Application of CPT2 inhibitors in the treatment of postmenopausal osteoporosis

Abstract

This invention discloses the use of CPT2 inhibitors in the treatment of postmenopausal osteoporosis. By detecting fatty acid oxidation levels in osteoclast precursor cells and CPT2 expression levels, postmenopausal osteoporosis can be predicted. It also discloses the use of CPT2 as a diagnostic marker for postmenopausal osteoporosis. The CPT2 inhibitors include perhexiline maleate, among others. This invention reveals a new use of CPT2 as a marker and therapeutic target for postmenopausal osteoporosis, providing important evidence for the clinical application of CPT2 inhibitors.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the application of CPT2 as a marker for the treatment of postmenopausal osteoporosis and a CPT2 inhibitor. Background Art

[0002] Postmenopausal osteoporosis (PMOP) is a systemic bone metabolic disease caused by estrogen deficiency, characterized by weakened bone strength and an increased risk of fracture. The dynamic balance between bone formation and resorption is fundamental to maintaining skeletal morphology. When this dynamic balance is disrupted, bone homeostasis is disrupted. With aging, the rapid decline in hormone levels after menopause, and other factors, bone formation capacity decreases, accompanied by increased bone resorption, ultimately leading to osteoporosis. Postmenopausal osteoporosis is characterized by excessive osteoclast formation and bone loss caused by decreased estrogen levels. PMOP often develops insidiously in postmenopausal women, and fragility fractures are its most common clinical complication. Fractures can occur with minimal or no trauma, often affecting the hip, femur, and spine, leading to pain, deformity, functional impairment, and even death. These complications severely impact the health and quality of life of middle-aged and elderly individuals, and can even shorten their lifespan.

[0003] Bone remodeling is synergistically regulated by bone-resorbing osteoclasts and bone-forming osteoblasts. The primary functional cells in the bone remodeling process are osteoclasts and osteoblasts, which influence each other's differentiation, aggregation, and functional activities through multiple signaling pathways. Coordination between osteoblasts and osteoclasts is regulated in a variety of ways: direct and paracrine regulation by estrogen, non-coding RNA regulation such as microRNAs, long non-coding RNAs, and circular RNAs, oxidative stress mediation, CD4+ T cell regulation, and intestinal microbiota regulation.

[0004] Current clinical medications, such as bisphosphonates and denosumab, are ineffective in some patients and pose risks such as mandibular osteonecrosis. Therefore, further research into the pathogenesis and therapeutic targets of postmenopausal osteoporosis is of great significance.

[0005] CPT2 (carnitine palmitoyltransferase 2) is a key enzyme located in the inner mitochondrial membrane. It is responsible for converting fatty acylcarnitines (such as palmitoylcarnitine) transported from the cytosol to the mitochondrial intermembrane space via CPT1 into fatty acyl-CoA within the mitochondrial matrix, completing a crucial step in the β-oxidation energy pathway for fatty acids. Perhexiline maleate is a CPT2 inhibitor (CAS: 3624-80-6, molecular formula: C19H35N⋅C4H4O4, molecular weight: 393.58). By inhibiting CPT2, it blocks the fatty acid oxidation pathway, thereby disrupting intracellular energy balance.

[0006] Patent application number CN201811585404.6 discloses the use of miRNA-3656 in the preparation of products for diagnosing postmenopausal osteoporosis. However, the existing technology is still unclear about the relationship between CPT2 and postmenopausal osteoporosis, and the role of CPT2 inhibitors in the treatment of postmenopausal osteoporosis remains to be clarified. Summary of the Invention

[0007] (1) Technical problems solved

[0008] Against the above background, the present invention provides an application of a CPT2 inhibitor in the treatment of postmenopausal osteoporosis, as well as an application of targeting CPT2 in postmenopausal osteoporosis, to address the current problems of lack of effective therapeutic targets for postmenopausal osteoporosis and lack of precise treatment strategies for postmenopausal osteoporosis.

[0009] (2) Technical solution

[0010] In order to achieve the above object, the present invention adopts the following technical solutions:

[0011] Use of CPT2 inhibitors in the preparation of drugs for treating postmenopausal osteoporosis.

[0012] The drug is used for at least one of the following:

[0013] Inhibit osteoclast formation;

[0014] or, inhibiting the expression of key transcription factors for osteoclast formation;

[0015] or, inhibiting the bone resorption function of osteoclasts;

[0016] or, alleviate bone loss in ovariectomized mice;

[0017] or, inhibiting serum bone resorption markers in ovariectomized mice.

[0018] The CPT2 inhibitor includes at least one of the following: a small molecule compound that specifically inhibits CPT2; or a small interfering RNA (siRNA) that specifically interferes with CPT2 expression.

[0019] Furthermore, the CPT2 inhibitor is Perhexiline maleate.

[0020] The present invention also provides a method for detecting the fatty acid oxidation rate of osteoclast precursor cells, comprising the following steps:

[0021] S1, Rapid separation of human peripheral blood monocytes / macrophages using CD14 magnetic beads antibody:

[0022] After obtaining informed consent from the volunteers, 20 mL of peripheral blood was collected from the volunteers using BD sodium heparin blood collection tubes, 10 mL of Ficoll-Paque PLUS separation buffer was added, and the cells were centrifuged at 2500 r / min for 30 min. The upper and middle layers of monocytes / macrophages were aspirated and rinsed twice with RPMI1640 medium. After counting the cells, 80 μL of buffer and 20 μL of CD14 Microbeads were added, and the cells were incubated at 4°C in the dark for 15 min. 2 mL of buffer was added to rinse the cells, and the cells were centrifuged at 300 g for 10 min. The supernatant was discarded and the cells were resuspended in 500 μL of buffer. The sorting column was installed on the sorting magnet, the sorting column was rinsed with buffer, and the cell suspension was added. The sorting column was removed and placed in a 15 mL centrifuge tube. Buffer was added to collect the cells. The obtained cells were CD14-positive monocytes / macrophages. After counting the obtained cells, they were seeded into 24-well plates at a density of 7.5×10^5 / cm 2 MEMα medium containing 30 ng / mL M-CSF and 10% FBS was added, and after 8 hours, the cells adhered and the S2 step was performed;

[0023] S2, using C 14 Determination of fatty acid oxidation levels in monocytes / macrophages by α-oleate and CO2 capture techniques:

[0024] Mix 50 μCi 14 C-oleate powder, 312.5 μL pure water and 3.5 mg sodium oleate were heated to 70 °C and then 0.94 mL of 4 mM BSA solution was added. 100 mM L-carnitine and 10 μM HEPES buffer were added to MEMα medium and diluted 1:100. 14 C-oleate solution, after counting the monocytes / macrophages, the above reaction solution was added and incubated in a 37 °C incubator for 4 h;

[0025] Insert a filter paper of appropriate size into the cap of a 1.5 mL EP tube, add 20 μL of NaOH solution dropwise, add 200 μL of 1 M perchloric acid to the bottom of the tube, take 400 μL of the reaction solution and add it to the EP tube. Close the EP tube, incubate at room temperature for 1 hour, transfer the filter paper to a radiometric tube containing 4 mL of scintillation fluid, and use a scintillation counter for detection; the value read by the scintillation counter is X, which is calculated using the following formula:

[0026] Cellular fatty acid oxidation rate (pmol / cell / hour) = 0.0352 × X / cell number;

[0027] S3, A correlation analysis was conducted between the bone density of postmenopausal women and the fatty acid oxidation level of their monocytes / macrophages. It was found that the fatty acid oxidation level of monocytes / macrophages was negatively correlated with bone density.

[0028] The present invention also provides the use of CPT2 as a diagnostic marker for postmenopausal osteoporosis, wherein the use is to treat postmenopausal osteoporosis by targeting CPT2, or to predict postmenopausal osteoporosis by detecting the fatty acid oxidation level of osteoclast precursor cells.

[0029] Furthermore, the application is to diagnose postmenopausal osteoporosis by measuring the expression level of CPT2.

[0030] The present invention also provides a CPT2 inhibitor, which comprises at least one of perhexiline maleate and a small interfering RNA of the CPT2 gene:

[0031] The small interfering RNA that inhibits CPT2 gene expression is:

[0032] CPT2-Hsa-siRNA: CCAGGCTGCCTATTCCCAAACTTGA.

[0033] The present invention predicts postmenopausal osteoporosis by detecting the fatty acid oxidation level of osteoclast precursor cells in postmenopausal women.

[0034] The present invention also predicts postmenopausal osteoporosis by detecting the expression level of CPT2 in osteoclast precursor cells of postmenopausal women.

[0035] The present invention discloses that CPT2 small interfering RNA inhibits osteoclast differentiation.

[0036] The present invention discovered that the CPT2 inhibitor Perhexiline maleate inhibits osteoclast differentiation.

[0037] The present invention discovered that the CPT2 inhibitor Perhexiline maleate inhibits bone resorption and alleviates osteoporosis in ovariectomized (OVX) mice after oral administration.

[0038] The present invention found that oral administration of perhexiline maleate alleviates osteoporosis in ovariectomized (OVX) mice.

[0039] The present invention discovers that the combination of perhexiline maleate and denosumab enhances the osteoporosis treatment effect of denosumab in ovariectomized (OVX) mice. Therefore, a drug for treating postmenopausal osteoporosis is proposed. The drug is a combination of perhexiline maleate and denosumab. The dosage of the drug is: denosumab 5 mg / kg subcutaneously for two weeks, and perhexiline maleate 80 mg / kg per day by oral gavage.

[0040] (3) Beneficial effects

[0041] The beneficial effects produced by the present invention are:

[0042] (1) The present invention discovered CPT2, a diagnostic and therapeutic marker for postmenopausal osteoporosis. Postmenopausal osteoporosis can be treated by targeting CPT2. At the same time, by detecting the expression level of fatty acid oxidation rate in osteoclast precursor cells, postmenopausal osteoporosis can be accurately predicted, thus providing a basis for individualized treatment.

[0043] (2) The present invention found that CPT2 inhibitors, such as Perhexiline maleate, can significantly improve postmenopausal osteoporosis. CPT2 can be used as a diagnostic and therapeutic target for postmenopausal osteoporosis, guiding the development and screening of related drugs.

[0044] (3) The present invention found that the CPT2 inhibitor Perhexiline maleate can effectively enhance the effect of Denosumab in treating postmenopausal osteoporosis, indicating that the development of postmenopausal osteoporosis drugs based on this has important clinical application value and market potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other implementation drawings based on the provided drawings without inventive effort.

[0046] Figure 1 .The fatty acid oxidation rate of peripheral blood mononuclear macrophages in postmenopausal women is positively correlated with the degree of osteoporosis.

[0047] in, Figure 1 A is a schematic diagram of magnetic bead sorting of CD14+ human peripheral blood monocytes / macrophages (osteoclast precursor cells). Figure 1 B is the flow chart for determining the fatty acid oxidation rate. Figure 1 C is the correlation analysis between the fatty acid oxidation rate of peripheral blood monocytes / macrophages and bone density T value in postmenopausal women. The results showed that the fatty acid oxidation rate of peripheral blood monocytes / macrophages in postmenopausal women was positively correlated with the degree of osteoporosis. Figure 1 D is the CPT2 expression level in peripheral blood monocytes / macrophages in postmenopausal women with normal bone density, osteopenia, and osteoporosis (**, P<0.01).

[0048] Figure 2 . CPT2 small interfering RNA transfection inhibits osteoclast formation and the expression of osteoclast-related transcription factors.

[0049] Figure 2 A is Western blot detection of CPT2 small interfering RNA knockdown efficiency, Figure 2 B is the TRAP staining result after CPT2 small interfering RNA transfection of CD14+ human peripheral blood monocytes / macrophages to induce osteoclast differentiation. Figure 2 C is the quantitative result of the aforementioned TRAP staining experiment, Figure 2 D shows the effect of CPT2 small interfering RNA on the expression of osteoclast differentiation-related marker genes TRAP, c-fos, NFATC1 and MMP9 detected by RT-qPCR (**, P<0.01).

[0050] Figure 3 . CTP2 inhibitor Perhexiline maleate significantly inhibited the formation of osteoclasts and the expression of osteoclast-related transcription factors.

[0051] Figure 3 A is the TRAP staining result showing the effect of different concentrations of Perhexiline maleate on osteoclast differentiation. Figure 3 B is the quantitative result of the above TRAP staining experiment, Figure 3 C shows the effect of CPT2 small interfering RNA on the expression of osteoclast differentiation-related marker genes TRAP, c-fos, NFATC1 and MMP9 detected by RT-qPCR (**, P<0.01).

[0052] Figure 4 . Perhexiline maleate inhibits osteoclast bone resorption function.

[0053] Figure 4 A is a bone resorption experiment showing that Perhexiline maleate inhibits osteoclast bone resorption function. Figure 4 B is the quantitative analysis of the bone resorption area in the above experiment (**, P < 0.01).

[0054] Figure 5 . Perhexiline maleate alleviates bone loss in OVX mice.

[0055] Figure 5 A is the microCT scan results of OVX mice after different interventions. Figure 5 B is the quantitative analysis of the aforementioned microCT scan results, including BV / TV (bone volume fraction), Tb.N (trabecular number), Tb.Th (trabecular thickness), and Tb.Sp (trabecular spacing). Figure 5 C is the change of serum bone resorption index CTX level in OVX mice after different interventions. Figure 5 D shows the changes in the serum bone formation index P1NP level in OVX mice after different interventions (**, P < 0.01; NS indicates no significant difference).

[0056] Figure 6 Perhexiline maleate inhibits osteoclast formation in the femur of OVX mice.

[0057] Figure 6 A is Figure 5 TRAP staining results of mouse femur, Figure 6 B is the quantitative analysis result of the aforementioned staining image using BIOQUANT OSTEO2021 V21.5.60 software (**, P<0.01; *, P<0.05; NS indicates no significant difference).

[0058] Figure 7 Perhexiline maleate enhances the therapeutic effect of denosumab on bone loss in ovariectomized mice.

[0059] Figure 7 A is the microCT scan results of OVX mice after different interventions. Figure 7 B is the quantitative analysis of the aforementioned microCT scan results, including BV / TV (bone volume fraction), Tb.N (trabecular number), Tb.Th (trabecular thickness), and Tb.Sp (trabecular spacing). Figure 7 C shows the changes in the levels of serum bone resorption marker CTX and bone formation marker P1NP in OVX mice after different interventions (**, P<0.01; NS indicates no significant difference). DETAILED DESCRIPTION

[0060] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0061] Example 1. The fatty acid oxidation rate of peripheral blood mononuclear macrophages in postmenopausal women is positively correlated with the degree of osteoporosis ( Figure 1 AC).

[0062] Materials and reagents: BD sodium heparin blood collection tubes, 367878; Ficoll-Paque PLUS, 17144003, Cytiva; human CD14 MicroBeads, Miltenyi Biotec, 130-050-201; separation columns, Miltenyi Biotec, 130-042-401; separation magnets, Miltenyi Biotec, 130-042-301; RMPI1640 medium, Sigma-Aldrich, R0883; M-CSF, R&D, AFL216; FBS, Gibco, A5256701; MEMα medium, Gibco, 12571063. 14 C-Oleate, PerkinElmer, NEC317050UC; sodium oleate, Santa Cruz, SC-215879; BSA, Proliant Biologicals, 68700; scintillation counter, Beckman Coulter, LS6500; scintillation fluid, MP Biomedicals, 882453; perchloric acid, Sigma, 244252; αMEM, Gibco, 12571063.

[0063] Experimental methods:

[0064] (1) Recruit orthopedic outpatients. The inclusion and exclusion criteria are as follows:

[0065] Subject inclusion criteria:

[0066] ① Confirmation of menopausal status: natural menopause ≥ 1 year (no spontaneous menstruation since the last menstrual period); age range: 45–75 years.

[0067] ② Health status: No serious acute diseases (such as infection, malignant tumors, active cardiovascular diseases); stable chronic diseases (such as hypertension, hyperlipidemia) are allowed to be included, but medication use must be recorded.

[0068] ③ Lifestyle stability: no significant changes in diet, exercise habits, or weight in the past 6 months (fluctuation < 5%).

[0069] Subject exclusion criteria:

[0070] ① Diseases that affect bone metabolism: uncontrolled hyperthyroidism / hypothyroidism, parathyroid disease, Cushing's syndrome, rheumatoid arthritis, multiple myeloma, etc.; severe liver and kidney diseases (eGFR < 60 mL / min / 1.73m² or abnormal liver function > 2 times the upper limit of normal).

[0071] ② Interference from metabolic diseases: diabetes (HbA1c ≥ 6.5%), obesity (BMI > 30 kg / m²); recent (within 3 months) use of drugs that affect metabolism or bone density (such as glucocorticoids, antiepileptic drugs, bisphosphonates, SERMs, PTH analogues).

[0072] ③ Hormone-related exclusions: users of postmenopausal hormone replacement therapy (HRT) or selective estrogen receptor modulators (SERMs) (if the study needs to exclude exogenous estrogen interference); users of antibiotics, probiotics, or drugs that significantly change the intestinal flora in the past six months (if intestinal metabolites are of concern).

[0073] ④ Interference with lifestyle habits: long-term alcoholism (alcohol intake ≥ 15 g / day) or smoking (>10 cigarettes / day); professional athletes or long-term bed rest (extreme physical activity affects bone metabolism).

[0074] ⑤Other exclusion factors: Fragility fracture or bone surgery in the past year; factors that affect DXA measurement (such as severe spinal deformity, metal implants).

[0075] A total of 25 subjects were recruited for this study. Dual-energy X-ray (DXA) was used to measure bone mineral density. After fasting overnight, 20 mL of peripheral blood was collected in the morning.

[0076] (2) Rapid separation of human peripheral blood monocytes / macrophages using CD14 magnetic beads antibody ( Figure 1A): 20 mL of peripheral blood was collected from the patient using a BD sodium heparin tube. 10 mL of Ficoll-Paque PLUS separation buffer was added and the tube was centrifuged at 2500 rpm for 30 minutes. The upper and middle layers of monocytes / macrophages were aspirated and rinsed twice with RPMI1640 medium. After cell count, 80 μL of buffer (PBS + 0.5% FBS + 2 mM EDTA) and 20 μL of CD14 microbeads were added and incubated at 4°C in the dark for 15 minutes. The cells were rinsed with 2 mL of buffer and centrifuged at 300 g for 10 minutes. The supernatant was discarded and the cells were resuspended in 500 μL of buffer. The separation column was mounted on the separation magnet, rinsed with buffer, and the cell suspension was added. The separation column was removed and placed in a 15 mL centrifuge tube. The cells were then collected with buffer. The resulting cells are CD14-positive monocytes / macrophages. The cells were counted and plated into a 24-well plate at a density of 7.5 × 10^5 / cm. 2 MEMα medium containing 30 ng / mL M-CSF and 10% FBS was added, and the following steps were performed after the cells adhered for 8 hours.

[0077] (3) Determination of fatty acid oxidation levels in monocytes / macrophages using CO2 capture technology ( Figure 1 B).

[0078] A. Mix 50 μCi 14 C-oleate powder, 312.5 μL pure water and 3.5 mg sodium oleate were heated to 70°C and then 0.94 mL BSA solution (4 mM) was added. 100 mM L-carnitine and 10 μM HEPES buffer were added to MEMα medium and diluted 1:100. 14 After counting the monocytes / macrophages, add the above reaction solution and incubate in a 37°C incubator for 4 h.

[0079] B. Insert a piece of appropriately sized filter paper into the cap of a 1.5 mL EP tube. Add 20 μL of NaOH solution and 200 μL of 1 M perchloric acid to the bottom of the tube. Add 400 μL of the reaction solution to the EP tube, seal the tube, and incubate at room temperature for 1 hour. Transfer the filter paper to a radiometric tube containing 4 mL of scintillation fluid for detection using a scintillation counter.

[0080] C. The scintillation counter reads the value X, which is calculated using the following formula

[0081] Cellular fatty acid oxidation rate (pmol / cell / hour) = 0.0352 × X / cell number. Correlation analysis between bone density and fatty acid oxidation levels of monocytes / macrophages in postmenopausal women revealed a negative correlation between fatty acid oxidation levels of monocytes / macrophages and bone density ( Figure 1 C).

[0082] Example 2. The expression level of CPT2 in peripheral blood mononuclear macrophages of patients with postmenopausal osteoporosis and osteopenia is higher than that of patients with normal bone mass ( Figure 1 D).

[0083] Materials and reagents: RNA extraction kit, Qiagen, 74104; reverse transcription kit, Takara, 6210A; SYBgreen premix, ABI, A25742; PCR instrument, ABI, A28567.

[0084] Experimental Methods: Human peripheral blood monocytes / macrophages were rapidly isolated using CD14 magnetic beads from subjects. Total RNA was extracted using an RNA extraction kit. After RNA concentration was determined, 1 μg of RNA was used to synthesize cDNA using a reverse transcription kit. SYBgreen premix, cDNA, and either CPT2 primers (sense strand, TGATGAGTAGTGGCAATGAGG; antisense strand, AAAGTGGACGGCAGTAGAG) or β-actin primers (internal control) (sense strand, CACCATTGGCAATGAGCGGTTC; antisense strand, AGGTCTTTGCGGATGTCCACGT) were mixed for RT-qPCR analysis. Peripheral blood monocytes / macrophage cDNA from postmenopausal subjects without osteoporosis was used as a control to compare CPT2 expression levels between subjects and controls.

[0085] Experimental results: RT-qPCR results showed that compared with the normal bone mass group of postmenopausal women, the expression level of CPT2 in peripheral blood monocytes / macrophages of patients with osteoporosis and osteopenia was higher ( Figure 1 D).

[0086] Experimental Example 3. Cpt2 small interfering RNA inhibits osteoclast formation

[0087] Materials and reagents: Cpt2 small interfering RNA (CCAGGCTGCCTATTCCCAAACTTGA); Lipo3000, Thermo, L3000015; M-CSF, R&D, AFL216; FBS, Gibco, A5256701; MEMα medium, Gibco, 12571063; RANKL, R&D, 390-TN-010; TRAP staining kit, Sigma-Aldrich, 387A-1KT.

[0088] 2. Experimental methods:

[0089] (1) Small interfering RNA (siRNA) was designed targeting the CDS sequence of the human CPT2 gene. The design principles were as follows: GC content of 30%-55%; a double-stranded region of 19-25 bp; and the target sequence should not form a strong hairpin structure or be self-complementary. The siRNA was designed using the Eurofins online tool, resulting in the sequence CCAGGCTGCCTATTCCCAAACTTGA.

[0090] (2) The peripheral blood monocytes / macrophages of the subjects were quickly separated by CD14 magnetic bead antibodies. After counting, MEMα culture medium containing 30 ng / mL M-CSF and 10% FBS was added and seeded into 96-well plates or 24-well plates. After overnight culture, Cpt2 small interfering RNA (CCAGGCTGCCTATTCCCAAACTTGA) was transfected. After 48 hours, the medium was changed to osteoclast induction medium (MEMα culture medium containing 10% FBS, 30 ng / mL M-CSF and 50 ng / mL RANKL), and the medium was changed every other day. After 14 days, the cells in the 96-well plate were fixed with 4% PFA, TRAP stained and counted. Total RNA was extracted from the cells in the 24-well plate using an RNA extraction kit. After measuring the RNA concentration, 1ug ​​of RNA was taken and cDNA was synthesized using a reverse transcription kit. SYBgreen premix, cDNA and target gene primers were mixed and RT-qPCR detection was performed. The primer sequences are as follows:

[0091] β-actin (internal reference): sense strand, CACCATTGGCAATGAGCGGTTC; antisense strand, AGGTCTTTGCGGATGTCCACGT

[0092] TRAP: sense strand, CATCAATGACAAGAGGTTCCAG; antisense strand, AAGTGCAGGCGGTAGAAAG

[0093] c-FOS: positive strand, CTCCAGTGCCAACTTCATTC; antisense strand, CAGCCATCTTATTCCTTTCCC

[0094] NFATc1: sense strand, TCCTCTCCAACACCAAAGTC; antisense strand, ATGTCCGTCTCTCCTTTCC

[0095] MMP9: sense strand, GCCACTTCCCCTTCATCTTC; antisense strand, GTTTCCCATCAGCATTGCC

[0096] 3. Experimental results: Western blot showed that CPT2 small interfering RNA significantly inhibited CPT2 protein level ( Figure 2A), TRAP staining results showed that CPT2 small interfering RNA significantly inhibited osteoclast differentiation ( Figure 2 B, 2C), RT-qPCR detection of CPT2 small interfering RNA inhibiting the expression of osteoclast differentiation-related marker genes TRAP, c-fos, NFATC1 and MMP9 ( Figure 2 D) (**, P < 0.01).

[0097] Example 4. Perhexiline maleate inhibits osteoclast differentiation

[0098] 1. Materials and reagents: recombinant human M-CSF, R&D, AFL216, recombinant human RANKL, R&D, 390-TN-010, TRAP staining kit, 387A-1KT, Sigma; MEMα medium, Gibco, 12571063; RNA extraction kit, Qiagen, 74104; perhexiline maleate, MCE, HY-B1334A; FBS, Gibco, A5256701.

[0099] 2. Experimental Methods: Peripheral blood monocytes / macrophages were rapidly isolated using CD14 magnetic beads. After counting, cells were plated in MEMα medium supplemented with 30 ng / mL M-CSF and 10% FBS and seeded into either 96-well or 24-well plates. After overnight culture, the cells were replaced with induction medium containing varying concentrations of perhexiline maleate (MEMα medium supplemented with 10% FBS, 30 ng / mL M-CSF, and 50 ng / mL RANKL). The medium was changed every other day.

[0100] After 14 days, cells in 96-well plates were fixed with 4% PFA, stained for TRAP, and counted. Total RNA was extracted from cells in 24-well plates using an RNA extraction kit. After RNA concentration was determined, 1 μg of RNA was used to synthesize cDNA using a reverse transcription kit. SYBgreen premix, cDNA, and target gene primers (TRAP, c-Fos, NFATc1, and MMP9) were mixed for RT-qPCR analysis.

[0101] 3. Experimental results: Both 2 μM and 10 μM Perhexiline maleate inhibited osteoclast differentiation and expression of osteoclast-related markers ( Figure 3 ).

[0102] Example 5. Perhexiline maleate inhibits osteoclast bone resorption

[0103] 1. Materials and reagents: bone slices (IDS, DT-1BON1000-96), wheat agglutinin (Sigma, L9640), 3,3'-diaminobenzidine (Sigma, D8001).

[0104] 2. Experimental Methods: Peripheral blood monocytes / macrophages were rapidly isolated using CD14 magnetic beads. After counting, cells were added to MEMα medium containing 30 ng / mL M-CSF and 10% FBS and seeded onto bone slices. After 24 hours, fresh induction medium (complete MEMα medium containing 30 ng / mL M-CSF and 50 ng / mL RANKL) was added to induce osteoclast differentiation. After 48 hours, the induction medium was replaced with perhexiline maleate, with the medium changed daily. After 14 days, the medium was aspirated, 0.5N NaOH solution was added, and cell debris was removed with a cotton swab. Cells were incubated with 50 μg / mL wheat agglutinin for 30 minutes, followed by incubation with 3,3'-diaminobenzidine for 30 minutes.

[0105] 3. Experimental results: Compared with the control group, 2 μM Perhexiline maleate inhibited the bone resorption function of osteoclasts, and 10 μM Perhexiline maleate inhibited the bone resorption function of osteoclasts more significantly ( Figure 4 ).

[0106] Example 6. Perhexiline maleate inhibits bone loss in ovariectomized mice

[0107] 1. Materials and reagents: P1NP ELISA kit, IDS, AC-33F1; CTX ELISA kit, IDS, IS-3000; microCT45, Scanco Medical AG.

[0108] 2. Experimental Methods: Eight-week-old C57BL / 6 female mice were randomly divided into the SHAM group, the OVX + DMSO group, and the OVX + Perhexiline maleate group. In the OVX group, mice were anesthetized with isoflurane inhalation. The dorsal skin of the mice was prepared and disinfected. The ovaries were located, ligated, and removed. The skin was then sutured after disinfection. In the SHAM group, the ovaries were located and sutured after disinfection. One week later, the OVX + Perhexiline maleate group was gavaged with 80 mg / kg Perhexiline maleate, while the SHAM and OVX + DMSO groups were gavaged with the same volume of solvent (DMSO). Interventions continued for 28 days. On the day of sample collection, mice were starved for 8 hours. After anesthesia, the eyes were enucleated and serum collected. Mice were sacrificed, and the tibiae were dissected and fixed with 4% PFA for 48 hours. MicroCT scans of the left tibiae were performed. The right tibia was decalcified with 14% EDTA for 2 weeks, embedded in paraffin, and sectioned. TRAP staining was performed, and the images were analyzed using BIOQUANT OSTEO 2021 V21.5.60 software.

[0109] 3. Experimental Results: MicroCT results showed that compared with the SHAM+DMSO group, the BV / TV, Tb.N, and Tb.Th in the OVX+DMSO group were significantly decreased, while Tb.Sp was increased, indicating that the OVX model was successfully established. The bone mass of OVX mice treated with perhexiline maleate was significantly increased compared with the OVX+DMSO group, indicating that perhexiline maleate inhibited the bone mass loss caused by OVX. Serum ELISA results showed that the bone resorption marker CTX was significantly increased in the OVX+DMSO group compared with the SHAM+DMSO group. The CTX level in the OVX+Perhexiline maleate group was lower than that in the OVX+DMSO group, indicating that perhexiline maleate inhibited the OVX-induced increase in bone resorption. Bioquant quantitative analysis showed that compared with the SHAM+DMSO group, the OVX+DMSO group had a significant increase in osteoclast formation, while perhexiline maleate inhibited the OVX-induced increase in osteoclast formation.

[0110] Example 7. Perhexiline maleate enhances the therapeutic effect of denosumab on bone loss in ovariectomized mice.

[0111] 1. Materials and reagents: Denosumab, Amgen; P1NP ELISA kit, IDS, AC-33F1; CTX ELISA kit, IDS, IS-3000; microCT45, Scanco Medical AG.

[0112] 2. Experimental Methods: Eight-week-old C57BL / 6 female mice were randomly divided into the OVX+DMSO group, the OVX+Deno group, and the OVX+Deno+PM group. In the OVX group, mice were anesthetized with isoflurane inhalation. The dorsal skin of the mice was prepared and disinfected. The skin was incised and the ovaries were located, ligated, and then removed. After disinfection, the skin was sutured. One week later, the OVX+Deno group received a subcutaneous injection of 5 mg / kg denosumab every two weeks and daily DMSO gavage (PM vehicle control). The OVX+Deno+PM group received a subcutaneous injection of 5 mg / kg denosumab every two weeks and daily DMSO gavage (PM vehicle control). The OVX+DMSO group received a subcutaneous injection of normal saline weekly (denosumab control) and daily DMSO gavage (PM vehicle control). Interventions continued for 28 consecutive days. On the day of sampling, mice were starved for 8 hours, and their eyes were enucleated after anesthesia for serum collection. Mice were sacrificed, and bilateral tibiae were isolated and fixed in 4% PFA for 48 hours. MicroCT scanning of the left tibia was performed. The right tibiae were decalcified with 14% EDTA for 2 weeks, embedded in paraffin, and sectioned. TRAP staining was performed, and images were analyzed using BIOQUANT OSTEO 2021 V21.5.60 software.

[0113] 3. Experimental Results: MicroCT results showed that compared with the OVX+DMSO group, the OVX+Deno group had significantly increased BV / TV, Tb.N, and Tb.Th, while Tb.Sp decreased, confirming the therapeutic effect of denosumab on ovariectomy-induced osteoporosis. Furthermore, bone mass in OVX mice treated with both denosumab and perhexiline maleate (OVX+Deno+PM) was significantly increased compared with the OVX+Deno group, indicating that perhexiline maleate can enhance the therapeutic effect of denosumab on osteoporosis in OVX mice. Serum ELISA results showed that the bone resorption marker CTX was significantly decreased in the OVX+Deno group compared with the OVX+DMSO group. Furthermore, CTX levels were lower in the OVX+Deno+PM group than in the OVX+Deno group, indicating that the combination of denosumab and perhexiline maleate can further inhibit the OVX-induced increase in bone resorption.

[0114] Finally, it should be noted that the above embodiments are intended only to illustrate the present invention and are not intended to limit the scope of protection of the present invention. In addition, after reading the technical contents of the present invention, those skilled in the art may make various changes, modifications, or variations to the present invention, and all such equivalent forms also fall within the scope of protection defined by the present application.

Claims

1. Use of a CPT2 inhibitor in the preparation of a drug for treating postmenopausal osteoporosis, characterized in that: The CPT2 inhibitor includes at least one of perhexiline maleate and small interfering RNA of the CPT2 gene. The small interfering RNA inhibiting the CPT2 gene is: CPT2-Hsa-siRNA, and the sequence is CCAGGCTGCCTATTCCCAAACTTGA.

2. The use according to claim 1, characterized in that: The use of the drug is at least one of the following: Inhibit osteoclast formation; or, inhibiting the expression of key transcription factors for osteoclast formation; or, inhibiting the bone resorption function of osteoclasts; or, alleviate bone loss in ovariectomized mice; or, inhibiting serum bone resorption markers in ovariectomized mice.

3. The use according to claim 1, characterized in that The drug is a combination of perhexiline maleate and denosumab.

4. The use according to claim 3, characterized in that The dosage of the drugs is: denosumab 5 mg / kg / two weeks by subcutaneous injection, and perhexiline maleate 80 mg / kg / day by oral gavage.

5. Application of CPT2 inhibitor Perhexiline maleate in the preparation of drugs to enhance the effect of Denosumab in the treatment of postmenopausal osteoporosis.

Images