mg, about 35.3 mg, about 35.4 mg, about 35.5 mg, about 35.6 mg, about 35.7 mg, about 35.8 mg, about 35.9 mg, about 36 mg, about 36.1 mg, about 36.2 mg, about 36.3 mg, about 36.4 mg, about 36.5 mg, about 36.6 mg, about 36.7 mg, about 36.8 mg, about 36.9 mg, about 37 mg, about 37.1 mg, about 37.2 mg, about 37.3 mg, about 37.4 mg, about 37.5 mg, about 37.6 mg, about 37.7 mg, about 37.8 mg, about 37.9 mg, about 38 mg, about 38.1 mg, about 38.2 mg, about 38.3 mg, about 38.4 mg, about 38.5 mg, about 38.6 mg, about 38.7 mg, about 38.8 mg, about 38.9 mg, about 39 mg, about 39.1 mg, about 39.2 mg, about 39.3 mg, about 39.4 mg, about 39.5 mg, about 39.6 mg, about 39.7 mg, about 39.8 mg, about 39.9 mg and about 40 mg.
79. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: 40 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, 42.8 mg, 42.9 mg, 43 mg, 43.1 mg, 43.2 mg, 43.3 mg, 43.4 mg, 43.5 mg, 43.6 mg, 43.7 mg, 43.8 mg, 43.9 mg, 44 mg, 44.1 mg, 44.2 mg, 44.3 mg, 44.4 mg, 44.5 mg, 44.6 mg, 44.7 mg, 44.8 mg, 44.9 mg, 45 mg, 45.1 mg, 45.2 mg, 45.3 mg, 45.4 mg, 45.5 mg, 45.6 mg, 45.7 mg, 45.8 mg, 45.9 mg, 46 mg, 46.1 mg, 46.2 mg, 46.3 mg, 46.4 mg, 46.5 mg, 46.6 mg, 46.7 mg, 46.8 mg, 46.9 mg, 47 mg, 47.1 mg, 47.2 mg, 47.3 mg, 47.4 mg, 47.5 mg, 47.6 mg, 47.7 mg, 47.8 mg, 47.9 mg, 48 mg, 48.1 mg, 48.2 mg, 48.3 mg, 48.4 mg, 48.5 mg, 48.6 mg, 48.7 mg, 48.8 mg, 48.9 mg, 49 mg, 49.1 mg, 49.2 mg, 49.3 mg, 49.4 mg, 49.5 mg, 49.6 mg, 49.7 mg, 49.8 mg, 49.9 mg, 50 mg, 50.1 mg, 50.2 mg, 50.3 mg, 50.4 mg, 50.5 mg, 50.6 mg, 50.7 mg, 50.8 mg, 50.9 mg, 51 mg, 51.1 mg, 51.2 mg, 51.3 mg, 51.4 mg, 51.5 mg, 51.6 mg, 51.7 mg, 51.8 mg, 51.9 mg, 52 mg, 52.1 mg, 52.2 mg, 52.3 mg, 52.4 mg, 52.5 mg, 52.6 mg, 52.7 mg, 52.8 mg, 52.9 mg, 53 mg, 53.1 mg, 53.2 mg, 53.3 mg, 53.4 mg, 53.5 mg, 53.6 mg, 53.7 mg, 53.8 mg, 53.9 mg, 54 mg, 54.1 mg, 54.2 mg, 54.3 mg, 54.4 mg, 54.5 mg, 54.6 mg, 54.7 mg, 54.8 mg, 54.9 mg, 55 mg, 55.1 mg, 55.2 mg, 55.3 mg, 55.4 mg, 55.5 mg, 55.6 mg, 55.7 mg, 55.8 mg, 55.9 mg, 56 mg, 56.1 mg, 56.2 mg, 56.3 mg, 56.4 mg, 56.5 mg, 56.6 mg, 56.7 mg, 56.8 mg, 56.9 mg, 57 mg, 57.1 mg, 57.2 mg, 57.3 mg, 57.4 mg, 57.5 mg, 57.6 mg, 57.7 mg, 57.8 mg, 57.9 mg, 58 mg, 58.1 mg, 58.2 mg, 58.3 mg, 58.4 mg, 58.5 mg, 58.6 mg, 58.7 mg, 58.8 mg, 58.9 mg, 59 mg, 59.1 mg, 59.2 mg, 59.3 mg, 59.4 mg, 59.5 mg, 59.6 mg, 59.7 mg, 59.8 mg, 59.9 mg, 60 mg, 60.1 mg, 60.2 mg, 60.3 mg, 60.4 mg, 60.5 mg, 60.6 mg, 60.7 mg, 60.8 mg, 60.9 mg, 61 mg, 61.1 mg, 61.2 mg, 61.3 mg, 61.4 mg, 61.5 mg, 61.6 mg, 61.7 mg, 61.8 mg, 61.9 mg, 62 mg, 62.1 mg, 62.2 mg, 62.3 mg, 62.4 mg, 62.5 mg, 62.6 mg, 62.7 mg, 62.8 mg, 62.9 mg, 63 mg, 63.1 mg, 63.2 mg, 63.3 mg, 63.4 mg, 63.5 mg, 63.6 mg, 63.7 mg, 63.8 mg, 63.9 mg, 64 mg, 64.1 mg, 64.2 mg, 64.3 mg, 64.4 mg, 64.5 mg, 64.6 mg, 64.7 mg, 64.8 mg, 64.9 mg, 65 mg, 65.1 mg, 65.2 mg, 65.3 mg, 65.4 mg, 65.5 mg, 65.6 mg, 65.7 mg, 65.8 mg, 65.9 mg, 66 mg, 66.1 mg, 66.2 mg, 66.3 mg, 66.4 mg, 66.5 mg, 66.6 mg, 66.7 mg, 66.8 mg, 66.9 mg, 67 mg, 67.1 mg, 67.2 mg, 67.3 mg, 67.4 mg, 67.5 mg, 67.6 mg, 67.7 mg, 67.8 mg, 67.9 mg, 68 mg, 68.1 mg, 68.2 mg, 68.3 mg, 68.4 mg, 68.5 mg, 68.6 mg, 68.7 mg, 68.8 mg, 68.9 mg, 69 mg, 69.1 mg, 69.2 mg, 69.3 mg, 69.4 mg, 69.5 mg, 69.6 mg, 69.7 mg, 69.8 mg, 69.9 mg and 70 mg.
80. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: about 40 mg, about 40.1 mg, about 40.2 mg, about 40.3 mg, about 40.4 mg, about 40.5 mg, about 40.6 mg, about 40.7 mg, about 40.8 mg, about 40.9 mg, about 41 mg, about 41.1 mg, about 41.2 mg, about 41.3 mg, about 41.4 mg, about 41.5 mg, about 41.6 mg, about 41.7 mg, about 41.8 mg, about 41.9 mg, about 42 mg, about 42.1 mg, about 42.2 mg, about 42.3 mg, about 42.4 mg, about 42.5 mg, about 42.6 mg, about 42.7 mg, about 42.8 mg, about 42.9 mg, about 43 mg, about 43.1 mg, about 43.2 mg, about 43.3 mg, about 43.4 mg, about 43.5 mg, about 43.6 mg, about 43.7 mg, about 43.8 mg, about 43.9 mg, about 44 mg, about 44.1 mg, about 44.2 mg, about 44.3 mg, about 44.4 mg, about 44.5 mg, about 44.6 mg, about 44.7 mg, about 44.8 mg, about 44.9 mg, about 45 mg, about 45.1 mg, about 45.2 mg, about 45.3 mg, about 45.4 mg, about 45.5 mg, about 45.6 mg, about 45.7 mg, about 45.8 mg, about 45.9 mg, about 46 mg, about 46.1 mg, about 46.2 mg, about 46.3 mg, about 46.4 mg, about 46.5 mg, about 46.6 mg, about 46.7 mg, about 46.8 mg, about 46.9 mg, about 47 mg, about 47.1 mg, about 47.2 mg, about 47.3 mg, about 47.4 mg, about 47.5 mg, about 47.6 mg, about 47.7 mg, about 47.8 mg, about 47.9 mg, about 48 mg, about 48.1 mg, about 48.2 mg, about 48.3 mg, about 48.4 mg, about 48.5 mg, about 48.6 mg, about 48.7 mg, about 48.8 mg, about 48.9 mg, about 49 mg, about 49.1 mg, about 49.2 mg, about 49.3 mg, about 49.4 mg, about 49.5 mg, about 49.6 mg, about 49.7 mg, about 49.8 mg, about 49.9 mg, about 50 mg, about 50.1 mg, about 50.2 mg, about 50.3 mg, about 50.4 mg, about 50.5 mg, about 50.6 mg, about 50.7 mg, about 50.8 mg, about 50.9 mg, about 51 mg, about 51.1 mg, about 51.2 mg, about 51.3 mg, about 51.4 mg, about 51.5 mg, about 51.6 mg, about 51.7 mg, about 51.8 mg, about 51.9 mg, about 52 mg, about 52.1 mg, about 52.2 mg, approximately 52.3 mg, approximately 52.4 mg, approximately 52.5 mg, approximately 52.6 mg, approximately 52.7 mg, approximately 52.8 mg, approximately 52.9 mg, approximately 53 mg, approximately 53.1 mg, approximately 53.2 mg, approximately 53.3 mg, approximately 53.4 mg, approximately 53.5 mg, approximately 53.6 mg, approximately 53.7 mg, approximately 53.8 mg, approximately 53.9 mg, approximately 54 mg, approximately 54.1 mg, approximately 54.2 mg, approximately 54.3 mg, approximately 54.4 mg, approximately 54.5 mg, approximately 54.6 mg, approximately 54.7 mg, approximately 54.8 mg, approximately 54.9 mg, approximately 55 mg, approximately 55.1 mg, approximately 55.2 mg, approximately 55.3 mg, approximately 55.4 mg, approximately 55.5 mg, approximately 55.6 mg, approximately 55.7 mg, approximately 55.8 mg, approximately 55.9 mg, approximately 56 mg, approximately 56.1 mg, approximately 56.2 mg, approximately 56.3 mg, approximately 56.4 mg, approximately 56.5 mg, approximately 56.6 mg, approximately 56.7 mg, approximately 56.8 mg, approximately 56.9 mg, approximately 57 mg, approximately 57.1 mg, approximately 57.2 mg, approximately 57.3 mg, approximately 57.4 mg, approximately 57.5 mg, approximately 57.6 mg, approximately 57.7 mg, approximately 57.8 mg, approximately 57.9 mg, approximately 58 mg, approximately 58.1 mg, approximately 58.2 mg, approximately 58.3 mg, approximately 58.4 mg, approximately 58.5 mg, approximately 58.6 mg, approximately 58.7 mg, approximately 58.8 mg, approximately 58.9 mg, approximately 59 mg, approximately 59.1 mg, approximately 59.2 mg, approximately 59.3 mg, approximately 59.4 mg, approximately 59.5 mg, approximately 59.6 mg, approximately 59.7 mg, approximately 59.8 mg, approximately 59.9 mg, approximately 60 mg, approximately 60.1 mg, approximately 60.2 mg, approximately 60.3 mg, approximately 60.4 mg, approximately 60.5 mg, approximately 60.6 mg, approximately 60.7 mg, approximately 60.8 mg, approximately 60.9 mg, approximately 61 mg, approximately 61.1 mg, approximately 61.2 mg, approximately 61.3 mg, approximately 61.4 mg, approximately 61.5 mg, approximately 61.6 mg, approximately 61.7 mg, approximately 61.8 mg, approximately 61.9 mg, approximately 62 mg, approximately 62.1 mg, approximately 62.2 mg, approximately 62.3 mg, approximately 62.4 mg, approximately 62.5 mg, approximately 62.6 mg, approximately 62.7 mg, approximately 62.8 mg, approximately 62.9 mg, approximately 63 mg, approximately 63.1 mg, approximately 63.2 mg, approximately 63.3 mg, approximately 63.4 mg, approximately 63.5 mg, approximately 63.6 mg, approximately 63.7 mg, approximately 63.8 mg, approximately 63.9 mg, approximately 64 mg, approximately 64.1 mg, approximately 64.2 mg, approximately 64.3 mg, approximately 64.4 mg, approximately 64.5 mg, approximately 64.6 mg, approximately 64.7 mg, approximately 64.8 mg, approximately 64.9 mg, about 65 mg, about 65.1 mg, about 65.2 mg, about 65.3 mg, about 65.4 mg, about 65.5 mg, about 65.6 mg, about 65.7 mg, about 65.8 mg, about 65.9 mg, about 66 mg, about 66.1 mg, about 66.2 mg, about 66.3 mg, about 66.4 mg, about 66.5 mg, about 66.6 mg, about 66.7 mg, about 66.8 mg, about 66.9 mg, about 67 mg, about 67.1 mg, about 67.2 mg, about 67.3 mg, about 67.4 mg, about 67.5 mg, about 67.6 mg, about 67.7 mg, about 67.8 mg, about 67.9 mg, about 68 mg, about 68.1 mg, about 68.2 mg, about 68.3 mg, about 68.4 mg, about 68.5 mg, about 68.6 mg, about 68.7 mg, about 68.8 mg, about 68.9 mg, about 69 mg, about 69.1 mg, about 69.2 mg, about 69.3 mg, about 69.4 mg, about 69.5 mg, about 69.6 mg, about 69.7 mg, about 69.8 mg, about 69.9 mg and about 70 mg.
81. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: 70 mg, 70.1 mg, 70.2 mg, 70.3 mg, 70.4 mg, 70.5 mg, 70.6 mg, 70.7 mg, 70.8 mg, 70.9 mg, 71 mg, 71.1 mg, 71.2 mg, 71.3 mg, 71.4 mg, 71.5 mg, 71.6 mg, 71.7 mg, 71.8 mg, 71.9 mg, 72 mg, 72.1 mg, 72.2 mg, 72.3 mg, 72.4 mg, 72.5 mg, 72.6 mg, 72.7 mg, 72.8 mg, 72.9 mg, 73 mg, 73.1 mg, 73.2 mg, 73.3 mg, 73.4 mg, 73.5 mg, 73.6 mg, 73.7 mg, 73.8 mg, 73.9 mg, 74 mg, 74.1 mg, 74.2 mg, 74.3 mg, 74.4 mg, 74.5 mg, 74.6 mg, 74.7 mg, 74.8 mg, 74.9 mg, 75 mg, 75.1 mg, 75.2 mg, 75.3 mg, 75.4 mg, 75.5 mg, 75.6 mg, 75.7 mg, 75.8 mg, 75.9 mg, 76 mg, 76.1 mg, 76.2 mg, 76.3 mg, 76.4 mg, 76.5 mg, 76.6 mg, 76.7 mg, 76.8 mg, 76.9 mg, 77 mg, 77.1 mg, 77.2 mg, 77.3 mg, 77.4 mg, 77.5 mg, 77.6 mg, 77.7 mg, 77.8 mg, 77.9 mg, 78 mg, 78.1 mg, 78.2 mg, 78.3 mg, 78.4 mg, 78.5 mg, 78.6 mg, 78.7 mg, 78.8 mg, 78.9 mg, 79 mg, 79.1 mg, 79.2 mg, 79.3 mg, 79.4 mg, 79.5 mg, 79.6 mg, 79.7 mg, 79.8 mg, 79.9 mg, 80 mg, 80.1 mg, 80.2 mg, 80.3 mg, 80.4 mg, 80.5 mg, 80.6 mg, 80.7 mg, 80.8 mg, 80.9 mg, 81 mg, 81.1 mg, 81.2 mg, 81.3 mg, 81.4 mg, 81.5 mg, 81.6 mg, 81.7 mg, 81.8 mg, 81.9 mg, 82 mg, 82.1 mg, 82.2 mg, 82.3 mg, 82.4 mg, 82.5 mg, 82.6 mg, 82.7 mg, 82.8 mg, 82.9 mg, 83 mg, 83.1 mg, 83.2 mg, 83.3 mg, 83.4 mg, 83.5 mg, 83.6 mg, 83.7 mg, 83.8 mg, 83.9 mg, 84 mg, 84.1 mg, 84.2 mg, 84.3 mg, 84.4 mg, 84.5 mg, 84.6 mg, 84.7 mg, 84.8 mg, 84.9 mg, 85 mg, 85.1 mg, 85.2 mg, 85.3 mg, 85.4 mg, 85.5 mg, 85.6 mg, 85.7 mg, 85.8 mg, 85.9 mg, 86 mg, 86.1 mg, 86.2 mg, 86.3 mg, 86.4 mg, 86.5 mg, 86.6 mg, 86.7 mg, 86.8 mg, 86.9 mg, 87 mg, 87.1 mg, 87.2 mg, 87.3 mg, 87.4 mg, 87.5 mg, 87.6 mg, 87.7 mg, 87.8 mg, 87.9 mg, 88 mg, 88.1 mg, 88.2 mg, 88.3 mg, 88.4 mg, 88.5 mg, 88.6 mg, 88.7 mg, 88.8 mg, 88.9 mg, 89 mg, 89.1 mg, 89.2 mg, 89.3 mg, 89.4 mg, 89.5 mg, 89.6 mg, 89.7 mg, 89.8 mg, 89.9 mg, 90 mg, 90.1 mg, 90.2 mg, 90.3 mg, 90.4 mg, 90.5 mg, 90.6 mg, 90.7 mg, 90.8 mg, 90.9 mg, 91 mg, 91.1 mg, 91.2 mg, 91.3 mg, 91.4 mg, 91.5 mg, 91.6 mg, 91.7 mg, 91.8 mg, 91.9 mg, 92 mg, 92.1 mg, 92.2 mg, 92.3 mg, 92.4 mg, 92.5 mg, 92.6 mg, 92.7 mg, 92.8 mg, 92.9 mg, 93 mg, 93.1 mg, 93.2 mg, 93.3 mg, 93.4 mg, 93.5 mg, 93.6 mg, 93.7 mg, 93.8 mg, 93.9 mg, 94 mg, 94.1 mg, 94.2 mg, 94.3 mg, 94.4 mg, 94.5 mg, 94.6 mg, 94.7 mg, 94.8 mg, 94.9 mg, 95 mg, 95.1 mg, 95.2 mg, 95.3 mg, 95.4 mg, 95.5 mg, 95.6 mg, 95.7 mg, 95.8 mg, 95.9 mg, 96 mg, 96.1 mg, 96.2 mg, 96.3 mg, 96.4 mg, 96.5 mg, 96.6 mg, 96.7 mg, 96.8 mg, 96.9 mg, 97 mg, 97.1 mg, 97.2 mg, 97.3 mg, 97.4 mg, 97.5 mg, 97.6 mg, 97.7 mg, 97.8 mg, 97.9 mg, 98 mg, 98.1 mg, 98.2 mg, 98.3 mg, 98.4 mg, 98.5 mg, 98.6 mg, 98.7 mg, 98.8 mg, 98.9 mg, 99 mg, 99.1 mg, 99.2 mg, 99.3 mg, 99.4 mg, 99.5 mg, 99.6 mg, 99.7 mg, 99.8 mg and 99.9 mg.
82. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: about 70 mg, about 70.1 mg, about 70.2 mg, about 70.3 mg, about 70.4 mg, about 70.5 mg, about 70.6 mg, about 70.7 mg, about 70.8 mg, about 70.9 mg, about 71 mg, about 71.1 mg, about 71.2 mg, about 71.3 mg, about 71.4 mg, about 71.5 mg, about 71.6 mg, about 71.7 mg, about 71.8 mg, about 71.9 mg, about 72 mg, about 72.1 mg, about 72.2 mg, about 72.3 mg, about 72.4 mg, about 72.5 mg, about 72.6 mg, about 72.7 mg, about 72.8 mg, about 72.9 mg, about 73 mg, about 73.1 mg, about 73.2 mg, about 73.3 mg, about 73.4 mg, about 73.5 mg, about 73.6 mg, about 73.7 mg, about 73.8 mg, about 73.9 mg, about 74 mg, about 74.1 mg, about 74.2 mg, about 74.3 mg, about 74.4 mg, about 74.5 mg, about 74.6 mg, about 74.7 mg, about 74.8 mg, about 74.9 mg, about 75 mg, about 75.1 mg, about 75.2 mg, about 75.3 mg, about 75.4 mg, about 75.5 mg, about 75.6 mg, about 75.7 mg, about 75.8 mg, about 75.9 mg, about 76 mg, about 76.1 mg, about 76.2 mg, about 76.3 mg, about 76.4 mg, about 76.5 mg, about 76.6 mg, about 76.7 mg, about 76.8 mg, about 76.9 mg, about 77 mg, about 77.1 mg, about 77.2 mg, about 77.3 mg, about 77.4 mg, about 77.5 mg, about 77.6 mg, about 77.7 mg, about 77.8 mg, about 77.9 mg, about 78 mg, about 78.1 mg, about 78.2 mg, about 78.3 mg, about 78.4 mg, about 78.5 mg, about 78.6 mg, about 78.7 mg, about 78.8 mg, about 78.9 mg, about 79 mg, about 79.1 mg, about 79.2 mg, about 79.3 mg, about 79.4 mg, about 79.5 mg, about 79.6 mg, about 79.7 mg, about 79.8 mg, about 79.9 mg, about 80 mg, about 80.1 mg, about 80.2 mg, about 80.3 mg, about 80.4 mg, about 80.5 mg, about 80.6 mg, about 80.7 mg, about 80.8 mg, about 80.9 mg, about 81 mg, about 81.1 mg, about 81.2 mg, about 81.3 mg, about 81.4 mg, about 81.5 mg, about 81.6 mg, about 81.7 mg, about 81.8 mg, about 81.9 mg, about 82 mg, about 82.1 mg, about 82.2 mg, approximately 82.3 mg, approximately 82.4 mg, approximately 82.5 mg, approximately 82.6 mg, approximately 82.7 mg, approximately 82.8 mg, approximately 82.9 mg, approximately 83 mg, approximately 83.1 mg, approximately 83.2 mg, approximately 83.3 mg, approximately 83.4 mg, approximately 83.5 mg, approximately 83.6 mg, approximately 83.7 mg, approximately 83.8 mg, approximately 83.9 mg, approximately 84 mg, approximately 84.1 mg, approximately 84.2 mg, approximately 84.3 mg, approximately 84.4 mg, approximately 84.5 mg, approximately 84.6 mg, approximately 84.7 mg, approximately 84.8 mg, approximately 84.9 mg, approximately 85 mg, approximately 85.1 mg, approximately 85.2 mg, approximately 85.3 mg, approximately 85.4 mg, approximately 85.5 mg, approximately 85.6 mg, approximately 85.7 mg, approximately 85.8 mg, approximately 85.9 mg, approximately 86 mg, approximately 86.1 mg, approximately 86.2 mg, approximately 86.3 mg, approximately 86.4 mg, approximately 86.5 mg, approximately 86.6 mg, approximately 86.7 mg, approximately 86.8 mg, approximately 86.9 mg, approximately 87 mg, approximately 87.1 mg, approximately 87.2 mg, approximately 87.3 mg, approximately 87.4 mg, approximately 87.5 mg, approximately 87.6 mg, approximately 87.7 mg, approximately 87.8 mg, approximately 87.9 mg, approximately 88 mg, approximately 88.1 mg, approximately 88.2 mg, approximately 88.3 mg, approximately 88.4 mg, approximately 88.5 mg, approximately 88.6 mg, approximately 88.7 mg, approximately 88.8 mg, approximately 88.9 mg, approximately 89 mg, approximately 89.1 mg, approximately 89.2 mg, approximately 89.3 mg, approximately 89.4 mg, approximately 89.5 mg, approximately 89.6 mg, approximately 89.7 mg, approximately 89.8 mg, approximately 89.9 mg, approximately 90 mg, approximately 90.1 mg, approximately 90.2 mg, approximately 90.3 mg, approximately 90.4 mg, approximately 90.5 mg, approximately 90.6 mg, approximately 90.7 mg, approximately 90.8 mg, approximately 90.9 mg, approximately 91 mg, approximately 91.1 mg, approximately 91.2 mg, approximately 91.3 mg, approximately 91.4 mg, approximately 91.5 mg, approximately 91.6 mg, approximately 91.7 mg, approximately 91.8 mg, approximately 91.9 mg, approximately 92 mg, approximately 92.1 mg, approximately 92.2 mg, approximately 92.3 mg, approximately 92.4 mg, approximately 92.5 mg, approximately 92.6 mg, approximately 92.7 mg, approximately 92.8 mg, approximately 92.9 mg, approximately 93 mg, approximately 93.1 mg, approximately 93.2 mg, approximately 93.3 mg, approximately 93.4 mg, approximately 93.5 mg, approximately 93.6 mg, approximately 93.7 mg, approximately 93.8 mg, approximately 93.9 mg, approximately 94 mg, approximately 94.1 mg, approximately 94.2 mg, approximately 94.3 mg, approximately 94.4 mg, approximately 94.5 mg, approximately 94.6 mg, approximately 94.7 mg, approximately 94.8 mg, approximately 94.9 mg, about 95 mg, about 95.1 mg, about 95.2 mg, about 95.3 mg, about 95.4 mg, about 95.5 mg, about 95.6 mg, about 95.7 mg, about 95.8 mg, about 95.9 mg, about 96 mg, about 96.1 mg, about 96.2 mg, about 96.3 mg, about 96.4 mg, about 96.5 mg, about 96.6 mg, about 96.7 mg, about 96.8 mg, about 96.9 mg, about 97 mg, about 97.1 mg, about 97.2 mg, about 97.3 mg, about 97.4 mg, about 97.5 mg, about 97.6 mg, about 97.7 mg, about 97.8 mg, about 97.9 mg, about 98 mg, about 98.1 mg, about 98.2 mg, about 98.3 mg, about 98.4 mg, about 98.5 mg, about 98.6 mg, about 98.7 mg, about 98.8 mg, about 98.9 mg, about 99 mg, about 99.1 mg, about 99.2 mg, about 99.3 mg, about 99.4 mg, about 99.5 mg, about 99.6 mg, about 99.7 mg, about 99.8 mg and about 99.9 mg.
83. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: 100 mg, 100.1 mg, 100.2 mg, 100.3 mg, 100.4 mg, 100.5 mg, 100.6 mg, 100.7 mg, 100.8 mg, 100.9 mg, 101 mg, 101.1 mg, 101.2 mg, 101.3 mg, 101.4 mg, 101.5 mg, 101.6 mg, 101.7 mg, 101.8 mg, 101.9 mg, 102 mg, 102.1 mg, 102.2 mg, 102.3 mg, 102.4 mg, 102.5 mg, 102.6 mg, 102.7 mg, 102.8 mg, 102.9 mg, 103 mg, 103.1 mg, 103.2 mg, 103.3 mg, 103.4 mg, 103.5 mg, 103.6 mg, 103.7 mg, 103.8 mg, 103.9 mg, 104 mg, 104.1 mg, 104.2 mg, 104.3 mg, 104.4 mg, 104.5 mg, 104.6 mg, 104.7 mg, 104.8 mg, 104.9 mg, 105 mg, 105.1 mg, 105.2 mg, 105.3 mg, 105.4 mg, 105.5 mg, 105.6 mg, 105.7 mg, 105.8 mg, 105.9 mg, 106 mg, 106.1 mg, 106.2 mg, 106.3 mg, 106.4 mg, 106.5 mg, 106.6 mg, 106.7 mg, 106.8 mg, 106.9 mg, 107 mg, 107.1 mg, 107.2 mg, 107.3 mg, 107.4 mg, 107.5 mg, 107.6 mg, 107.7 mg, 107.8 mg, 107.9 mg, 108 mg, 108.1 mg, 108.2 mg, 108.3 mg, 108.4 mg, 108.5 mg, 108.6 mg, 108.7 mg, 108.8 mg, 108.9 mg, 109 mg, 109.1 mg, 109.2 mg, 109.3 mg, 109.4 mg, 109.5 mg, 109.6 mg, 109.7 mg, 109.8 mg, 109.9 mg, 110 mg, 110.1 mg, 110.2 mg, 110.3 mg, 110.4 mg, 110.5 mg, 110.6 mg, 110.7 mg, 110.8 mg, 110.9 mg, 111 mg, 111.1 mg, 111.2 mg, 111.3 mg, 111.4 mg, 111.5 mg, 111.6 mg, 111.7 mg, 111.8 mg, 111.9 mg, 112 mg, 112.1 mg, 112.2mg, 112.3mg, 112.4mg, 112.5mg, 112.6mg, 112.7mg, 112.8mg, 112.9mg, 113mg, 113.1mg, 113.2mg, 113.3mg, 113.4mg, 113.5mg, 113.6mg, 113.7mg, 113.8mg, 113.9mg, 114mg, 114.1mg, 114.2mg, 114.3mg, 114.4mg, 114.5mg, 114.6mg, 114.7mg, 114.8mg, 114.9mg, 115mg, 115.1mg, 115.2mg, 115.3mg, 115.4mg, 115.5mg, 115.6mg, 115.7mg, 115.8mg, 115.9mg, 116mg, 116.1mg, 116.2mg, 116.3mg, 116.4mg, 116.5mg, 116.6mg, 116.7mg, 116.8mg, 116.9mg, 117mg, 117.1mg, 117.2mg, 117.3mg, 117.4mg, 117.5mg, 117.6mg, 117.7mg, 117.8mg, 117.9mg, 118mg, 118.1mg, 118.2mg, 118.3mg, 118.4mg, 118.5mg, 118.6mg, 118.7mg, 118.8mg, 118.9mg, 119mg, 119.1mg, 119.2mg, 119.3mg, 119.4mg, 119.5mg, 119.6mg, 119.7mg, 119.8mg, 119.9mg, 120mg, 120.1mg, 120.2mg, 120.3mg, 120.4mg, 120.5mg, 120.6mg, 120.7mg, 120.8mg, 120.9mg, 121mg, 121.1mg, 121.2mg, 121.3mg, 121.4mg, 121.5mg, 121.6mg, 121.7mg, 121.8mg, 121.9mg, 122mg, 122.1mg, 122.2mg, 122.3mg, 122.4mg, 122.5mg, 122.6mg, 122.7mg, 122.8mg, 122.9mg, 123mg, 123.1mg, 123.2mg, 123.3mg, 123.4mg, 123.5mg, 123.6mg, 123.7mg, 123.8mg, 123.9mg, 124mg, 124.1mg, 124.2mg, 124.3mg, 124.4mg, 124.5mg, 124.6mg, 124.7mg, 124.8mg, 124.9 mg and 125 mg.
84. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: about 100 mg, about 100.1 mg, about 100.2 mg, about 100.3 mg, about 100.4 mg, about 100.5 mg, about 100.6 mg, about 100.7 mg, about 100.8 mg, about 100.9 mg, about 101 mg, about 101.1 mg, about 101.2 mg, about 101.3 mg, about 101.4 mg, about 101.5 mg, about 101.6 mg, about 101.7 mg, about 101.8 mg, about 101.9 mg, about 102 mg, about 102.1 mg, about 102.2 mg, about 102.3 mg, about 102.4 mg, about 102.5 mg, about 102.6 mg, about 102.7 mg, about 102.8 mg, about 102.9 mg, about 103 mg, about 103.1 mg, about 103.2 mg, about 103.3 mg, about 103.4 mg, about 103.5 mg, about 103.6 mg, about 103.7 mg, about 103.8 mg, about 103.9 mg, about 104 mg, about 104.1 mg, about 104.2 mg, about 104.3 mg, about 104.4 mg, about 104.5 mg, about 104.6 mg, about 104.7 mg, about 104.8 mg, about 104.9 mg, about 105 mg, about 105.1 mg, about 105.2 mg, about 105.3 mg, about 105.4 mg, about 105.5 mg, about 105.6 mg, about 105.7 mg, about 105.8 mg, about 105.9 mg, about 106 mg, about 106.1 mg, about 106.2 mg, about 106.3 mg, about 106.4 mg, about 106.5 mg, about 106.6 mg, about 106.7 mg, about 106.8 mg, about 106.9 mg, about 107 mg, about 107.1 mg, about 107.2 mg, about 107.3 mg, about 107.4 mg, about 107.5 mg, about 107.6 mg, about 107.7 mg, about 107.8 mg, about 107.9 mg, about 108 mg, about 108.1 mg, about 108.2 mg, about 108.3 mg, about 108.4 mg, about 108.5 mg, about 108.6 mg, about 108.7 mg, about 108.8 mg, about 108.9 mg, about 109 mg, about 109.1 mg, about 109.2 mg, about 109.3 mg, about 109.4 mg, about 109.5 mg, about 109.6 mg, about 109.7 mg, about 109.8 mg, about 109.9 mg, about 110 mg, about 110.1 mg, about 110.2 mg, about 110.3 mg, about 110.4 mg, about 110.5 mg, about 110.6 mg, about 110.7 mg, about 110.8 mg, about 110.9 mg, about 111 mg, about 111.1 mg, about 111.2 mg, about 111.3 mg, about 111.4 mg, about 111.5 mg, about 111.6 mg, about 111.7 mg, about 111.8 mg, about 111.9 mg, about 112 mg, about 112.1 mg, about 112.2 mg, about 112.3 mg, about 112.4 mg, about 112.5 mg, about 112.6 mg, about 112.7 mg, about 112.8 mg, about 112.9 mg, about 113 mg, about 113.1 mg, about 113.2 mg, about 113.3 mg, about 113.4 mg, about 113.5 mg, about 113.6 mg, about 113.7 mg, about 113.8 mg, about 113.9 mg, about 114 mg, about 114.1 mg, about 114.2 mg, about 114.3 mg, about 114.4 mg, about 114.5 mg, about 114.6 mg, about 114.7 mg, about 114.8 mg, about 114.9 mg, about 115 mg, about 115.1 mg, about 115.2 mg, about 115.3 mg, about 115.4 mg, about 115.5 mg, about 115.6 mg, about 115.7 mg, about 115.8 mg, about 115.9 mg, about 116 mg, about 116.1 mg, about 116.2 mg, about 116.3 mg, about 116.4 mg, about 116.5 mg, about 116.6 mg, about 116.7 mg, about 116.8 mg, about 116.9 mg, about 117 mg, about 117.1 mg, about 117.2 mg, about 117.3 mg, about 117.4 mg, about 117.5 mg, about 117.6 mg, about 117.7 mg, about 117.8 mg, about 117.9 mg, about 118 mg, about 118.1 mg, about 118.2 mg, about 118.3 mg, about 118.4 mg, about 118.5 mg, about 118.6 mg, about 118.7 mg, about 118.8 mg, about 118.9 mg, about 119 mg, about 119.1 mg, about 119.2 mg, about 119.3 mg, about 119.4 mg, about 119.5 mg, about 119.6 mg, about 119.7 mg, about 119.8 mg, about 119.9 mg, about 120 mg, about 120.1 mg, about 120.2 mg, about 120.3 mg, about 120.4 mg, about 120.5 mg, about 120.6 mg, about 120.7 mg, about 120.8 mg, about 120.9 mg, about 121 mg, about 121.1 mg, about 121.2 mg, about 121.3 mg, about 121.4 mg, about 121.5 mg, about 121.6 mg, about 121.7 mg, about 121.8 mg, about 121.9 mg, about 122 mg, about 122.1 mg, about 122.2 mg, about 122.3 mg, about 122.4 mg, about 122.5 mg, about 122.6 mg, about 122.7 mg, about 122.8 mg, about 122.9 mg, about 123 mg, about 123.1 mg, about 123.2 mg, about 123.3 mg, about 123.4 mg, about 123.5 mg, about 123.6 mg, about 123.7 mg, about 123.8 mg, about 123.9 mg, about 124 mg, about 124.1 mg, about 124.2 mg, about 124.3 mg, about 124.4 mg, about 124.5 mg, about 124.6 mg, about 124.7 mg, about 124.8 mg, about 124.9 mg and about 125 mg.
85. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is in the range of any one of the following: 10 mg to 200 mg, 10 mg to 190 mg, 10 mg to 180 mg, 10 mg to 170 mg, 10 mg to 160 mg, 10 mg to 150 mg, 10 mg to 140 mg, 10 mg to 120 mg, 10 mg to 110 mg, 10 mg to 100 mg, 10 mg to 80 mg, 10 mg to 70 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, 10 mg to 20 mg, 20 mg to 200 mg, 20 mg to 190 mg, 20 mg to 180 mg, 20 mg to 170 mg, 20 mg to 160 mg, 20 mg to 150 mg, 20 mg to 140 mg, 20 mg to 120 mg, 20 mg to 110 mg, 20 mg to 100 mg, 20 mg to 80 mg, 20 mg to 70 mg, 20 mg to 60 mg, 20 mg to 50 mg, 20 mg to 10 mg, 20 mg to 30 mg, 30 mg to 200 mg, 30 mg to 190 mg, 30 mg to 180 mg, 30 mg to 170 mg, 30 mg to 160 mg, 30 mg to 150 mg, 30 mg to 140 mg, 30 mg to 120 mg, 30 mg to 110 mg, 30 mg to 100 mg, 30 mg to 80 mg, 30 mg to 70 mg, 30 mg to 60 mg, 30 mg to 50 mg, 30 mg to 20 mg, 40 mg to 200 mg, 40 mg to 190 mg, 40 mg to 180 mg, 40 mg to 170 mg, 40 mg to 160 mg, 40 mg to 150 mg, 40 mg to 140 mg, 40 mg to 120 mg, 40 mg to 110 mg, 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 200 mg, 50 mg to 190 mg, 50 mg to 180 mg, 50 mg to 170 mg, 50 mg to 160 mg, 50 mg to 150 mg, 50 mg to 140 mg, 50 mg to 120 mg, 50 mg to 110 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 200 mg, 60 mg to 190 mg, 60 mg to 180 mg, 60 mg to 170 mg, 60 mg to 160 mg, 60 mg to 150 mg, 60 mg to 140 mg, 60 mg to 120 mg, 60 mg to 110 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 200 mg, 70 mg to 190 mg,70 mg to 180 mg, 70 mg to 170 mg, 70 mg to 160 mg, 70 mg to 150 mg, 70 mg to 140 mg, 70 mg to 120 mg, 70 mg to 110 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 200 mg, 80 mg to 190 mg, 80 mg to 180 mg, 80 mg to 170 mg, 80 mg to 160 mg, 80 mg to 150 mg, 80 mg to 140 mg, 80 mg to 120 mg, 80 mg to 110 mg, 80 mg to 100 mg, 80 mg to 90 mg, 90 mg to 200 mg, 90 mg to 190 mg, 90 mg to 180 mg, 90 mg to 170 mg, 90 mg to 160 mg, 90 mg to 150 mg, 90 mg to 140 mg, 90 mg to 120 mg, 90 mg to 110 mg, 90 mg to 100 mg, 100 mg to 200 mg, 100 mg to 190 mg, 100 mg to 180 mg, 100 mg to 170 mg, 100 mg to 160 mg, 100 mg to 150 mg, 100 mg to 140 mg, 100 mg to 120 mg, 100 mg to 110 mg, 110 mg to 200 mg, 110 mg to 190 mg, 110 mg to 180 mg, 110 mg to 170 mg, 110 mg to 160 mg, 110 mg to 150 mg, 110 mg to 140 mg, 110 mg to 130 mg, 110 mg to 120 mg, 120 mg to 200 mg, 120 mg to 190 mg, 120 mg to 180 mg, 120 mg to 170 mg, 120 mg to 160 mg, 120 mg to 150 mg, 120 mg to 140 mg, 120 mg to 130 mg, 130 mg to 200 mg, 130 mg to 190 mg, 130 mg to 180 mg, 130 mg to 170 mg, 130 mg to 160 mg, 130 mg to 150 mg, 130 mg to 140 mg, 140 mg to 200 mg, 140 mg to 190 mg, 140 mg to 180 mg, 140 mg to 170 mg, 140 mg to 160 mg, 140 mg to 150 mg, 150 mg to 200 mg, 150 mg to 190 mg, 150 mg to 180 mg, 150 mg to 170 mg, 150 mg to 160 mg, 160 mg to 200 mg, 160 mg to 190 mg, 160 mg to 180 mg, 160 mg to 170 mg, 180 mg to 200 mg, 180 mg to 190 mg, 190 mg to 200 mg, 105 mg to 135 mg, 105 mg to 130 mg, 105 mg to 125 mg, 105 mg to 120 mg, 110 mg to 135 mg110 mg to 130 mg, 110 mg to 125 mg, 110 mg to 120 mg, 115 mg to 135 mg, 115 mg to 130 mg, 115 mg to 125 mg, 115 mg to 120 mg, 115 mg to 125 mg, 115 mg to 120 mg, 120 mg to 135 mg, 120 mg to 125 mg, 125 mg to 140 mg, 125 mg to 130 mg, 130 mg to 135 mg, 135 mg to 140 mg, 120 mg to 129 mg, 120 mg to 128 mg, 120 mg to 127 mg, 120 mg to 86 mg, 120 mg to 124 mg, 120 mg to 123 mg, 120 mg to 122 mg, 120 mg to 121 mg, 121 mg to 130 mg, 122 mg to 129 mg, 122 mg to 128 mg, 122 mg to 127 mg, 122 mg to 126 mg, 122 mg to 125 mg, 122 mg to 124 mg, 122 mg to 123 mg, 123 mg to 130 mg, 123 mg to 129 mg, 123 mg to 128 mg, 123 mg to 127 mg, 123 mg to 126 mg, 123 mg to 125 mg, 123 mg to 124 mg, 124 mg to 130 mg, 124 mg to 129 mg, 124 mg to 128 mg, 124 mg to 127 mg, 124 mg to 126 mg, 124 mg to 125 mg, 125 mg to 129 mg, 125 mg to 128 mg, 125 mg to 127 mg, 125 mg to 126 mg, 126 mg to 130 mg, 126 mg to 129 mg, 126 mg to 128 mg, 126 mg to 127 mg, 127 mg to 130 mg, 127 mg to 129 mg, 127 mg to 128 mg, 128 mg to 130 mg, 128 mg to 129 mg, and 129 mg to 130 mg.
86. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is from 1 mg to any one of the following: less than 350 mg, less than 345 mg, less than 340 mg, less than 335 mg, less than 330 mg, less than 325 mg, less than 320 mg, less than 315 mg, less than 310 mg, less than 305 mg, less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg, less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.
87. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is from 1 mg to any one of the following: less than about 350 mg, less than about 345 mg, less than about 340 mg, less than about 335 mg, less than about 330 mg, less than about 325 mg, less than about 320 mg, less than about 315 mg, less than about 310 mg, less than about 305 mg, less than about 300 mg, less than about 295 mg, less than about 290 mg, less than about 285 mg, less than about 280 mg, less than about 275 mg, less than about 270 mg, less than about 265 mg, less than about 260 mg, less than about 255 mg, less than about 250 mg, less than about 245 mg, less than about 240 mg, less than about 235 mg, less than about 230 mg, less than about 225 mg, less than about 220 mg, less than about 215 mg, less than about 210 mg, less than about 205 mg, less than about 200 mg, less than about 195 mg, less than about 190 mg, less than about 185 mg, less than about 180 mg, less than about 175 mg, less than about 170 mg, less than about 165 mg, less than about 160 mg, less than about 150 mg, less than about 145 mg, less than about 140 mg, less than about 135 mg, less than about 130 mg, less than about 125 mg, less than about 120 mg, less than about 115 mg, less than about 110 mg, less than about 105 mg, less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, less than about 40 mg, less than about 35 mg, less than about 30 mg, less than about 25 mg, less than about 20 mg, less than about 15 mg, less than about 10 mg, and less than about 5 mg.
88. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, at least 150 mg, at least 155 mg, at least 160 mg, at least 165 mg, at least 170 mg, at least 175 mg, at least 180 mg, at least 185, at least 190 mg, at least 195 mg, and at least 200 mg.
89. The method according to any one of claims 1 to 62, wherein the therapeutically effective amount is any one of the following: at least about 5 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, or at least about 150 mg, at least about 155 mg, at least about 160 mg, at least about 165 mg, at least about 170 mg, at least about 175 mg, at least about 180 mg, at least about 185, at least about 190 mg, at least about 195 mg, and at least about 200 mg.
90. The method according to any one of claims 1 to 89, which comprises administering the compound once every two weeks.
91. The method according to any one of claims 1 to 89, which comprises administering the compound once every four weeks.
92. The method according to any one of claims 1 to 89, which comprises administering the compound once every eight weeks.
93. The method according to any one of claims 1 to 89, which comprises administering the compound once every twelve weeks.
94. The method according to any one of claims 1 to 89, which comprises administering the compound once every sixteen weeks.
95. The method according to any one of claims 1 to 89, which comprises administering the compound once every twenty weeks.
96. The method according to any one of claims 1 to 89, which comprises administering the compound once every twenty-four weeks.
97. The method according to any one of claims 1 to 89, which comprises administering the compound once every six months.
98. The method according to any one of claims 1 to 89, which comprises administering the compound approximately once every two weeks.
99. The method according to any one of claims 1 to 89, which comprises administering the compound approximately once every four weeks.
100. The method according to any one of claims 1 to 89, which comprises administering the compound approximately once every eight weeks.
101. The method according to any one of claims 1 to 89, which comprises administering the compound approximately once every twelve weeks.
102. The method according to any one of claims 1 to 89, which comprises administering the compound approximately once every sixteen weeks.
103. The method according to any one of claims 1 to 89, which comprises administering the compound approximately once every twenty weeks.
104. The method according to any one of claims 1 to 89, which comprises administering the compound approximately once every twenty-four weeks.
105. The method according to any one of claims 1 to 89, which comprises administering the compound approximately once every 6 months.
106. The method according to any one of claims 1 to 89, which comprises administering the compound approximately once every 6 months, approximately once every 7 months, approximately once every 8 months, approximately once every 9 months, approximately once every 10 months, approximately once every 11 months or approximately once every 12 months.
107. The method according to any one of claims 1 to 89, which comprises administering the compound monthly.
108. The method according to any one of claims 1 to 89, which comprises administering the compound once every two months.
109. The method according to any one of claims 1 to 89, which comprises administering the compound once every three months.
110. The method according to any one of claims 1 to 89, which comprises administering the compound quarterly.
111. The method according to any one of claims 1 to 89, which comprises administering the compound semi-annually.
112. The method according to any one of claims 1 to 89, which comprises administering the compound annually.
113. The method according to any one of claims 1 to 89, which comprises administering the compound once every two years.
114. The method according to any one of claims 1 to 89, which comprises administering the compound according to any one of the following: once every 1 week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, once every 20 weeks, once every 21 weeks, once every 22 weeks, once every 23 weeks, once every 24 weeks, monthly, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 7 months, once every 8 months, once every 9 months, once every 10 months, once every 11 months or annually.
115. The method according to any one of claims 1 to 89, which comprises administering the compound in any of the following: about once every 1 week, about once every 2 weeks, about once every 3 weeks, about once every 4 weeks, about once every 5 weeks, about once every 6 weeks, about once every 7 weeks, about once every 8 weeks, about once every 9 weeks, about once every 10 weeks, about once every 11 weeks, about once every 12 weeks, about once every 13 weeks, about once every 14 weeks, about once every 15 weeks, about once every 16 weeks, about once every 17 weeks, about once every 18 weeks, about once every 19 weeks, about once every 21 weeks, about once every 22 weeks, about once every 23 weeks, about once every 24 weeks, about once a month, about once every 2 months, about once every 3 months, about once every 4 months, about once every 5 months, about once every 6 months, about once every 7 months, about once every 8 months, about once every 9 months, about once every 10 months, about once every 11 months, or about once a year.
116. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 20 mg of the compound once every four weeks.
117. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 40 mg of the compound once every four weeks.
118. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 70 mg of the compound once every four weeks.
119. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 100 mg of the compound once every 4 weeks.
120. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 20 mg of the compound once every eight weeks.
121. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 40 mg of the compound once every eight weeks.
122. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 70 mg of the compound once every eight weeks.
123. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 100 mg of the compound once every eight weeks.
124. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 20 mg of the compound once every 12 weeks, once every 3 months, or once a quarter.
125. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 40 mg of the compound once every 12 weeks, once every 3 months, or once a quarter.
126. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 70 mg of the compound once every 12 weeks, once every 3 months, or once a quarter.
127. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 100 mg of the compound once every 12 weeks, once every 3 months, or once every quarter.
128. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 20 mg of the compound once every 6 months or twice a year.
129. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 40 mg of the compound once every 6 months or twice a year.
130. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 70 mg of the compound once every 6 months or twice a year.
131. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 100 mg of the compound once every 6 months or twice a year.
132. The method according to any one of claims 1 to 131, wherein two doses of the compound are administered.
133. The method according to any one of claims 1 to 131, wherein four doses of the compound are administered.
134. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 100 mg of the compound once every 2 weeks for a total of 3 doses, followed by administering a dose of 100 mg of the compound once every 4 weeks thereafter.
135. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 70 mg of the compound once every 2 weeks for a total of 3 doses, followed by administering a dose of 70 mg of the compound once every 4 weeks thereafter.
136. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 40 mg of the compound once every 2 weeks for a total of 3 doses, followed by administering a dose of 40 mg of the compound once every 4 weeks thereafter.
137. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 40 mg to 70 mg of the compound once every 4 weeks.
138. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of about 40 mg to about 70 mg of the compound once every 4 weeks.
139. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 40 mg to 70 mg of the compound once every 2 weeks for a total of 3 doses, followed by administering a dose of 40 mg to 70 mg of the compound once every 4 weeks thereafter.
140. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of about 40 mg to about 70 mg of the compound once every 2 weeks for a total of 3 doses, followed by administering a dose of about 40 mg to about 70 mg of the compound once every 4 weeks thereafter.
141. The method according to claim 139 or claim 140, wherein for the first 6 doses, the same amount of the compound is administered.
142. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 70 mg of the compound once every 4 weeks for a total of 3 doses, followed thereafter by administering a dose of 40 mg of the compound once every 4 weeks.
143. The method according to any one of claims 1 to 89, which comprises administering to the human subject a dose of 70 mg of the compound once every 4 weeks for a total of 3 doses, followed thereafter by administering a dose of 70 mg of the compound once every 8 weeks.
144. The method according to any one of claims 1 to 89, wherein the human subject has IgA nephropathy, and the method comprises administering to the subject a first dosing regimen comprising administering the compound once every two weeks for a total of 3 doses, and then administering a dose of 100 mg of the compound once every 4 weeks.
145. The method according to claim 128, which further comprises monitoring the safety or efficacy of the dosing regimen, stopping the administration of the first dosing regimen, and then administering to the subject a second dosing regimen comprising administering a dose of 70 mg of the compound every 4 weeks.
146. The method according to any one of claims 90 to 145, wherein 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 doses are administered.
147. The method according to any one of claims 1 to 89, which comprises administering to the human subject an initial loading dose of 70 mg of the compound.
148. The method according to claim 147, which comprises administering to the human subject a second loading dose of 70 mg of the compound 4 weeks after the initial loading dose.
149. The method according to claim 147 or claim 148, which comprises administering to the human subject a maintenance dose of 40 mg of the compound 4 weeks after the second loading dose.
150. The method according to claim 147 or claim 148, which comprises administering to the human subject a maintenance dose of 40 mg of the compound 8 weeks after the second loading dose.
151. The method according to claim 147 or claim 148, which comprises administering to the human subject a maintenance dose of 40 mg of the compound 12 weeks after the second loading dose.
152. The method according to claim 147 or claim 148, which comprises administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 4 weeks after the second loading dose and then every 4 weeks thereafter.
153. The method according to claim 147 or claim 148, which comprises administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 8 weeks after the second loading dose and every 8 weeks thereafter.
154. The method according to claim 147 or claim 148, which comprises administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 12 weeks after the second loading dose and every 12 weeks thereafter.
155. The method according to claim 147 or claim 148, which comprises administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 16 weeks after the second loading dose and every 16 weeks thereafter.
156. The method according to claim 147 or claim 148, which comprises administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 24 weeks after the second loading dose and every 24 weeks thereafter.
157. The method according to any one of claims 149 to 156, wherein at least 2, at least 3, at least 4, at least 5 or at least 6 maintenance doses are administered to the human subject.
158. The method according to any one of claims 1 to 157, wherein the compound is administered subcutaneously.
159. The method according to claim 145, wherein the compound is administered by injection.
160. The method according to any one of claims 1 to 159, wherein the compound is formulated as a pharmaceutical composition comprising the compound and a pharmaceutically acceptable diluent.
161. The method according to claim 160, wherein the pharmaceutically acceptable diluent is sterile water, sterile saline or sterile phosphate buffered saline.
162. The method according to any one of claims 1 to 161, wherein the compound is co-administered with an angiotensin converting enzyme inhibitor, an angiotensin receptor blocker, a sodium / glucose co-transporter-2 inhibitor, an anti-complement agent or a complement inhibitor.
163. A method of improving IgA nephropathy, improving geographic atrophy, reducing CFB protein or reducing CFB RNA in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound according to the following chemical structure: (SEQ ID NO:4), or a pharmaceutically acceptable salt thereof.
164. The method according to claim 163, wherein the compound is a sodium salt or a potassium salt.
165. A method of improving IgA nephropathy, improving geographic atrophy, reducing CFB protein or reducing CFB RNA in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound according to the following chemical structure: (SEQ ID NO:4).
166. A method for improving IgA nephropathy, improving geographic atrophy, reducing CFB protein or reducing CFB RNA in human subjects in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound: wherein the compound has the following chemical symbol (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C e s A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO:4); wherein, A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and GalNAc3-7 a-o'= 167. A method of ameliorating IgA nephropathy in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound having the following chemical structure: (SEQ ID NO:4), or a pharmaceutically acceptable salt thereof.
168. The method according to claim 167, wherein the compound is a sodium salt or a potassium salt.
169. A method of ameliorating IgA nephropathy in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 70 mg or about 70 mg of a compound having the following chemical structure: (SEQ ID NO:4).
170. A method of ameliorating IgA nephropathy in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 70 mg or about 70 mg of a compound, wherein the compound has the following chemical symbol (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO:4); wherein, A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and GalNAc3-7 a-o'= 171. A method of ameliorating geographic atrophy in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound having the following chemical structure: (SEQ ID NO:4), or a pharmaceutically acceptable salt thereof.
172. The method according to claim 171, wherein the compound is a sodium salt or a potassium salt.
173. A method of ameliorating geographic atrophy in a human subject in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound having the following chemical structure: (SEQ ID NO:4).
174. A method for ameliorating geographic atrophy in human subjects in need thereof, the method comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg or about 70 mg of a compound, wherein the compound has the following chemical symbol (5' to 3'): GalNAc3-7 a-o' A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO:4); wherein, A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and GalNAc3-7 a-o'= 175. The method according to any one of claims 163 to 174, which comprises administering the compound once every 4 weeks.
176. The method according to any one of claims 163 to 174, which comprises administering the compound once every 8 weeks.
177. The method according to any one of claims 163 to 174, which comprises administering the compound once every 12 weeks.
178. The method according to any one of claims 163 to 174, which comprises administering the compound once every 16 weeks.
179. The method according to any one of claims 163 to 174, which comprises administering the compound once every 24 weeks.
180. The method according to any one of claims 163 to 174, which comprises administering the compound once every 6 months.
181. The method according to any one of claims 163 to 174, which comprises administering the compound about once every 4 weeks.
182. The method according to any one of claims 163 to 174, which comprises administering the compound approximately once every 8 weeks.
183. The method according to any one of claims 163 to 174, which comprises administering the compound approximately once every 12 weeks.
184. The method according to any one of claims 163 to 174, which comprises administering the compound approximately once every 16 weeks.
185. The method according to any one of claims 163 to 174, which comprises administering the compound approximately once every 24 weeks.
186. The method according to any one of claims 163 to 174, which comprises administering the compound approximately once every 6 months.
187. The method according to any one of claims 163 to 174, which comprises administering a 40 mg dose of the compound to the human subject once every four weeks.
188. The method according to any one of claims 163 to 174, which comprises administering a 70 mg dose of the compound to the human subject once every four weeks.
189. The method according to any one of claims 163 to 174, which comprises administering a 100 mg dose of the compound to the human subject once every four weeks.
190. The method according to any one of claims 163 to 174, wherein the compound is administered by injection.
191. The method according to any one of claims 163 to 190, wherein the compound is formulated as a pharmaceutical composition comprising the compound and a pharmaceutically acceptable diluent.
192. The method according to claim 191, wherein the pharmaceutically acceptable diluent is sterile water, sterile saline, or sterile phosphate buffered saline.
193. The method according to any one of claims 163 to 192, wherein administering the compound reduces the level of C3 deposition in the eye, or reduces the accumulation of C3 deposition in the eye, or slows the progression of geographic atrophy in the subject.
194. The method according to any one of claims 163 to 192, wherein in the subject, administering the compound reduces the level of plasma CFB protein, reduces serum AP activity, reduces the level of serum functional CFB, reduces the level of urinary factor B cleavage product (Ba), or reduces the level of proteinuria.
195. The method according to claim 194, wherein the urinary protein / creatinine ratio is reduced after administering the compound.
196. The method according to claim 194, wherein the level of urinary protein is reduced after administering the compound.
197. The method according to any one of claims 163 to 192, wherein administering the compound slows the progression of geographic atrophy in the subject.
198. The method according to any one of claims 163 to 193, wherein administering the compound slows the expansion of the geographic atrophy area.
199. The method according to any one of claims 163 to 193, wherein administering the compound slows the expansion of geographic atrophy into the foveal region.
200. The method according to any one of claims 163 to 193, wherein administering the compound prevents the expansion of geographic atrophy.
201. The method according to any one of claims 1 to 200, which comprises detecting the amount of CFB protein or CFB RNA in a biological sample from the human subject.
202. The method according to claim 201, wherein the biological sample is blood.
203. The method according to claim 102, wherein the biological sample is serum or plasma.
204. The method according to claim 201, wherein the biological sample is urine.
205. The method according to any one of claims 201 to 204, wherein the detection occurs before administering the compound.
206. The method according to any one of claims 201 to 204 to 178, wherein the detection occurs after administering the compound.
207. The method according to any one of claims 201 to 204, wherein the detection occurs before and after administering the compound.
208. The method according to any one of claims 201 to 207, which comprises adjusting the initial loading dose, loading dose, maintenance dose or therapeutically effective amount of the administered compound after detecting the amount of CFBRNA, CFB protein or a combination thereof.
209. The method according to any one of claims 1 to 208, which comprises analyzing the level of plasma CFB protein, the level of serum AP activity, the level of serum functional CFB, the level of urinary factor B cleavage product (Ba) or the level of urinary protein in the subject.
210. The method according to claim 209, wherein the urinary protein / creatinine ratio in a urine sample from the subject is analyzed after administering the compound.
211. The method according to claim 209, wherein the level of urinary protein in a urine sample from the subject is analyzed after administering the compound.
212. The method according to claim 210 or claim 211, wherein the analysis occurs before administering the compound, or after administering the compound, or a combination thereof.
213. The method according to claim 212, which comprises determining or adjusting the therapeutically effective amount of the compound after performing the analysis.
214. The method according to claim 212 or claim 213, which comprises performing the analysis after administering the compound and adjusting the frequency of administering the compound after performing the analysis.
Citation Information
Patent Citations
Compositions and methods for modulating complement factor b expression
WO2015168635A2