Saccharomyces cerevisiae culture with banana fragrance as well as preparation method and application of saccharomyces cerevisiae culture

Abstract

The invention belongs to the technical field of fermentation, and particularly relates to a saccharomyces cerevisiae culture with banana fragrance as well as a preparation method and application of the saccharomyces cerevisiae culture. The preparation method of the yeast culture comprises the following steps: S1, preparing a single colony plate: performing activation culture on saccharomyces cerevisiae to obtain a saccharomyces cerevisiae single colony plate; s2, shake-flask seed culture: inoculating the saccharomyces cerevisiae single colony plate into a YPD liquid culture medium for amplification culture to obtain a shake-flask seed culture solution; s3, aerobic fermentation: inoculating the shake flask seed culture solution into a fermentation tank, and performing aerobic fermentation by controlling dissolved oxygen in stages to obtain a saccharomyces cerevisiae culture; the separated saccharomyces cerevisiae L9 strain is adopted as a fermentation strain for fermentation, aerobic fermentation is performed in a staged dissolved oxygen control mode, and the prepared fermentation product is rich in banana fragrance and has the skin care effects of promoting cell proliferation and migration, promoting repair, reducing inflammatory factors and skin pigmentation and improving skin moisture content.

Description

Technical Field

[0001] The present invention relates to the technical field of fermentation, and in particular to a Saccharomyces cerevisiae culture with banana flavor, a preparation method thereof, and an application thereof. Background Art

[0002] Banana aroma is one of the very pleasant aromas favored by consumers. In the known field, the abundance of yeasts producing specific aromas in the yeast population is very small, and among them, the number of yeast strains that have been found to produce banana aroma is even rarer. The known aroma-producing yeasts that produce banana aroma generally can produce an aroma with a banana style, but this aroma is not single and pure. When producing banana aroma, other types of aromas are often accompanied, so that the simulation degree of this aroma to the real banana aroma is not high. Secondly, the abundance of yeasts with functional properties in the yeast population is very small. Currently, the known yeast fermentation products or filtrates with excellent skin care effects often have unpleasant odors.

[0003] The odors of the yeast fermentation product filtrate products produced by the fermentation of the existing technology with functional yeast strains are mainly unpleasant fermentation odors such as saliva smell, yellow rice wine smell, soy sauce smell, etc. This is mainly because these functional yeasts produce other fermentation products during the fermentation process, which bring the fermentation odor. For example, the main component of SK-II Facial Treatment Essence, the filtrate of the fermentation product of Pichia fermentans, has characteristic fermentation odor and slight acidity, and these odors are described as saliva smell by many consumers. These odors are not welcomed by consumers and cosmetics developers in the application of daily chemical products. In response to the above problems, the vast majority of manufacturers cover up the peculiar smell by adding essence for flavoring, but cannot fundamentally solve the fermentation peculiar smell. The peculiar smell usually still remains in the base flavor of the product, and remains on the skin surface after the aroma dissipates, resulting in a bad use experience and a limited scope of use.

[0004] Currently, the reported banana aroma-producing yeasts that are known and commercially available mainly originate from sake and German wheat beer. Among them, the fully ripened banana yeast pure rice gin produced in Okuizumo-cho, Shimane Prefecture, Japan is well-known for its banana aroma. Its characteristic is that, based on the rice aroma, it contains a strong banana aroma, which comes from the sake yeast 7# it uses. German wheat beer (or known as Hefeweizen beer) is also well-known for the rich fruity aroma in the beer, and the presence of banana aroma is one of its important characteristics. The banana aroma in German wheat beer is mainly produced by the special wheat beer yeast it uses, forming a characteristic German or Belgian wheat beer yeast system. However, whether it is sake or German Hefeweizen beer, the banana aroma is one of the characteristic aromas of the mixed aroma produced by aroma-producing yeasts, but it is not the only single aroma. It often also has other characteristic aromas, and finally presents a mixed aroma with a banana aroma style. For example, the banana aroma in the fully ripened banana yeast pure rice gin is not only the banana aroma, but also has the aroma of rice wine and the aroma of wine. In addition to producing the banana smell, the German wheat beer yeast also has a mixed aroma of wine aroma, clove aroma, and fruit aroma. The banana aroma is only one of the aromas it presents, rather than a single banana aroma. In the existing known public domain, there has been no report of an aroma-producing yeast that can mainly present the banana aroma or solely present the banana aroma. Second, the production of the banana aroma has a high correlation with the culture conditions of the known aroma-producing yeasts. The banana-style aroma is only produced under a narrow range of culture methods and aroma-producing conditions. For example, the aroma-producing yeast LalBrew Abbaye of German wheat beer TM , when fermenting at a lower temperature (17 - 20 °C), mainly produces a strong fruity aroma and the flavors of raisins, dates, and figs, while when fermenting at a high temperature (22 - 25 °C), it produces the typical wheat beer flavor aromas including tropical fruit aroma, spice flavor, and banana flavor.

[0005] The proportion of yeast strains with excellent efficacy in nature is extremely low, and the proportion of yeast strains with aroma-producing functions among all yeast strains is also extremely low. There has been no report in the prior art of a yeast strain that not only has excellent efficacy but also has the ability to produce aroma. In view of this, the present invention aims to provide a new strain of bacteria, and through fermentation technology, produce a yeast culture that has a natural banana aroma and at the same time has the efficacy of skin care products. Summary of the Invention

[0006] The object of the present invention is to provide a Saccharomyces cerevisiae culture with a banana flavor, its preparation method and application. This yeast culture can produce a relatively pure banana aroma, and at the same time, the product of this yeast culture has various biological activities and skin care effects.

[0007] To achieve the above object, on the one hand, the present invention provides a method for preparing a Saccharomyces cerevisiae culture with banana aroma, comprising the following steps:

[0008] S1: Preparation of single colony plate: Activate and culture Saccharomyces cerevisiae to obtain a single colony plate of Saccharomyces cerevisiae;

[0009] S2: Shake flask seed culture: Inoculate the single colony plate of Saccharomyces cerevisiae into YPD liquid medium for expanded culture to obtain shake flask seed culture solution;

[0010] S3: Aerobic fermentation: Inoculate the shake flask seed culture solution into a fermenter and carry out aerobic fermentation by controlling dissolved oxygen in stages to obtain a Saccharomyces cerevisiae culture;

[0011] In step S3, the obtained shake flask seed culture solution is inoculated into the fermentation medium of the fermenter for propagation at an inoculation amount of 5% by volume;

[0012] In step S3, controlling dissolved oxygen in stages includes at least two-stage controlled dissolved oxygen culture: The first-stage controlled dissolved oxygen culture: When OD is between 0 and 10, the ventilation rate is 0.2 - 1.8 vvm, and the fixed rotation speed is 150 rpm; The second-stage controlled dissolved oxygen culture: When OD > 10, the ventilation rate is 0.2 - 1.2 vvm, and the fixed rotation speed is 150 rpm.

[0013] According to the embodiments of the present application, the Saccharomyces cerevisiae is Saccharomyces cerevisiae L9, and Saccharomyces cerevisiae L9 is deposited in the China Center for Type Culture Collection, with the deposit number: CCTCC NO: M2024741, and the deposit date is April 22, 2024. Its spliced sequence is:

[0014] GGGGGGTCTCTACTGATTGAGGTCAACTTTAAGACATTGTTCGCCTAGACGCTCTCTTCTTATCGATAACGTTCCAATACGCTCAGTATAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTGCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAGTATCACTCACTACCAAACAGAATGTTTGAAAAGGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACAAAAATTCTTGTTTTTGACAAAAATTTAATGAATAAATAAAATTGTTTGTGTTTGTTACCTCTGGGCCCCGATTGCTCGAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCACAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAAGCCTAGCAAGACCGCGCACTTAAGCGCAGGCCCGGCTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTTGCCAAAACAAAAAAATCCATTTTCAAAATTATTAAATTTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTTACTTCC。

[0015] According to an embodiment of the present application, step S1 specifically includes the following steps:

[0016] S11: Disperse the Alpine cheese sample in sterile physiological saline and perform a 10-fold serial dilution. Spread the diluted solution onto YPD solid medium and incubate at 30 °C for 36 h. The 9th colony with typical yeast-like characteristics on the L-th plate selected from the isolated single colonies is Saccharomyces cerevisiae L9, which is stored at -80 °C.

[0017] S12: Take out the glycerol tube of Saccharomyces cerevisiae L9 from -80 °C. In the laminar flow hood, use a sterile inoculation needle to pick an appropriate amount of glycerol bacterial liquid and inoculate it onto the plate medium by the polygon streaking method into YPD liquid medium. Incubate at 30 °C for 36 h. After a bacterial lawn forms on the plate medium, place it in a 4 °C refrigerator for standby.

[0018] According to the embodiments of the present application, step S2 specifically includes the following steps: Take two standard-loop colonies and inoculate them into a YPD shake flask seed medium. The culture conditions are constant temperature culture at 220 r / min and 30 °C for 18 h to obtain a shake flask seed culture solution.

[0019] According to the embodiments of the present application, the YPD liquid medium, calculated by weight percentage, includes 20 parts of peptone, 20 parts of glucose, and 10 parts of yeast powder.

[0020] According to the embodiments of the present application, the conditions for aerobic fermentation in step S3 are to control the pH of the fermentation process to 5.5 and the fermentation temperature to 30 - 34 °C.

[0021] According to the embodiments of the present application, the fermentation medium includes glucose, sucrose, yeast peptone, tryptone, yeast powder, biotin, folic acid, and water.

[0022] According to the embodiments of the present application, after step S3, it further includes the steps of centrifuging and filtering the Saccharomyces cerevisiae culture to obtain a filtrate as the Saccharomyces cerevisiae fermentation product.

[0023] On the other hand, the present application provides a banana-flavored Saccharomyces cerevisiae culture prepared by the preparation method described above.

[0024] On yet another hand, the present application discloses the application of the banana-flavored Saccharomyces cerevisiae culture described above in skin care products.

[0025] The beneficial effects of the technical solution of the present invention compared with the prior art are:

[0026] (1) The brewer's yeast used in this application is a brewer's yeast isolated from Swiss Alps alpine cheese that can produce banana aroma and has whitening effect. It is named Saccharomyces cerevisiae L9 strain. This strain has good fermentation ability, ester production ability, and low foaming property. The fermentation product filtrate produced has a strong banana aroma, promotes cell proliferation and migration, promotes repair, reduces inflammatory factors, reduces skin pigmentation, and increases skin moisture content.

[0027] (2) The present invention adds the aroma-enhancing strain Saccharomyces cerevisiae L9 to the conventional culture medium to produce a fermentation liquid with a strong banana aroma. The process is simple, the production efficiency is high, the production cost is low, it is natural and healthy, and it is suitable for industrialization.

[0028] (3) The present invention optimizes the fermentation temperature through experiments and adopts staged control of dissolved oxygen during the fermentation process, which can promote the synthesis of banana aroma, make the banana aroma more intense, and improve production efficiency. At the same time, it also has wine aroma, sour aroma and sweet aroma, and the aroma intensity is moderate and rich.

[0029] (4) The banana-scented yeast fermentation culture prepared by the present invention has the skin care effects of promoting cell proliferation and migration, promoting repair, reducing inflammatory factors, reducing skin pigmentation, and increasing skin moisture content. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 A schematic diagram of a gas chromatography analysis spectrum in an example of the present invention;

[0031] Figure 2 Schematic diagram showing the effect of the fermentation product filtrate of Saccharomyces cerevisiae L9 on the expression level of TNF-α in an example of the present invention;

[0032] Figure 3 Schematic diagram showing the effect of the fermentation product filtrate of Saccharomyces cerevisiae L9 on the expression level of IL-1α in an example of the present invention;

[0033] Figure 4 Schematic diagram of the effect of the fermentation product filtrate of Saccharomyces cerevisiae L9 on the expression level of IL-1β in the examples of the present invention;

[0034] Figure 5 This is a schematic diagram comparing the cell migration before and after the cell scratch test in an example of the present invention;

[0035] Figure 6Schematic diagram of cell density (crystal violet staining) of human skin fibroblasts cultured for 48 h in the examples of the present invention; wherein, A. negative control group, B. positive control group, C. 0.1% filtrate of Saccharomyces cerevisiae L9 fermentation product, D. 1% filtrate of Saccharomyces cerevisiae L9 fermentation product, E. 0.1% lysate of Saccharomyces cerevisiae L9 fermentation product, F. 1% lysate of Saccharomyces cerevisiae L9 fermentation product;

[0036] Figure 7 Schematic diagram of DPPH free radical scavenging rate of the filtrate of Saccharomyces cerevisiae L9 fermentation product in the examples of the present invention;

[0037] Figure 8 Change in trans-epidermal water loss (TEWL) value on the inner side of the volunteer's forearm before and after 30 days of use in the examples of the present invention

[0038] Figure 9 Schematic diagram of the detection image of ultraviolet spots in the examples of the present invention;

[0039] Figure 10 Flow chart of the steps for the preparation method of a Saccharomyces cerevisiae culture with banana aroma in the examples of the present invention. Detailed implementation manners

[0040] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments. The following embodiments are used to illustrate the present invention, but are not used to limit the scope of the present invention.

[0041] As Figure 10 shown, a preparation method of a Saccharomyces cerevisiae culture with banana aroma in the examples of the present application includes the following steps:

[0042] S1: Preparation of single colony plate: Activate and culture Saccharomyces cerevisiae to obtain a single colony plate of Saccharomyces cerevisiae;

[0043] Specifically, step S1 specifically includes the following steps:

[0044] S11: Disperse the Alpine cheese sample in sterile physiological saline and perform a 10-fold gradient dilution. Spread the dilution on the YPD solid medium and culture at 30 °C for 36 h. The 9th colony with typical yeast characteristics on the Lth plate selected from the isolated single colonies is Saccharomyces cerevisiae L9, which is stored at -80 °C;

[0045] S12: Take out the glycerol tube of Saccharomyces cerevisiae L9 from -80 °C. In the ultra-clean bench, use a sterile inoculation needle to pick an appropriate amount of glycerol bacterial liquid and use the polygon streaking method on the plate medium to inoculate it into the YPD liquid medium. Culture at 30 °C for 36 h. After a bacterial lawn is formed on the plate medium, place it in a 4 °C refrigerator for standby.

[0046] Specifically, the Saccharomyces cerevisiae is Saccharomyces cerevisiae L9, and Saccharomyces cerevisiae L9 is deposited in the China Center for Type Culture Collection with the deposit number: CCTCC NO: M2024741.

[0047] S2: Shake flask seed culture: Inoculate a single colony plate of Saccharomyces cerevisiae into YPD liquid medium for expansion culture to obtain a shake flask seed culture solution;

[0048] Specifically, step S2 specifically includes the following steps: Take two standard ring colonies and inoculate them into a YPD shake flask seed medium, and the culture conditions are constant temperature culture at 220 r / min and 30 °C for 18 h to obtain a shake flask seed culture solution.

[0049] Specifically, the YPD liquid medium, calculated by weight percentage, includes 20 parts of peptone, 20 parts of glucose, and 10 parts of yeast powder.

[0050] S3: Aerobic fermentation: Inoculate the shake flask seed culture solution into a fermenter and perform aerobic fermentation by controlling the dissolved oxygen in stages to obtain a Saccharomyces cerevisiae culture;

[0051] Specifically, in step S3, the obtained shake flask seed culture solution is inoculated into the fermentation medium of the fermenter at an inoculation amount of 5% by volume for propagation;

[0052] Specifically, the staged control of dissolved oxygen includes at least two-stage control of dissolved oxygen culture: The first-stage control of dissolved oxygen culture: When the OD is between 0 and 10, the ventilation volume is 0.2 - 1.8 vvm, and the fixed rotation speed is 150 rpm; The second-stage control of dissolved oxygen culture: When the OD > 10, the ventilation volume is 0.2 - 1.2 vvm, and the fixed rotation speed is 150 rpm.

[0053] Specifically, the conditions for aerobic fermentation in step S3 are to control the pH of the fermentation process to be 5.5, and the fermentation temperature is 26 - 44 °C. Preferably, through experiments, the optimal temperature is proven to be 34 °C.

[0054] Specifically, the fermentation medium of the fermenter is selected from any one or more of YPD or YPD modified medium, and the fermentation medium includes glucose, sucrose, yeast peptone, tryptone, yeast powder, biotin, folic acid, and water, etc.

[0055] Specifically, after step S3, it also includes the steps of centrifuging and filtering the Saccharomyces cerevisiae culture to obtain a filtrate as the Saccharomyces cerevisiae fermentation product.

[0056] Another aspect of the present application discloses a banana-flavored Saccharomyces cerevisiae culture prepared by the above preparation method.

[0057] Another aspect of the present application discloses the application of the above banana-flavored Saccharomyces cerevisiae culture in skin care products.

[0058] The preparation method of the Saccharomyces cerevisiae culture of the present invention and the effects of its application are studied through specific examples below. The preservation number of the Saccharomyces cerevisiae L9 strain used in the examples of the present invention is CCTCC NO: M2024741.

[0059] Example 1 Source of Saccharomyces cerevisiae L9

[0060] Saccharomyces cerevisiae L9 was isolated and purified from a sample of Alpine cheese from the Swiss Alps. The Alpine cheese sample was dispersed in sterile physiological saline and serially diluted 10-fold. The diluted solution was spread on YPD solid medium and cultured at 30 °C for 36 h. The 9th colony with typical yeast characteristics on the Lth plate selected from the isolated single colonies was named L9. This strain can grow on YPD solid medium containing 100 mg / L chloramphenicol. It was further streaked and purified on YPD solid medium containing chloramphenicol, and the pure Saccharomyces cerevisiae L9 strain was obtained after 2 passages of subculture. It was stored at -80 °C, and the purified yeast strain was preserved.

[0061] Example 2 Detection of the physiological characteristics of Saccharomyces cerevisiae L9

[0062] A. Gas production ability test

[0063] Strain activation: One loop of the bacterial lawn of the Saccharomyces cerevisiae L9 strain obtained in Example 1 was inoculated into a medium containing 100 mL of YPD, and cultured at 30 °C and 220 r / min for 18 h. The cultured bacterial solution was cooled in ice for standby.

[0064] Preparation of test tubes: 10 mL of YPD liquid medium was aspirated and dispensed into several 15 mL test tubes. The Durham tubes were inverted and the air in the tubes was discharged. They were sterilized at 121 °C for 20 min and cooled for standby.

[0065] Test of the fermentation ability of the strain: The activated strain was inoculated into the test tubes at an inoculation amount of 2% (v / v), and cultured in a biochemical incubator at 30 °C. The gas production in the Durham tubes was observed and recorded every 12 h.

[0066] After testing: The Saccharomyces cerevisiae L9 strain has strong gas production ability, and the Durham tube can be filled with gas within 36 h.

[0067] Test of the ester production ability of the strain

[0068] Under aseptic conditions, the Saccharomyces cerevisiae strain L9 was inoculated onto an ester-producing plate solid medium by the streak plate method and statically cultured in a biochemical incubator at 30°C for 3 days. Each treatment was repeated three times, with Angel brand aroma-producing active dry yeast powder and a blank as controls. When the colony color of the medium showed light yellow, it indicated a low-ester-producing yeast; yellow indicated a medium-ester-producing yeast; and dark yellow indicated a high-ester-producing yeast. Based on this as the judgment criterion, the color development of each test strain on the medium was observed. The darker the color, the stronger the ester-producing ability of the strain.

[0069] The test results showed that the colonies of the Saccharomyces cerevisiae strain L9 in the ester-producing plate showed dark yellow, indicating a high-ester-producing yeast.

[0070] C Foaming performance test

[0071] After activating the Saccharomyces cerevisiae strain L9, it was serially diluted to make the concentration of each bacterial solution reach 5×106 CFU / mL. The activated bacterial solution at this concentration was inoculated into YPD liquid medium at an inoculation amount of 2% (v / v) and statically cultured in a biochemical incubator at 30°C for 3 days. The foam height in each test tube was measured every 4 hours. According to the maximum foam height, the yeast strains could be divided into: non-foaming, low-foaming (less than 2 mm), medium-foaming (between 2 - 4 mm), and high-foaming (greater than 4 mm). The test results showed that the strain had low foaming characteristics, and the bubble height was less than 2 mm after fermentation, indicating that it was more conducive to production fermentation.

[0072] Example 3 Fermentation and preparation of the Saccharomyces cerevisiae L9 culture

[0073] Preparation of a filtrate of the fermentation product of Saccharomyces cerevisiae L9

[0074] Preparation of the Saccharomyces cerevisiae L9 plate: Take out the Saccharomyces cerevisiae L9 glycerol tube obtained in Example 1 from -80°C. In a laminar flow hood, use a sterile inoculation needle to pick an appropriate amount of glycerol bacterial solution and streak it on the plate medium (polygonal streaking method). Culture it at 30°C for 36 h. After forming a bacterial lawn, place it in a 4°C refrigerator for later use.

[0075] Preparation of the primary seed solution: On the cultured Saccharomyces cerevisiae L9 plate, pick two standard loop colonies and inoculate them into a YPD shake flask seed medium. Culture them at a constant temperature of 30°C with a rotation speed of 220 r / min for 18 h to obtain the primary seed solution.

[0076] Fed-batch culture of Saccharomyces cerevisiae L9: The seed liquid was inoculated into the seed tank at an inoculation amount of 5% by volume and cultured using the fermentation medium. The pH of the fermentation process was controlled at 5.5, the fermentation temperature was 30 °C, and the dissolved oxygen was controlled in stages. In the first stage, the aeration rate was 1 vvm and the fixed rotation speed was 150 rpm. In the second stage, the aeration rate was 0.8 vvm and the fixed rotation speed was 150 rpm. The medium formula was: 20 parts of glucose, 20 parts of peptone, and 10 parts of yeast powder. The fermentation broth was obtained after 24 h of culture;

[0077] The fermentation broth was centrifuged at 10000 rpm for 10 min and obtained after filtration through a 0.22 μm microfiltration membrane. The supernatant was taken to obtain the filtrate of the fermentation product of Saccharomyces cerevisiae L9. The odor of this filtrate had a strong banana aroma.

[0078] Preparation of the cell lysate of Saccharomyces cerevisiae L9

[0079] Preparation of the Saccharomyces cerevisiae L9 plate: The glycerol tube of Saccharomyces cerevisiae L9 obtained in Example 1 was taken out at -80 °C. An appropriate amount of glycerol bacterial liquid was taken with a sterile inoculation needle in the ultra-clean bench and streaked on the plate medium (polygonal streaking method). It was cultured at 30 °C for 36 h. After the formation of the bacterial lawn, it was placed in a 4 °C refrigerator for standby;

[0080] Preparation of the first-stage seed liquid: On the well-cultured Saccharomyces cerevisiae L9 plate, two standard-loop colonies were taken and inoculated into the YPD shake flask seed medium. It was cultured at a constant temperature of 30 °C with a rotation speed of 220 r / min for 18 h to obtain the first-stage seed liquid;

[0081] Fed-batch culture of Saccharomyces cerevisiae L9: The seed liquid was inoculated into the seed tank at an inoculation amount of 5% by volume and cultured using the fermentation medium. The pH of the fermentation process was controlled at 5.5, the fermentation temperature was 30 °C, and the dissolved oxygen was controlled in stages. In the first stage, the aeration rate was 1 vvm and the fixed rotation speed was 150 rpm. In the second stage, the aeration rate was 0.8 vvm and the fixed rotation speed was 150 rpm. The medium formula was: 20 parts of glucose, 20 parts of peptone, and 10 parts of yeast powder. The fermentation broth was obtained after 24 h of culture;

[0082] The fermentation broth was centrifuged at 6000 rpm to collect the bacterial cells. Then the yeast cells were washed with pure water and further centrifuged at 6000 rpm to separate and remove water. The water-removed bacterial cells were ground and broken in a ball mill. According to a solid content of 3% by weight, pure water was added for stirring, dissolution, and resuspension. It was filtered through a 0.22 μm microfiltration membrane and a 5000 Da ultrafiltration membrane in sequence to remove insoluble bacterial cell fragments. The clear liquid obtained after filtration was the cell lysate of Saccharomyces cerevisiae L9. The odor of the yeast fermentation product cell lysate prepared in this example was mainly yeast aroma and slightly carried a slight banana aroma as evaluated by the perfume evaluation personnel.

[0083] Comparison of the banana aroma simulation degree and intensity of strain L9 in Example 4

[0084] The filtrate of the fermentation product of Saccharomyces cerevisiae L9 prepared according to Example 3 was used as a sample for the banana aroma simulation degree of the fermentation product. The filtrates of the fermentation products of the corresponding Saccharomyces cerevisiae strains were prepared in the same manner as in Example 3 using the other strains listed in Table 1 as control samples.

[0085] Table 1 Sources and names of yeast strains producing banana aroma used in this example

[0086]

[0087]

[0088] For all the test strains in Table 1, after pre-activation, they were streaked on the slant of YPD agar medium. After culturing for 24 h to form a streaked bacterial lawn, they were stored at 4 °C for later use.

[0089] After the mature bananas were juiced into banana puree using a juicer, banana juices diluted with 0.5 times, 1 time, 2 times, 3 times, 5 times, and 10 times the mass of water were added respectively as reference samples for the banana aroma intensity and simulation degree.

[0090] Sensory evaluation: Ten ordinary people aged 20 - 35 with normal olfaction were used as sensory evaluation personnel. The filtrates of the fermentation products of Saccharomyces cerevisiae strains and banana juice samples with different dilution multiples were respectively filled into sample bottles with the same appearance, no odor, and opaque. An odor blind test was conducted. The sample bottles were only labeled with the scrambled random coding serial numbers of the samples, and all sensory evaluation personnel did not know the specific content of the samples corresponding to the serial numbers before the test was completed. The sensory personnel evaluated the samples according to the sample odor. The evaluation was divided into three level options: 1. Vivid: The sample odor was close to that of a banana, and the evaluator considered the sample to be banana juice or its diluted sample; 2. Similar: Containing a weak banana odor, but with a low intensity or containing other odors, and the evaluator considered the sample not to be banana juice or its diluted sample, but having the characteristics of banana aroma; 3. Excluded: Completely without aroma odor or with a large difference in odor from a banana, and the evaluator considered the sample impossible to be banana juice or its diluted sample. In addition, for those samples that they considered to be banana juice or its diluted samples, the aroma intensity was ranked.

[0091] Results: As shown in Table 2, some sensory evaluation personnel (4 / 10) could misidentify the aroma of the filtrate of the fermentation product of Saccharomyces cerevisiae L9 as real banana juice (or its diluted solution), and it had a high aroma simulation degree, which was not possessed by other known existing banana-producing yeasts. Secondly, among the 4 people who misidentified, 3 people thought that the aroma intensity of the filtrate of the fermentation product of Saccharomyces cerevisiae L9 was stronger than that of the 5-fold diluted banana juice, and 1 person thought it was stronger than that of the 3-fold diluted banana juice.

[0092] Table 2 Sensory evaluation results of the simulation degree of banana aroma

[0093]

[0094] Example 5 Analysis and Detection of the Aroma Components of the Fermentation Product Filtrate of Saccharomyces cerevisiae L9

[0095] Detection of aroma components: The fermentation product filtrate of Saccharomyces cerevisiae L9 in Example 3 was detected by gas chromatography-mass spectrometry.

[0096] HS-SPME conditions: Take 3 mL of the sample into a 10 mL headspace vial, add 5 μL of the internal standard 2-octanol (dilution ratio 1:200), add a rotor, seal it, insert the aged extraction needle into the headspace of the sample after sealing, place it on a heating plate at 60 °C, push out the extraction needle tip after it stabilizes, perform headspace extraction for 60 min, and insert the extraction head into the injection port of a gas chromatography-mass spectrometry (GC-MS) instrument for desorption.

[0097] GC conditions: HP-5MS chromatographic column (50 m × 0.200 mm × 0.33 μm); the carrier gas is high-purity helium (He); the flow rate is 1 mL / min; split injection is used, and the split ratio is 10:1; the injection port temperature is 250 °C; the temperature programming is that the initial temperature is 50 °C, hold for 1 min, increase the temperature to 150 °C at a rate of 2 °C / min, and then increase the temperature to 250 °C at a rate of 4 °C / min and hold for 10 min.

[0098] MS conditions: Electron ionization (EI) source; the ion source temperature is 260 °C; the interface temperature is 260 °C; the mass scanning range is 33 - 450 m / z.

[0099] As Figure 1 shown, through gas chromatography analysis, the following main components were detected in the sample: ethanol (EtOH), with a retention time of 3.31 min; isoamyl alcohol (i-AmOH), with a retention time of 7.62 min; isoamyl acetate (i-AmOAc), with a retention time of 14.05 min. The results show that the content of isoamyl acetate in the sample is the highest, followed by isoamyl alcohol and ethanol. These substances are the aroma components with relatively high proportions in the fermentation products of strain L9. Among them, isoamyl acetate (i-AmOAc) is the main body of the banana aroma. However, adding isoamyl acetate to the fermentation broth does not improve the simulation degree and quality of the banana aroma in the fermentation broth. Moreover, the simulation degree of the banana aroma is not directly related to the content of isoamyl acetate. There should be other volatile products that do not account for the main content, which makes the banana aroma obtained by the fermentation of L9 yeast have a relatively high degree of authenticity.

[0100] Example 6 Influence of the Fermentation Aeration Level during the Fermentation Culture Process of Saccharomyces cerevisiae L9 on Aroma Production by Saccharomyces cerevisiae L9

[0101] Fermentation tank culture of Saccharomyces cerevisiae L9:

[0102] Preparation of Saccharomyces cerevisiae L9 plate: Take out the glycerol tube of Saccharomyces cerevisiae L9 obtained in Example 1 at -80°C. In a laminar flow hood, use a sterile inoculation needle to pick an appropriate amount of glycerol bacterial liquid and streak it on the plate medium (polygonal streaking method). Incubate at 30°C for 36 h. After forming a bacterial lawn, place it in a 4°C refrigerator for standby;

[0103] Preparation of primary seed liquid: On the well-cultured Saccharomyces cerevisiae L9 plate, pick two standard loop colonies and inoculate them into the YPD shake flask seed medium. Incubate at a constant temperature of 30°C with a rotation speed of 220 r / min for 18 h to obtain the primary seed liquid;

[0104] Fermentation tank culture of Saccharomyces cerevisiae L9: Inoculate the seed liquid into the seed tank for culture using the fermentation medium at an inoculation amount of 5% by volume. Control the pH of the fermentation process to be 5.5 and the fermentation temperature to be 30°C. Cultivate by controlling the dissolved oxygen in stages. The process of controlling the dissolved oxygen in stages is as follows: The first stage of controlling the dissolved oxygen for cultivation: When the OD is between 0 and 10, the ventilation volume is set to 0.2, and the fixed rotation speed is 150 r / min; The second stage of controlling the dissolved oxygen for cultivation: When the OD is greater than 10, the ventilation volume is 0.4 vvm. During the experiment, continuously change the ventilation volume in the first and second stages. The ventilation volume in the first stage is 0.6, 1.0, 1.4, 1.8 vvm, and the rotation speed is fixed; The ventilation volumes in the second stage are 0.6, 0.8, 1.0, and 1.2 respectively. And conduct sensory analysis and aroma component detection on the filtrate of the fermentation product obtained by fermentation.

[0105] As shown in Table 3, in this example, the samples with a dilution factor of 0 - 5 times of banana juice are used as the reference for the banana aroma intensity. The aroma intensity level n (0 - 5, where 0 indicates that the aroma intensity is close to undiluted banana juice) of the fermentation product of Saccharomyces cerevisiae L9 is evaluated based on the banana juice with an aroma intensity close to n times dilution. Using the GC-MS detection method of Example 5, analyze the important aroma components in the fermentation product.

[0106] Table 3 Sensory analysis and aroma component detection of Saccharomyces cerevisiae L9 with different ventilation volume controls

[0107] Effect of fermentation temperature on aroma production of Saccharomyces cerevisiae L9 in Example 7

[0108] Inoculation fermentation was carried out according to the method of Example 3, except that the culture temperatures of Saccharomyces cerevisiae L9 were set at 26, 30, 34, 38, 42, and 46 °C respectively, and sensory analysis and aroma component detection were carried out on the filtrate of the fermentation product obtained by fermentation. Samples with a dilution factor of 0 - 5 times of banana juice were used as references for the banana aroma intensity, and the aroma intensity level n (0 - 5, where 0 indicates that the aroma intensity is close to undiluted banana juice) of the fermentation product of Saccharomyces cerevisiae L9 was evaluated based on the aroma intensity close to that of banana juice diluted n times. The GC-MS detection method of Example 5 was used to analyze the important aroma components in the fermentation product.

[0109] Table 4. Sensory analysis and aroma component detection of Saccharomyces cerevisiae L9 at different fermentation temperatures

[0110] It can be seen from Table 4 that different fermentation temperatures are related to the yield of isoamyl acetate. When the fermentation temperature is 26 °C and 46 °C, the yield of isoamyl acetate is low and the banana aroma intensity is medium. When the fermentation temperature is 30, 34, 38, and 42 °C, there are differences in the yield of isoamyl acetate to varying degrees. When the preferred fermentation temperature is 34 °C, the yield of isoamyl acetate is the highest and the banana aroma intensity is high. Therefore, when the fermentation temperature is 30 - 34 °C, Saccharomyces cerevisiae L9 has the best fermentation temperature for producing banana aroma.

[0111] Test on the down-regulation effect of inflammatory factors in the filtrate of the fermentation product of Saccharomyces cerevisiae L9 in Example 8

[0112] An in vitro cell model of macrophages (RAW264.7) induced by lipopolysaccharide (LPS) was used to test the down-regulation effect of inflammatory factors in the filtrate of the fermentation product of Saccharomyces cerevisiae L9. The process is as follows:

[0113] (1) Seeding: Macrophages (RAW264.7) were seeded in a 96-well cell culture plate (100 μL per well) at a concentration of 2×105 Cell / mL (using DMEM medium containing 10% FBS).

[0114] (2) Administration: After culturing the cells for 24 h, the original medium was discarded, and the cells were washed once with PBS. Then, DMEM medium (without FBS) containing the test sample at the specified concentration and LPS was added to each well for the test, and BC (background control), NC (negative control), and PC (positive control) control groups were set up.

[0115] ① BC group: 100 μL DMEM (without FBS)

[0116] ② NC group: 90 μL DMEM (without FBS) + 10 μL LPS (final concentration of LPS 1 μg / mL)

[0117] ③PC group: 80 μL DMEM (without FBS) + 10 μL LPS + 10 μL DSMX (using dexamethasone as the positive control with a final concentration of 0.01%, and the final concentration of LPS is 1 μg / mL)

[0118] ④Sample group: 90 μL DMEM containing the sample (without FBS) + 10 μL LPS (the final concentration of LPS is 1 μg / mL, and the test final concentration of the filtrate of the fermentation product of Saccharomyces cerevisiae L9 is 0.01%)

[0119] Taking three inflammatory factors, tumor necrosis factor (TNF-α), IL-1α, and IL-1β, as the detection indicators of the inflammatory factor level.

[0120] (3) Incubation and detection

[0121] After cell administration, continue to incubate in a 37°C carbon dioxide incubator for 24 h. Then, take 100 μL of the cell supernatant from each well and centrifuge at 1000 g for 20 min. Take the supernatant and use the ELISA kit method to detect the contents of the three inflammatory factors, TNF-α, IL-1α, and IL-1β, respectively. The ELISA detection kits for TNF-α, IL-1α, and IL-1β were purchased from Shanghai Beyotime Biotechnology Co., Ltd. (product numbers: PT518, PI565, PI305).

[0122] (4) ELISA detection

[0123] Detect the levels of the three inflammatory factors in the cell supernatant according to the operation methods described in the instructions of the ELISA kits for TNF-α, IL-1α, and IL-1β.

[0124] The results are as follows:

[0125] The expression results of TNF-α are as follows Figure 2 As shown, in the presence of 0.01% of the filtrate of the fermentation product of Saccharomyces cerevisiae L9, the expression level of TNF-α induced by LPS was downregulated by 41.66%, slightly higher than the effect of the positive control dexamethasone, and there was a significant difference compared with the non-administered group.

[0126] The expression level results of IL-1α produced by macrophages are as Figure 3 shown. When the cells were in the presence of 0.01% of the filtrate of the fermentation product of Saccharomyces cerevisiae L9, the expression level of IL-1α induced by LPS was downregulated by 71%, and there was a significant difference compared with the non-administered group.

[0127] The expression level results of IL-1β secreted by macrophages are as Figure 4As shown, in the presence of the fermentation product filtrate of Saccharomyces cerevisiae L9 at 0.01%, the expression level of IL-1β induced by LPS was downregulated by 84%, which was significantly different from that of the non-drug administration group.

[0128] Overall, the fermentation product filtrate of Saccharomyces cerevisiae L9 has good bioactive effects on downregulating the levels of inflammatory factors and can play a good soothing effect.

[0129] Example 9 Repair efficacy test of the fermentation product filtrate of Saccharomyces cerevisiae L9

[0130] The fermentation product filtrate of Saccharomyces cerevisiae L9 obtained in Example 2 was used, and its repair efficacy was evaluated by an in vitro evaluation model through a cell scratch assay. The evaluation process of the cell scratch assay is as follows:

[0131] Using human immortalized keratinocytes (HaCAT) cells as the test model cells, the cultured HaCAT cells were digested and resuspended, and the cell suspension concentration was adjusted to 5×105 cells / well by dilution with DMEM medium (containing 5% fetal bovine serum). According to the liquid addition volume of 2 mL per well, it was added to a 24-well cell culture plate for culture. The cells were cultured in a CO2 incubator at 37°C (5% carbon dioxide concentration) for 24 h until the cells adhered to the wall; after the cells adhered to the wall, a sterile inoculation needle was perpendicular to the plane of the cell culture plate to make a scratch on the cell layer; after the scratch was completed, the cells were washed 3 times with PBS to wash away the non-adherent cells, that is, the cells scratched off during scribing, so that the gap left after scribing was clearly visible. Then, fresh serum-free medium (containing the test sample or the control sample) was added, and photos were taken and recorded; in this example, the blank control (BC) was not added, and serum-free medium (DMEM) was used; the positive control (PC) was added with fetal bovine serum (FBS, final concentration 10%) in the medium; the test group was a serum-free medium containing the fermentation product filtrate of L9 yeast or the lysate of the fermentation product of L9 yeast at a final concentration of 0.1%.

[0132] After the cell culture plate with photos taken and recorded was continuously placed in a CO2 incubator at 37°C for 6 h, according to the "healing" situation of the scratch, photos were taken again (the cells were stained with crystal violet), and the fusion of the scratch area was calculated to calculate the migration rate. The Image J software was used to statistically analyze the scratch areas at 0 h and 6 h, and calculate the migration rate (%). The calculation formula: migration rate = (scratch area at 0 h - scratch area at 6 h / 8 h) / scratch area at 0 h × 100%.

[0133] The results are as Figure 5As shown, compared with the blank control (BC), the migration rates of keratinocytes supplemented with 0.1% filtrate of Saccharomyces cerevisiae L9 fermentation product and lysate of Saccharomyces cerevisiae L9 fermentation product increased by 31% and 45% respectively. This result indicates that the filtrate of Saccharomyces cerevisiae L9 fermentation product and the lysate of Saccharomyces cerevisiae L9 fermentation product have the efficacy of promoting cell migration and repair, and possess good skin repair efficacy.

[0134] Example 10: Test on the efficacy of promoting cell proliferation of the filtrate of Saccharomyces cerevisiae L9 fermentation product

[0135] The repair efficacy of the Saccharomyces cerevisiae L9 fermentation product was also evaluated using an in vitro cell model for promoting cell proliferation. The testing process is as follows:

[0136] (1) Cell seeding

[0137] Select well-growing human skin fibroblast HSF cells as the test cells. After digestion, prepare a cell suspension of about 2×104 cells / mL with cell culture medium, and inoculate it into a 96-well plate, 100 μL per well. Add sterile PBS to the edge wells. Place it in a carbon dioxide incubator and culture for 24 h ± 2 h. For each test, a blank control group should be set up simultaneously. In the blank control group, no cells are inoculated, and only the same volume of cell culture medium is added. Inoculate 2 96-well plates, namely the 72-hour plate and the photographing plate.

[0138] (2) Sample addition

[0139] Set up a blank control group, a negative control group, a positive control group, and a test sample group. The test sample is the filtrate of Saccharomyces cerevisiae L9 fermentation product prepared in Example 8

[0140] Add DMEM medium containing 2% fetal bovine serum to the blank control group and the negative control group, add DMEM medium containing 10% serum to the positive control group, and add the test sample medium with the specified concentration of the test sample to the test sample group. The liquid addition volume per well is 100 μL. After adding the samples, place the well plate in a carbon dioxide incubator and incubate for 72 h.

[0141] (3) Medium replacement

[0142] After incubating for 48 h, take out the 96-well plate for medium replacement operation. Replace the medium in the blank control group and the negative control group with DMEM medium containing 2% fetal bovine serum, replace the medium in the test sample group with the test sample medium containing different concentrations of Saccharomyces cerevisiae L9 culture, and replace the medium in the positive control group with DMEM medium containing 10% serum. As Figure 6As shown, it is a schematic diagram of cell density (crystal violet staining) after culturing human skin fibroblasts for 48 hours. Among them, A. negative control group, B. positive control group, C. 0.1% filtrate of Saccharomyces cerevisiae L9 fermentation product, D. 1% filtrate of Saccharomyces cerevisiae L9 fermentation product, E. 0.1% lysate of Saccharomyces cerevisiae L9 fermentation product, F. 1% lysate of Saccharomyces cerevisiae L9 fermentation product. Obviously, the cell density is greater in the group with the addition of Saccharomyces cerevisiae L9 culture.

[0143] (4) CCK8 assay

[0144] Determine the absorbance value: Mix CCK8 with complete medium at a ratio of 1:10 and incubate for 2 hours.

[0145] (5) Calculate the relative cell viability at each time point

[0146] Example 11 Free radical scavenging ability test of the fermentation product filtrate of Saccharomyces cerevisiae L9

[0147] The DPPH method was used to test the free radical scavenging ability of the fermentation product filtrate of L9. The test was carried out using a DPPH free radical scavenging ability detection kit (Solarbio Life Sciences, product number 4755), and the test was carried out according to the method listed in the kit instructions.

[0148] As Figure 7 shown, the positive control is the DPPH scavenging rate of 0.25 mg / mL ascorbic acid (VC) is 93%. The test sample in the test group is the fermentation product filtrate of Saccharomyces cerevisiae L9 prepared in Example 8. At the 5% g / g test concentration level and the 1% g / g test concentration level, the DPPH scavenging rates of the fermentation product filtrate of Saccharomyces cerevisiae L9 reached 62% and 14% respectively, showing good ability to scavenge DPPH hydroxyl radicals.

[0149] Example 12 Application of the fermentation product filtrate of Saccharomyces cerevisiae L9 in a skin care formula

[0150] The configuration process of a serum formula is shown in Table 5 below:

[0151] 1. Mix the 3 formula substances in Configuration 1 according to the addition ratio and stir well until uniform;

[0152] 2. Mix the 4 formula substances in Configuration 2 according to the addition ratio and stir well until uniform;

[0153] 3. Mix the well-mixed part of Configuration 1 with the well-mixed part of Configuration 2 according to the addition ratio and stir well until uniform.

[0154] Table 5 Serum formula

[0155]

[0156] The formulation configuration process of the Second Repair and Revitalizing Skin Toner is shown in Table 6 as follows:

[0157] 1. Mix the 8 formulation ingredients in Configuration 1 according to the addition ratio, and stir well until homogeneous;

[0158] Mix the 3 formulation ingredients in Configuration 2 according to the addition ratio, and stir well until homogeneous;

[0159] Mix the well-mixed part of Configuration 1 and the well-mixed part of Configuration 2 according to the addition ratio, and stir well until homogeneous.

[0160] Table 6 Repair and Revitalizing Skin Toner Formulation

[0161]

[0162] Efficacy Test of the Formulation in Example 13

[0163] A trial test was conducted on the actual use efficacy of the essence containing the filtrate of L9 yeast fermentation product formulated according to Table 5 in Example 12.

[0164] The test adopted the actual human trial test effect. The trial period was 30 days, the usage frequency was twice a day, once in the morning and once in the evening, and it was used continuously for 30 days. The test volunteers were healthy men or women aged 30 - 45. The test evaluated the skin barrier ability, ultraviolet spots, skin moisture content, and trial experience and other indicators of the skin parts of 15 subjects who continuously used the essence for 30 days.

[0165] The improvement of the skin barrier ability was evaluated using the Transepidermal waterloss (TEWL) index. The Tewameter TM300 of CK Company in Germany was used to test the transepidermal water loss of the skin surface of the test volunteers.

[0166] The detection of ultraviolet spots was carried out using the ultraviolet spot detection function module of the VISIA-CR skin analysis system (Canfield Scientific Company), and the improvement of the ultraviolet pigment spots on the test face was carried out according to the test instruction method.

[0167] The trial experience of the trial users was in the form of a questionnaire survey, and the intuitive trial feelings of the skin of the subjects during the trial process were statistically analyzed.

[0168] As Figure 8 shown, the results showed that after 30 days of use, the Transepidermal waterloss (TEWL) values of the skin of the volunteers generally decreased, indicating that the skin barrier function of the subjects was improved after using the essence for 30 days, the TEWL level of the skin decreased, and the skin water retention ability increased.

[0169] like Figure 9 As shown in the figure, the results of the ultraviolet spot detection showed that the area of ultraviolet spots in the test area of the subject's face decreased from 16.3±3.4% (pigmentation area / AOI area) to 8.5±2.7% ((pigmentation area / AOI area). The detection image results of the ultraviolet spots showed that the pigmentation area range and fluorescence intensity (pigmentation degree) of the subject's face were significantly improved.

[0170] In the trial experience questionnaire survey of trial users, 80% (12 / 15) of the trial users believed that the skin condition of their hands and faces had been perceptibly improved, 73% (11 / 15) of the trial users believed that the smoothness of their skin had been improved, 73% (11 / 15) of the trial users believed that the water content and skin elasticity of their skin had been improved, 67% (10 / 15) of the trial users believed that the brightness of their skin had been improved and the depth of pigmentation had been improved, and 0% (0 / 15) of the trial users experienced adverse reactions such as redness, swelling, itching, dryness, irritation, and pain.

[0171] In summary, the technical solution of this application has the following beneficial effects:

[0172] (1) The brewer's yeast used in this application is a brewer's yeast isolated from Swiss Alps alpine cheese that can produce banana aroma and has whitening effect. It is named Saccharomyces cerevisiae L9 strain. This strain has good fermentation ability, ester production ability, and low foaming property. The fermentation product filtrate produced has a strong banana aroma, promotes cell proliferation and migration, promotes repair, reduces inflammatory factors, reduces skin pigmentation, and increases skin moisture content.

[0173] (2) The present invention adds the aroma-enhancing strain Saccharomyces cerevisiae L9 to the conventional culture medium to produce a fermentation liquid with a strong banana aroma. The process is simple, the production efficiency is high, the production cost is low, it is natural and healthy, and it is suitable for industrialization.

[0174] (3) The present invention optimizes the fermentation temperature through experiments and adopts staged control of dissolved oxygen during the fermentation process, which can promote the synthesis of banana aroma, make the banana aroma more intense, and improve production efficiency. At the same time, it also has wine aroma, sour aroma and sweet aroma, and the aroma intensity is moderate and rich.

[0175] (4) The banana-scented yeast fermentation culture prepared by the present invention has the skin care effects of promoting cell proliferation and migration, promoting repair, reducing inflammatory factors, reducing skin pigmentation, and increasing skin moisture content.

[0176] The above are only the preferred embodiments of the present invention, and do not limit the implementation manners and protection scope of the present invention. For those skilled in the art, it should be realized that all the equivalent substitutions and obvious changes made by using the description and illustrations of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for preparing a Saccharomyces cerevisiae culture with banana aroma, characterized in that, It includes the following steps: S1: Preparation of single colony plate: Activate and culture Saccharomyces cerevisiae to obtain a single colony plate of Saccharomyces cerevisiae; S2: Shake flask seed culture: Inoculate the single colony plate of Saccharomyces cerevisiae into YPD liquid medium for expanded culture to obtain shake flask seed culture solution; S3: Aerobic fermentation: Inoculate the shake flask seed culture solution into a fermenter and perform aerobic fermentation by controlling dissolved oxygen in stages to obtain a Saccharomyces cerevisiae culture; In step S3, the obtained shake flask seed culture solution is inoculated into the fermentation medium of the fermenter at an inoculation amount of 5% by volume for propagation; In step S3, the staged control of dissolved oxygen includes at least two-stage control of dissolved oxygen culture: The first-stage control of dissolved oxygen culture: When OD is between 0 and 10, the ventilation volume is 0.2 - 1.8 vvm, and the fixed rotation speed is 150 rpm; The second-stage control of dissolved oxygen culture: When OD > 10, the ventilation volume is 0.2 - 1.2 vvm, and the fixed rotation speed is 150 rpm.

2. The preparation method of a Saccharomyces cerevisiae culture with banana aroma according to claim 1, characterized in that, The Saccharomyces cerevisiae is Saccharomyces cerevisiae L9, and the Saccharomyces cerevisiae L9 is deposited in the China Center for Type Culture Collection, with the deposit number: CCTCC NO: M2024741.

3. The preparation method of a Saccharomyces cerevisiae culture with banana aroma according to claim 2, characterized in that, Step S1 specifically includes the following steps: S11: Disperse the Alpine cheese sample in sterile physiological saline and perform a 10-fold gradient dilution. Coat the diluted solution onto YPD solid medium and culture at 30 °C for 36 h. The 9th colony with typical yeast-like characteristics on the Lth plate selected from the isolated single colonies is the Saccharomyces cerevisiae L9, and it is stored at -80 °C; S12: Take out the glycerol tube of Saccharomyces cerevisiae L9 from -80 °C. In a clean bench, use a sterile inoculation needle to pick an appropriate amount of glycerol bacterial liquid and inoculate it onto the plate medium by the polygon streaking method into YPD liquid medium. Culture at 30 °C for 36 h. After a bacterial lawn is formed on the plate medium, place it in a 4 °C refrigerator for standby.

4. The preparation method of a Saccharomyces cerevisiae culture with banana aroma according to claim 1, characterized in that, Step S2 specifically includes the following steps: Take two standard loop colonies and inoculate them into YPD shake flask seed medium. The culture conditions are constant temperature culture at 220 r / min and 30 °C for 18 h to obtain shake flask seed culture solution.

5. The preparation method of a Saccharomyces cerevisiae culture with banana aroma according to claim 1, characterized in that, The YPD liquid medium, calculated by weight percentage, includes 20 parts of peptone, 20 parts of glucose, and 10 parts of yeast powder.

6. The preparation method of a Saccharomyces cerevisiae culture with banana aroma according to claim 1, characterized in that, The conditions for the aerobic fermentation in step S3 are to control the pH of the fermentation process to be 5.5, and the fermentation temperature to be 30 - 34 °C.

7. The preparation method of a Saccharomyces cerevisiae culture with banana aroma according to claim 1, characterized in that, The fermentation medium includes glucose, sucrose, yeast peptone, tryptone, yeast powder, biotin, folic acid, and water.

8. The preparation method of a Saccharomyces cerevisiae culture with banana aroma according to claim 1, characterized in that, After step S3, it also includes the steps of centrifuging and filtering the Saccharomyces cerevisiae culture to obtain a filtrate as the Saccharomyces cerevisiae fermentation product.

9. A banana-flavored Saccharomyces cerevisiae culture prepared by the preparation method according to any one of claims 1 - 8.

10. Use of the banana-flavored Saccharomyces cerevisiae culture according to claim 9 in skin care products.

Images