External field thermal gating nano-channel with cell ion transport regulation and control function and application of external field thermal gating nano-channel
By combining temperature-gated DNA nanochannels and external field heat conversion nanomaterials to construct external field hot-controlled nanochannels, the efficiency and stability of DNA nanochannels in ion transport regulation are solved, and the precise treatment of neurological diseases is achieved.
Patent Information
- Application Number
- CN202510256721.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2025-08-01
AI Technical Summary
The existing DNA nanochannels are greatly affected by the dynamic physiological environment when regulating ion transport, and their efficiency, accuracy and stability are limited, making it difficult to achieve accurate ion transport regulation, especially when treating neurological diseases.
By combining temperature-gated DNA nanochannels with external field heat-converted nanomaterials, an external field heat-controlled nanochannel is formed, and local heating is used to control the opening and closing of DNA nanochannels, and precise regulation of ion transport is achieved.
It provides an accurate, controllable and safe ion transport strategy, which can directly and efficiently regulate the transport of substances inside and outside the cell, is suitable for the treatment of neurological diseases, and has the potential of a multifunctional integrated platform.
Smart Images

Figure CN120393035A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and more particularly, to an externally field-heat-responsive nanoscale channel having a function of regulating cellular ion transport and its applications. Background Art
[0002] Dynamic and repetitive ion transmembrane transport plays a central role in the regulation of various physiological functions such as the generation of the resting potential and action potential of neurons, neurotransmitter release, and nerve signal transduction. Abnormal ion transport can lead to neurological diseases such as epilepsy, neuropathic pain, and autism. Currently, the treatment methods for the above diseases include drug therapy, biological gene editing, and physical electrical stimulation, etc., by stimulating biological ion channels to restore normal ion transport. However, biological ion channels usually have multiple subtypes and the structures among various subtypes are highly similar, which limits the targeting accuracy and intervention efficiency of the above regulation schemes for ion channels and results in serious safety risks such as drug addiction, gene mutation, and nerve injury. Therefore, it is necessary to study an accurate, controllable, and safe ion transport strategy from a new perspective.
[0003] Artificial DNA nanoscale channels with ion transport functions have been developed by extending the gating structure and physiological functions beyond ion channels. Due to their unique structural precision and adjustability, extensive chemical modification ability, and good biocompatibility, DNA nanoscale channels are considered to be an ideal choice for effectively and accurately regulating ion transport on cells. So far, DNA nanoscale channels with different morphological structures and gating strategies have been constructed to regulate the transport of substances by responding to external environments (such as temperature, pH, cation concentration, complementary strands, aptamers, etc.). However, these environment-responsive gates are greatly affected by the dynamic physiological environment, and their efficiency, accuracy, and stability are limited, resulting in uncontrolled and non-repetitive regulated ion transport.
[0004] Therefore, there is an urgent need in the art to develop a precisely gated DNA nanoscale channel to achieve precise cyclic ion transport for neurological diseases. Summary of the Invention
[0005] In view of the above problems, one object of the present invention is to provide an artificial externally field-heat-responsive nanoscale channel having a function of regulating cellular ion transport.
[0006] Another object of the present invention is to provide a regulation of ion flow mediated by the nanoscale channel and its application in corresponding diseases.
[0007] In the first aspect of the present invention, there is provided an externally field-heat-responsive nanoscale channel, which is obtained by connecting a temperature-gated DNA nanoscale channel with a nanomaterial for external field heat conversion through click chemistry.
[0008] In another preferred embodiment, the externally field-heated and gated nanochannel has the function of regulating cell ion transport.
[0009] In another preferred embodiment, the nanomaterial for external field heat conversion converts external field energy into heat energy to locally raise the temperature to the gating temperature (or response temperature) of the DNA nanochannel, thereby opening the externally field-heated and gated nanochannel.
[0010] In another preferred embodiment, the structure of the DNA nanochannel is selected from the group consisting of: 2 HB (double helix), 4 HB (tetrahelix), 6 HB (hexahelix), regular hexagon, square or tower-shaped origami structure, preferably the 6 HB (hexahelix) structure.
[0011] In another preferred embodiment, the structure of the DNA nanochannel comprises the DNA strands shown in SEQ ID NO: 1-6.
[0012] In another preferred embodiment, the structure of the DNA nanochannel further comprises a covalently linked lid at the top of the channel as a resealable cap, and the lid sequence is as shown in SEQ ID NO: 7 (AACCGCGCAGCGTTTTTTTTTATGACGTGCTTTTTTTTTATCGTGACTTTTTTTTTCGTGATTACTTA).
[0013] In another preferred embodiment, the covalent linkage region of the lid has a melting temperature of 30-60 °C (preferably 38-48 °C).
[0014] In another preferred embodiment, the gating temperature of the DNA nanochannel is obtained by designing the lid sequence to regulate the required melting temperature.
[0015] In another preferred embodiment, the gating temperature of the temperature-gated DNA nanochannel is 30-60 °C, preferably 38-48 °C; more preferably 40-45 °C.
[0016] In another preferred embodiment, the DNA nanochannel is modified with an N3 (azide) group.
[0017] In another preferred embodiment, the nanomaterial is modified with a DBCO (dibenzocyclooctyne) gene.
[0018] In another preferred embodiment, the externally field-heated and gated nanochannel is obtained by connecting the DNA nanochannel modified with an N3 (azide) group and the nanomaterial for external field heat conversion modified with a DBCO (dibenzocyclooctyne) gene through a click chemical reaction.
[0019] In another preferred embodiment, the reaction conditions of the click chemistry reaction include: the reaction temperature is 35-38 °C, and the reaction time is 0.5-4 h.
[0020] In another preferred embodiment, the external field heat includes photothermal and / or magnetic heat.
[0021] In another preferred embodiment, the nanomaterials for external field heat conversion include nanomaterials responsive to photothermal and / or magnetic heat.
[0022] In another preferred embodiment, the nanomaterials are selected from one or more combinations of the following groups: gold-iron heterojunction, gold nanorods, silver nanorods, graphene, carbon nanotubes, black phosphorus, magnetite, cobalt ferrite, nickel ferrite or neodymium iron boron, preferably gold-iron heterojunction.
[0023] In another preferred embodiment, the gold-iron heterojunction is responsive to both light field and magnetic field.
[0024] In another preferred embodiment, the concentration ratio of the DNA nanochannel to the nanomaterial is 200 nM: 0-200 μg / mL (calculated as Fe), where the concentration of the nanomaterial is not 0; preferably, the dosage ratio of the DNA nanochannel to the nanomaterial is 200 nM: 100 μg / mL (calculated as Fe).
[0025] In the second aspect of the present invention, a method for preparing the external field heat-controlled nanochannel as described in the first aspect of the present invention is provided, and the method includes the following steps:
[0026] Connect the temperature-gated DNA nanochannel with the nanomaterial for external field heat conversion through click chemistry reaction to obtain the external field heat-controlled nanochannel.
[0027] In another preferred embodiment, the concentration ratio of the DNA nanochannel to the nanomaterial is 200 nM: 0-200 μg / mL (calculated as Fe), where the concentration of the nanomaterial is not 0; preferably, the dosage ratio of the DNA nanochannel to the nanomaterial is 200 nM: 100 μg / mL (calculated as Fe).
[0028] In another preferred embodiment, the reaction conditions of the click chemistry reaction include: the reaction temperature is 35-38 °C, and the reaction time is 0.5-4 h.
[0029] In another preferred embodiment, the structure of the DNA nanochannel is selected from the following groups: 2 HB (double helix), 4 HB (tetrahelix), 6 HB (hexagonal helix), regular hexagon, square or tower-shaped origami structure, preferably 6 HB (hexagonal helix) structure.
[0030] In another preferred embodiment, the structure of the DNA nanochannel comprises the DNA strands shown in SEQ ID NO: 1-6.
[0031] In another preferred embodiment, the DNA nanochannel is modified with an N3 (azide) group.
[0032] In another preferred embodiment, the DNA nanochannel contains the sequence shown in SEQ ID NO: 7.
[0033] In another preferred embodiment, the method for preparing the DNA nanochannel comprises the following steps:
[0034] (1) Dissolve 7 DNA single strands shown in SEQ ID NO: 1-7 in 1×TAE in equimolar amounts, add Mg 2+ ) Heat to 90-99 °C for 10-20 min, and after programmed gradient cooling, obtain the temperature-gated DNA nanochannel.
[0035] In another preferred example, the process of the programmed gradient cooling includes the following heating and cooling procedures:
[0036] Heat to 95 °C for 10 minutes; after cooling to 60 °C at a rate of 0.5 °C per minute, then cool to 20 °C at a rate of 1 °C per minute, and store at 4 °C.
[0037] In another preferred embodiment, the nanomaterial is modified with a DBCO (dibenzocyclooctyne) gene.
[0038] In another preferred embodiment, the external field heat-gated nanochannel is obtained by connecting the DNA nanochannel modified with an N3 (azide) group and the external field heat-converting nanomaterial modified with a DBCO (dibenzocyclooctyne) gene through a click chemical reaction.
[0039] In another preferred embodiment, the nanomaterial is a gold-iron heterojunction.
[0040] In another preferred embodiment, the method for preparing the gold-iron heterojunction comprises the following steps:
[0041] (1) Prepare the precursor gold spheres: Dissolve 50-70 mg of chloroauric acid in 5-20 mL of a mixed solution composed of 1-octadecene, oleic acid, and oleylamine in a volume ratio of 10-15:1:1, stir, heat the mixture to 120-150 °C and keep it for 30-60 min. After cooling, centrifuge and purify the product, and wash it with ethanol and n-hexane (V / V = 2:1) to obtain the precursor gold spheres;
[0042] (2)Preparation of Au-Fe heterojunction in oil phase: Add the precursor gold spheres obtained in step (1) to a mixture of iron acetylacetonate, 1,2-dodecanediol, oleic acid, oleylamine, and 1-octadecene, ultrasonically disperse, and heat to 300 - 330 °C in an argon atmosphere for 2 - 4 h. After cooling to room temperature, centrifuge to collect the product, wash it 3 times with a mixture of isopropanol and methanol (V / V = 1:1), and disperse it in n-hexane to obtain the Au-Fe heterojunction in oil phase;
[0043] Among them, the molar ratio of the precursor gold spheres to iron acetylacetonate, 1,2-dodecanediol, oleic acid, and oleylamine is: (0.05 - 0.2):(0.2 - 0.4):(2 - 4):(2 - 4):(2 - 4), preferably 0.1:0.25:1:1:1, and the volume of 1-octadecene is 5 - 50 mL;
[0044] (3)Preparation of hydrophilic Au-Fe heterojunction: Mix the Au-Fe heterojunction in oil phase obtained in step (2) with mPEG 5000 -SH, H2N-PEG 5000 -COOH, and toluene, ultrasonically treat for 2 - 3 h, magnetically separate overnight to remove excess toluene and PEG 5000 , and then wash it 3 times with ultrapure water to obtain a hydrophilic Au-Fe heterojunction with an amino group on the magnetic sphere;
[0045] Among them, the mass ratio of the Au-Fe heterojunction in oil phase to mPEG 5000 -SH and H2N-PEG 5000 -COOH is: 1:(1 - 20):(1 - 20); preferably 1:10:10; the volume of toluene is 1 - 30 mL;
[0046] (4)Preparation of DBCO-modified Au-Fe heterojunction: Mix the hydrophilic Au-Fe heterojunction obtained in step (3) with EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide), NHS (N-hydroxysuccinimide), DBCO-COOH, and PBS, ultrasonically treat for 2 - 3 h, with a power of 130 - 260 W, centrifuge to collect the product, and wash it 3 times with ultrapure water to obtain the DBCO-modified Au-Fe heterojunction;
[0047] Among them, the mass ratio of the hydrophilic Au-Fe heterojunction to EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide), NHS (N-hydroxysuccinimide), and DBCO-COOH is: 1:(50 - 200):(10 - 100):(1 - 10), preferably 1:100:66:1; the volume of PBS is 1 - 30 mL.
[0048] In the third aspect of the present invention, a method for regulating the transport of substances inside and outside cells for non-diagnostic or therapeutic purposes in vitro is provided, including the following steps:
[0049] After inserting the externally field-responsive DNA nanochannel as described in the first aspect of the present invention into a cell, under the action of an external field, the opening or closing of the externally field-responsive DNA nanochannel is mediated, thereby regulating the transport of substances inside and outside the cell.
[0050] In another preferred embodiment, the method further comprises the step: when the externally field-responsive nanochannel as described in the first aspect of the present invention is inserted into a cell, through an external field that deeply penetrates, locally regulates, and is precisely controllable, the ion transport situation inside and outside the cell membrane can be regulated spatiotemporally, reversibly, and ultimately the electrophysiological function of the cell is regulated.
[0051] In another preferred embodiment, the insertion refers to modifying the externally field nanochannel with cholesterol, tocopherol, acetylated alkyl, porphyrin, or a combination thereof (preferably cholesterol modification) to obtain the property of inserting into the cell membrane, thereby performing cell insertion.
[0052] In another preferred embodiment, the external field is selected from the following group:
[0053] (1) An alternating magnetic field with a frequency of 50 - 500 kHz and an intensity of 330 Oe, or
[0054] (2) A laser with a wavelength of 400 - 1200 nm and a power of 0 - 2 W / cm 2 。
[0055] In another preferred embodiment, the action time of the external field is 10 s - 30 min.
[0056] In another preferred embodiment, the cells include: cells of the nervous system, stem cells, immune cells, and tumor cells.
[0057] In another preferred embodiment, the cells of the nervous system include neurons of non-human mammals (dorsal root ganglion cells, cortical neurons, hippocampal neurons), glial cells (astrocytes, oligodendrocytes, microglia, Schwann cells), and neural stem cells.
[0058] In another preferred embodiment, the non-human mammals include: mice, rats, dogs, or monkeys.
[0059] In another preferred embodiment, the neurons are selected from the following group: ND7 / 23 cells or DRG neurons.
[0060] In another preferred embodiment, the substances to be regulated inside and outside the cell can be one or several of sodium, potassium, calcium, magnesium, iron, copper, and zinc ions, or can also be small molecule compounds with a hydrated particle size less than 2 nm.
[0061] In another preferred embodiment, due to the repulsive effect of the negatively charged backbone of the DNA nanochannel on negatively charged substances, when the substances to be regulated inside and outside the cell are positively charged substances, they are usually more easily transported.
[0062] In the fourth aspect of the present invention, there is provided a use of the externally field-heated and controlled nanochannel as described in the first aspect of the present invention or the externally field-heated and controlled nanochannel prepared by the method as described in the second aspect of the present invention, for:
[0063] (1) regulating the transport of substances inside and outside the cell;
[0064] (2) enhancing the excitability of nerve cells;
[0065] (3) activating immune cells;
[0066] (4) promoting the differentiation of stem cells.
[0067] In another preferred embodiment, the cells include: cells of the nervous system, stem cells, immune cells, and tumor cells.
[0068] In another preferred embodiment, the cells of the nervous system include neurons of non-human mammals (dorsal root ganglion cells, cortical neurons, hippocampal neurons), glial cells (astrocytes, oligodendrocytes, microglia, Schwann cells), and neural stem cells.
[0069] In another preferred embodiment, the non-human mammals include: mice, rats, dogs, or monkeys.
[0070] In another preferred embodiment, the neurons are selected from the group consisting of ND7 / 23 cells or DRG neurons.
[0071] In another preferred embodiment, the substances to be regulated inside and outside the cell can be one or more of sodium, potassium, calcium, magnesium, iron, copper, and zinc ions, or can be small molecule compounds with a hydrated particle size less than 2 nm.
[0072] In the fifth aspect of the present invention, there is provided an application of the externally field-heated and controlled nanochannel as described in the first aspect of the present invention or the externally field-heated and controlled nanochannel prepared by the method as described in the second aspect of the present invention in the preparation of cross-biological membrane materials, anti-tumor drug delivery materials, photodynamic reagent delivery materials, anti-inflammatory agent delivery materials, or antibacterial agent delivery materials.
[0073] It should be understood that within the scope of the present invention, the above-mentioned various technical features of the present invention and the technical features specifically described below (such as in the examples) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be elaborated one by one here.
[0074] Compared with the prior art, the present invention has the following technical effects:
[0075] (1) The artificial externally field-heat-gated nanochannel provided by the present invention has the function of regulating cell ion transport.
[0076] (2) The artificial externally field-heat-gated nanochannel provided by the present invention combines the externally field regulation method mediated by nanomaterials with local controllable adjustment advantages and the DNA nanochannel, provides an accurate externally field gating switch for the DNA nanochannel, and endows it with the ability to accurately transport substances.
[0077] (3) The externally field-heat-gated nanochannel constructed by the present invention is applied to the regulation of cell ion transport. Compared with the method of regulating ion transport through natural ion channels, the artificial externally field-heat-gated nanochannel of the present invention uses an ion transport regulation method with spatio-temporal precision, is more direct, efficient, accurate and controllable, and can be repeated, making it have broad application prospects in the treatment of nervous system diseases.
[0078] (4) In addition to having the ability of externally field heat conversion, the nanomaterials introduced in the present invention usually also have functions such as imaging and magnetic guidance. The externally field-heat-gated nanochannel provided by the present invention has the potential to become a multi-functional integrated platform for diagnosis and treatment. Description of the Drawings
[0079] Figure 1 Schematic diagram showing the morphological structure of the DNA nanochannel in Example 1 of the present invention. Among them, Figure A is the transmission electron microscope (TEM) image of the DNA nanochannel; Figure B is the atomic force microscope (AFM) image of the DNA nanochannel. 1 and 2 in Figure B respectively represent 1 typical DNA nanochannel; Figures C and D respectively show the height and outer diameter results of the DNA nanochannel statistically obtained from Figure B.
[0080] Figure 2 Diagram showing the temperature response result of the DNA nanochannel in Example 1 of the present invention. Among them, Figure A is a schematic diagram of the temperature response detection process of the DNA nanochannel: the energy resonance transfer fluorescent pair Cy3 / Cy5 is labeled in the gating region of the DNA nanochannel (Cy3 is labeled on the capping strand, and Cy5 is labeled on the tube wall). At room temperature, the DNA nanochannel remains closed, showing Cy5 fluorescence. When the temperature rises above 40 °C, the DNA nanochannel gating opens, showing Cy3 fluorescence; Figure B shows the change of Cy3 and Cy5 fluorescence intensities with temperature. Figure C shows the kinetic change of the FRET signal between Cy3 and Cy5 in five heating-cooling cycles.
[0081] Figure 3Show the TEM image of the Au-Fe heterojunction in Example 1 of the present invention. The scale bar is 20 nm. Among them, the histogram is the particle size distribution diagram of the Au-Fe heterojunction statistically based on the TEM results.
[0082] Figure 4 Show the results of the thermal heating effect of the Au-Fe heterojunction in Examples 1, 2, and 3 of the present invention. Among them, the A-B diagrams respectively show the temperature changes during the natural cooling process after irradiating the Au-Fe heterojunction solution and ultrapure water with an 808 nm laser (1 W / cm 2 , 20 min), and the calculation of the photothermal conversion ability of the Au-Fe heterojunction through the above process; Diagram C shows the temperature increase of the Au-Fe heterojunction, the control nanomaterials (gold nanospheres, magnetic nanospheres) with the same size as it, and water under the action of an 808 nm laser (1W / cm 2 , 20 min); Diagram D is the TEM and particle size distribution diagrams of the synthesized gold nanospheres and magnetic nanospheres respectively; Diagram E is the calculation of the magnetic thermal heating and magnetic thermal specific loss power of Au-Fe heterojunctions with different concentrations under a high-frequency alternating magnetic field; Diagram F is the calculation of the thermal heating situation and specific loss power of Au-Fe heterojunctions with different concentrations under the combined action of laser and high-frequency alternating magnetic field.
[0083] Figure 5 Show the results of the external field response of the external field thermally gated nanochannel in Example 1 of the present invention. Among them, Diagram A shows the schematic diagram of the optical response verification of the external field thermally gated nanochannel: The energy resonance transfer fluorescence pair Cy3 / Cy5 is labeled in the gated region of the DNA nanochannel (Cy3 is labeled on the capping strand, and Cy5 is labeled on the tube wall). When no laser is applied, the DNA nanochannel remains closed, showing Cy5 fluorescence. When the laser causes the Au-Fe heterojunction to undergo photothermal heating to above 40 °C, the DNA nanochannel gate opens, showing Cy3 fluorescence; Diagram B shows the fluorescence intensity changes of Cy3 and Cy5 of the DNA nanochannel and the external field thermally gated nanochannel with / without laser application. Diagram C shows the fluorescence changes of Cy3 / Cy5 under 3 cycles of laser application - turning off. Among them, NC represents the DNA nanochannel, JNP represents the Au-Fe heterojunction, and Laser represents laser irradiation.
[0084] Figure 6 Show the results of the establishment of the external field thermally gated nanochannel on the cell membrane in Example 1 of the present invention, and the scale bar is 10 µm. Among them, Hoechst represents the nuclear staining result, Membrane represents the cell membrane staining result, NC represents the Cy3-labeled DNA nanochannel, JNP represents the FITC-labeled Au-Fe heterojunction, and the two together form the external field thermally gated nanochannel. Colocalization shows the co-localization result of NC-JNP and the cell membrane, and Merge represents the coincidence result of all fluorescence channels and the bright field channel.
[0085] Figure 7 Show the ion flow result diagram of primary DRG neurons mediated by the external field heat-controlled nanochannel in Example 1 of the present invention. Among them, Figure A-Figure D respectively represent the detection results of intracellular potassium ion, sodium ion, calcium ion and chloride ion concentrations. Control uses a pure cell group, Laser represents laser irradiation, and NC-JNP represents the external field heat-controlled nanochannel.
[0086] Figure 8 Show the cytotoxicity detection result diagram of the external field heat-controlled nanochannel composed of different external field heat conversion nanomaterials. Among them, Figure A represents the detection result of the external field heat-controlled nanochannel composed of 200 nM DNA nanochannel and different concentrations (µg / mL in terms of Fe) of gold-iron heterojunction (Au-Fe3O4 Janus nanoparticle, JNP). Figure B represents the detection result of different concentrations of the external field heat-controlled nanochannel composed of 200 nM DNA nanochannel and different concentrations (µg / mL in terms of Au) of gold nanospheres (gold nanosphere, GNS). Since the mass ratio of Fe to Au in the gold-iron heterojunction is 1.0:1.3, the concentrations (in terms of Au) of the materials in Figure A and Figure B are kept consistent. NC represents the DNA nanochannel, and Laser represents laser irradiation.
[0087] Figure 9 Show the overexcitation result diagram of primary DRG neurons mediated by the external field heat-controlled nanochannel in Example 1 of the present invention. Figure A represents the change of the resting membrane potential (RMP) of DRG neurons in each group; Figure B represents the firing frequency of action potentials (AP) induced by step current injection in each group; Figure C is a representative AP trace in the pure cell and external field heat-controlled nanochannel + laser groups; Figure D is the tracing of APs with different current intensities in the pure cell group and the external field heat-controlled nanochannel + laser group. The AP-induced current injection starts from -20 pa and increases by 20 pa per step; Figure E represents the rheological enzyme change in the pure cell group and the external field heat-controlled nanochannel + laser group; Figure F is a representative image of the real-time membrane potential trace of the external field heat-controlled nanochannel when the laser is turned on and off. Figure G is the change of the real-time membrane potential in the pure cell group and the external field heat-controlled nanochannel group when the laser is turned on and off. Control uses a pure cell; Laser represents the applied laser; NC-JNP represents the external field heat-controlled nanochannel. Detailed implementation mode
[0088] To make the objectives, technical solutions, beneficial effects, and remarkable improvements of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, all these described embodiments are only partial embodiments of the present invention, rather than all embodiments; based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.
[0089] As used herein, the term "nanomaterials with external field thermal response" refers to nanomaterials that can exhibit thermal response behavior to external stimuli (such as light, magnetic field, electric field, etc.). Under the action of an external field, these materials can absorb energy and convert it into heat energy, thereby showing temperature changes or thermal effects.
[0090] The nanomaterials with external field thermal response in the present invention include but are not limited to: photothermal response materials (such as gold nanorods, silver, carbon nanotubes, black phosphorus), magnetothermal response materials (such as ferrite nanoparticles (such as Fe3O4), cobalt ferrite, nickel ferrite, or neodymium iron boron), electrothermal response materials (such as conductive polymers, carbon-based materials (such as graphene), metal nanowires), and gold-iron heterojunctions that are responsive to both light fields and magnetic fields; and other external field thermal response materials (such as microbubbles, nanoparticles, or carbon-based materials). The nanomaterials with external field thermal response of the present invention preferably include gold-iron heterojunctions.
[0091] Example 1
[0092] In this example, an artificial external field thermally controlled DNA nanochannel was constructed, and its application as a transport channel for open regulation of cell ion transport under external light field control was demonstrated. The specific steps are as follows:
[0093] (1) Preparation and characterization of temperature-gated DNA nanochannels:
[0094] The DNA nanochannel mainly consists of 6 DNA strands, among which 6 DNA strands (SEQ ID NO: 1-6) interact to form a nanochannel structure, and the last 1 DNA strand (SEQ ID NO: 7) is covalently connected to the top of the channel as a lid that can be repeatedly opened and sealed.
[0095] Through the design of the DNA sequence of this DNA strand SEQ ID NO: 7, the covalent connection region of the lid has a melting temperature of 40°C. In addition, the 5' end of the lid strand is also modified with an N3 group, enabling it to be coupled to a gold-iron heterojunction modified with a DBCO group through click chemical reaction. The specific sequences of the 7 single strands are shown in Table 1:
[0096] Table 1
[0097]
[0098] These 7 DNA single strands were taken in equimolar amounts (each at 1 μM, dissolved in 1×TAE, with 20 mM Mg 2+ ) and heated to 95 °C for 10 min, cooled at 0.5 °C / min to 60 °C, and then cooled at 1 °C / min to 20 °C. Then the samples were stored at 4 °C to obtain temperature-gated DNA nanochannels.
[0099] The results were as Figure 1 shown, and the morphological structure of the DNA nanochannels was cylindrical ( Figure 1 A, B), with a height of approximately 16.25 ± 2.05 nm ( Figure 1 C), and an outer diameter of approximately 4.28 ± 0.71 nm ( Figure 1 D).
[0100] The temperature responsiveness of the DNA nanochannels was characterized by modifying a fluorescence FRET pair (Cy3 / Cy5) at the gating site of the DNA nanochannels, and the results were as Figure 2 shown.
[0101] Figure 2 The results showed that as the temperature increased, the fluorescence intensity of Cy3 gradually increased, while the fluorescence intensity of Cy5 decreased correspondingly, indicating that the gating of the DNA nanochannels had temperature responsiveness ( Figure 2 A - 2B). In addition, in five heating and cooling cycles, the opening of the temperature-gated DNA nanochannels was stable and repeatable ( Figure 2 C).
[0102] (2) Preparation and characterization of the photothermal conversion material gold-iron heterojunction:
[0103] Chloroauric acid (65 mg) was dissolved in a mixture of 1-octadecene (10 mL), oleic acid (1 mL), and oleylamine (1 mL) and stirred for 10 min, and then the mixture was heated to 130 °C and kept for 30 min. After cooling, the product was centrifuged and purified, and washed twice with ethanol and n-hexane (V / V = 2:1) to obtain precursor gold spheres.
[0104] All of the precursor gold spheres were added to a mixture of iron acetylacetonate (0.5 mmol, 177 mg), 1,2-dodecanediol (2 mmol, 508 mg), oleic acid (2 mmol, 565 mg), oleylamine (2 mmol, 530 mg) and 1-octadecene (50 mL). The mixture was sonicated for 10 min to disperse it, heated to 115 °C under argon, and the condensation device was removed for 30 min to remove the n-hexane contained in the solution. Then the condensation device was reinstalled, and the solution was heated to 205 °C for 2 h and then heated to 315 °C in an argon atmosphere for 2 h. After cooling to room temperature, the product was collected by centrifugation, washed 3 times with a mixture of isopropanol and methanol (V / V = 1:1), and finally dispersed in n-hexane to obtain an oil-phase gold-iron heterojunction.
[0105] The above-synthesized gold-iron heterojunction (1 mg calculated based on Fe concentration) was mixed with mPEG 5000 -SH (10 mg), H2N-PEG 5000 -COOH (10 mg), and toluene (5 mL), sonicated for 2 h, and the excess toluene and PEG 5000 were removed by magnetic separation overnight, and then washed 3 times with ultrapure water to obtain a hydrophilic gold-iron heterojunction with amino groups on the magnetic spheres.
[0106] The obtained hydrophilic gold-iron heterojunction (1 mg calculated based on Fe concentration) was mixed with 100 mg of EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide), 66 mg of NHS (N-hydroxysuccinimide), 1 mg of DBCO-COOH, and 10 mL of PBS, sonicated for 2 h at a power of 195 W, a working time of 5 s, and an interval time of 2 s. The product was collected by centrifugation and washed 3 times with ultrapure water to obtain a DBCO-modified gold-iron heterojunction.
[0107] The results showed that the morphological structure of the gold-iron heterojunction was a dumbbell-like structure with an average size of 22.36 ± 3.55 nm as shown by TEM images (as Figure 3 ). In addition, the photothermal heating of the gold-iron heterojunction is shown in Figure 4 A-C. Under the irradiation of an 808 nm laser with a power of 1 W / cm 2 , the photothermal conversion efficiency of the gold-iron heterojunction was 67.4% ( Figure 4 A, B). At a concentration of 50 μg / mL, the material could increase the local temperature from 37.0 °C to 48.7 °C within 1 min, reaching the gating temperature of the DNA nanochannel ( Figure 4C). To demonstrate the irreplaceability of the gold-iron heterojunction (JNP), the inventors also used gold nanospheres (GNS) and magnetic nanospheres (MNS) of the same size to perform photothermal heating under the same laser conditions. The experimental results showed that the temperature of the gold nanospheres (GNS) increased to 42.9 °C at 1 min, while the temperature of the magnetic nanospheres (MNS) increased to 37.6 °C, unable to reach the gating temperature of the DNA nanochannel ( Figure 4 C, D).
[0108] (3) Preparation and characterization of externally field-heated gated nanochannels:
[0109] The temperature-gated DNA nanochannel (NC) prepared in step (1) was mixed with the DBCO-modified gold-iron heterojunction (JNP) prepared in step (2) at a concentration of 200 nM and 100 μg / mL (calculated based on the Fe concentration), and co-incubated at 37 °C for 30 min to combine the two through click chemistry reaction to obtain an externally field-heated gated nanochannel (NC-JNP), which was then purified by magnetic separation.
[0110] Similarly, the external field responsiveness of the externally field-heated gated nanochannel was characterized by the fluorescence FRET pair (Cy3 / Cy5) modified at the gate, and the fluorescence change of the externally field-heated gated nanochannel prepared in step (3) under 808 nm laser irradiation (Laser, 1 W / cm 2 ) was measured ( Figure 5 A). The results showed that under laser irradiation, the fluorescence intensity of Cy3 increased, while the fluorescence intensity of Cy5 decreased correspondingly, indicating that the opening of the externally field-heated gated DNA nanochannel can be effectively controlled by near-infrared light ( Figure 5 B). In the subsequent on-off cycle of laser irradiation, the fluorescence intensity change of the FRET pair remained consistent, further confirming the reversibility and stability of the photothermal regulation gating switch of the nanochannel ( Figure 5 C).
[0111] (4) Further, the externally field-heated gated nanochannel prepared in step (3) was used in combination with the light field to directly, precisely, and reversibly regulate the ion transport and cell excitability of ND7 / 23 cells or DRG neurons. The specific process is as follows:
[0112] The murine neuroblastoma adherent cell line (ND7 / 23 cells) or primary DRG neurons extracted from mice were cultured overnight in a 35 mm glass-bottom confocal dish, co-incubated with 200 nM DNA nanochannel (NC) at 4 °C for 40 min, then 100 μg / mL gold-iron heterojunction (JNP) was added and incubated at 37 °C for 30 min, and washed twice with PBS and replaced with fresh pure DMEM medium.
[0113] Through fluorescence confocal images, the Cy3-modified DNA nanochannel (NC) appears red, the FITC-labeled gold-iron heterojunction (JNP) appears green, and the cell membrane stained with CellMask deep red appears purple. The confocal images show good colocalization effects, indicating that the externally field-heat-responsive nanochannel has been effectively constructed on the cell membrane ( Figure 6 ).
[0114] Subsequently, primary DRG cells were exposed to an 808 nm laser with a power of 1 W / cm 2 for 5 min to open the externally field-heat-responsive nanochannel and mediate ion exchange between the inside and outside of the cell. Specifically, the changes in intracellular ion concentrations can be observed through various ion fluorescence probes (including potassium ion probe PBFI AM, sodium ion probe SBFI AM, calcium ion probe Fluo 4 AM, or chloride ion probe MQAE, etc.).
[0115] The statistical results of fluorescence intensity show that
[0116] in the absence of the externally field-heat-responsive nanochannel, compared with the cells without laser irradiation (Control), there were no significant changes in the potassium ion or sodium ion concentrations in the cells irradiated with laser (Laser); while in the presence of the externally field-heat-responsive nanochannel, compared with the cells without laser irradiation (NC-JNP), the potassium ion or sodium ion concentrations in the cells irradiated with laser (NC-JNP+Laser) were significantly reduced ( Figure 7 A, B).
[0117] in the absence of the externally field-heat-responsive nanochannel, compared with the cells without laser irradiation (Control), the calcium ion concentration in the cells irradiated with laser (Laser) was significantly increased; and in the presence of the externally field-heat-responsive nanochannel, compared with the cells without laser irradiation (NC-JNP), the calcium ion concentration in the cells irradiated with laser (NC-JNP+Laser) was significantly increased ( Figure 7 C);
[0118] in the absence of the externally field-heat-responsive nanochannel, compared with the cells without laser irradiation (Control), there were no significant changes in the chloride ion concentration in the cells irradiated with laser (Laser), and in the presence of the externally field-heat-responsive nanochannel, compared with the cells without laser irradiation (NC-JNP), there were also no significant changes in the chloride ion concentration in the cells irradiated with laser (NC-JNP+Laser); while compared with the cells irradiated with laser (Control), the chloride ion concentration in the cells (NC-JNP+Laser) with the externally field-heat-responsive nanochannel opened by laser irradiation was slightly reduced ( Figure 7 D).
[0119] (5) Measure the biosafety of the externally thermally gated nanochannels. Incubate the temperature-gated DNA nanochannels (NC) prepared in step (1) with ND7 / 23 cells at a concentration of 200 nM at 4 °C for 40 min. Subsequently, incubate the DBCO-modified gold-iron heterojunctions (JNP) prepared in step (2) with ND7 / 23 cells inserted into NC at concentrations of 0, 25, 50, 75, 100 μg / mL (calculated based on Fe concentration, if corresponding to Au concentration, it is 0, 33, 66, 99, 132 μg / mL) at 37 °C for 30 min. Use an 808 nm laser (1 W / cm 2 ) to irradiate the cells for 5 min (at this time, the cells are heated to the nanochannel opening temperature), then continue to culture the cells in the incubator for 4 h. Finally, add 10% CCK-8 reagent diluted with serum-free medium to the cells and incubate for 1 h, then measure the absorbance of each group at 450 nm using a microplate reader to calculate cell viability.
[0120] In addition, also incubate the temperature-gated DNA nanochannels (NC) prepared in step (1) with ND7 / 23 cells at a concentration of 200 nM at 4 °C for 40 min. Subsequently, incubate the DBCO-modified gold nanospheres (GNS) prepared in step (2) with ND7 / 23 cells inserted into NC at concentrations of 0, 33, 66, 99, 132 μg / mL (calculated based on Au concentration) at 37 °C for 30 min. Use an 808 nm laser (1 W / cm 2 ) to irradiate the cells for 15 min (at this time, the cells are heated to the nanochannel opening temperature), then continue to culture the cells in the incubator for 4 h. Finally, add 10% CCK-8 reagent diluted with serum-free medium to the cells and incubate for 1 h, then measure the absorbance of each group at 450 nm using a microplate reader to calculate cell viability.
[0121] The results show that due to the efficient photothermal conversion mediated by the gold-iron heterojunction, the operation of opening the externally thermally gated nanochannels composed of the gold-iron heterojunction has a negligible impact on the viability of neuronal cells ( Figure 8 A), different from the approximately 30% cytotoxicity caused by the externally thermally gated nanochannels composed of gold nanomaterials ( Figure 8 B).
[0122] (6) Evaluate the effect of nanochannel opening on neuronal excitability by patch clamp recording:
[0123] Establish externally thermally gated nanochannels on primary DRG neurons using the same method as in step (4), and then apply a power of 1 W / cm 2808 nm laser for 30 s. The results are as Figure 9 shown.
[0124] The results showed that after the above operations, compared with the normal DRG neurons (Control) group, the resting membrane potential of the neurons (NC-JNP+Laser) with the opening of the externally field-heated gated nanochannels mediated by laser irradiation was significantly increased ( Figure 9 A), the firing frequency of action potentials was significantly increased ( Figure 9 B, C), and the minimum current threshold required to induce action potentials was significantly decreased ( Figure 9 D, E). It is worth noting that consistent with the previous results, after the cyclic operation of turning the laser on and off, all recorded neurons showed immediate and significant membrane potential changes ( Figure 9 F, G). These results indicate that the externally field-heated gated DNA nanochannels can significantly increase the excitability of DRG neurons under laser stimulation (as Figure 9 ).
[0125] Example 2
[0126] This example is basically the same as the preparation process of Example 1. The difference is that in this example, the gold-iron heterojunction in step (2) is a magnetic thermal conversion material gold-iron heterojunction. Among them, the magnetic thermal heating results of the gold-iron heterojunction are as Figure 4 shown in E, and its specific loss power of magnetic heating is 1004 W / g. The other steps are as follows:
[0127] (3) Preparation of externally field-heated gated nanochannels: Mix the DNA nanochannels prepared in step (1) at a concentration of 200 nM with the gold-iron heterojunction prepared in step (2) at a concentration of 100 μg / mL (calculated based on the Fe concentration), incubate at 37 °C for 30 min, and then collect and purify by magnetic separation. Resuspend the prepared externally field-heated gated nanochannels in pure DMEM medium before use.
[0128] (4) Further, the externally field-hot-controlled nanochannels prepared in step (3) are combined with a magnetic field to directly, precisely, and reversibly regulate ion transport and cell excitability of ND7 / 23 cells or DRG neurons as follows: ND7 / 23 cells or DRG neurons are cultured overnight in a 35 mm glass-bottom confocal dish, co-incubated with 200 nM DNA nanochannels at 4 °C for 40 min, then 100 μg / mL gold-iron heterojunction is added and incubated at 37 °C for 30 min, washed twice with PBS and replaced with fresh pure DMEM medium. Subsequently, potassium ion probe PBFI AM, sodium ion probe SBFI AM, calcium ion probe Fluo 4 AM, or chloride ion probe MQAE is incubated with the cells at 37 °C for 1.5 h (PBFI AM, SBFI AM) or 30 min (Fluo 4 AM, MQAE), and then washed three times with PBS. Pure DMEM (PBFI AM, SBFI AM, Fluo 4 AM) or Kreb-hepes buffer solution (MQAE) is added to each dish. The cells are exposed to a high-frequency alternating magnetic field for 5 min (magnetic field parameters: 375 kHz; 330 Oe), and the transport of various ions by the externally field-hot-controlled nanochannels is statistically analyzed based on the fluorescence intensity results. Further, the effect of nanochannel opening on neuron excitability is evaluated by patch clamp recording.
[0129] The results show that the opening of the externally field-hot-controlled nanochannels mediated by a high-frequency alternating magnetic field promotes the transport of various cations (including potassium ions, sodium ions, and calcium ions); and under the stimulation of a high-frequency alternating magnetic field, the externally field-hot-controlled nanochannels can significantly increase the excitability of ND7 / 23 cells or DRG neurons.
[0130] Example 3
[0131] In this example, the preparation process is basically the same as that of Example 1, except that in this example, the gold-iron heterojunction in step (2) is an externally field-thermal conversion material gold-iron heterojunction. Among them, the photo-magnetic coupling thermal heating of the gold-iron heterojunction is as Figure 4 shown in Figure F, and its photo-magnetic coupling specific loss power is 5167 W / g. The other steps are as follows:
[0132] (3) Preparation of externally field-hot-controlled nanochannels: The DNA nanochannels prepared in step (1) are mixed with the gold-iron heterojunction prepared in step (2) at a concentration of 200 nM and a concentration of 100 μg / mL (calculated based on the Fe concentration), co-incubated at 37 °C for 30 min, then collected and purified by magnetic separation, and the prepared externally field-hot-controlled nanochannels are resuspended in pure DMEM medium before use.
[0133] (4)Furthermore, the externally field-heat-responsive nanochannels prepared in step (3) are combined with magnetic / optical fields to directly, precisely, and reversibly regulate ion transport and cell excitability in ND7 / 23 cells or DRG neurons as follows: ND7 / 23 cells or DRG neurons are cultured overnight in a 35-mm glass-bottom confocal dish, co-incubated with 200 nM DNA nanochannels at 4 °C for 40 min, and then 100 μg / mL gold-iron heterojunction is added and incubated at 37 °C for 30 min. The cells are washed twice with PBS and fresh pure DMEM medium is replaced. Subsequently, the cells are simultaneously exposed to an 808-nm laser (1 W / cm 2 2) and a high-frequency alternating magnetic field (375 kHz; 330 Oe) for 0 - 5 min to open the externally field-heat-responsive nanochannels and mediate ion exchange across the cell membrane. The ion flow across the cell membrane can be detected using various fluorescent ion probes, and the effect of channel opening on neuronal excitability can be evaluated using patch clamp.
[0134] The results show that the opening of the externally field-heat-responsive nanochannels mediated by the laser and high-frequency alternating magnetic field promotes the transport of various cations (including potassium ions, sodium ions, and calcium ions); and under the combined stimulation of the laser and high-frequency alternating magnetic field, the externally field-heat-responsive nanochannels can significantly increase the excitability of ND7 / 23 cells or DRG neurons.
[0135] The preferred embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the above specific embodiments, and the devices and structures not described in detail should be understood to be implemented in a common manner in the art; any person skilled in the art can make many possible changes and modifications to the technical solution of the present invention, or modify it into an equivalent embodiment with equivalent changes, without departing from the scope of the technical solution of the present invention, which does not affect the essence of the present invention. Therefore, any simple modification, equivalent change, and modification made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the protection of the technical solution of the present invention.
Claims
1. A popular external-field controlled nanochannel, characterized in that, The externally field-heat-controlled nanochannel is obtained by connecting a temperature-gated DNA nanochannel with a nano material for external field heat conversion through a click chemical reaction.
2. The hot-field controlled nanochannel according to claim 1, characterized in that, The structure of the DNA nanochannel includes the DNA strands shown in SEQ ID NO: 1-6.
3. The hot control nanochannel in the external field according to claim 1, characterized in that, The structure of the DNA nanochannel further includes a covalently connected lid at the top of the channel as a resealable lid, and the sequence of the lid is shown in SEQ ID NO:
7.
4. The external field hot control nanochannel according to claim 1, characterized in that The nano material is selected from one or more combinations of the following groups: Gold-iron heterojunction, gold nanorods, silver nanorods, graphene, carbon nanotubes, black phosphorus, iron oxide, cobalt ferrite, nickel ferrite or neodymium iron boron, preferably gold-iron heterojunction.
5. The hot-field controlled nanochannel according to claim 1, characterized in that, The concentration ratio of the DNA nanochannel to the nano material is 200 nM: 0-200 μg / mL (calculated as Fe), where the concentration of the nano material is not 0; preferably, the dosage ratio of the DNA nanochannel to the nano material is 200 nM: 100 μg / mL (calculated as Fe).
6. A method for preparing the externally field-popular-controlled nanochannel according to any one of claims 1 to 5, characterized in that, The method includes the following steps: Connect the temperature-gated DNA nanochannel with the nano material for external field heat conversion through a click chemical reaction to obtain the externally field-heat-controlled nanochannel.
7. The external field hot-controlled nanochannel according to claim 6, characterized in that, The nano material is a gold-iron heterojunction prepared by the following steps: (1) Prepare the precursor gold spheres: Dissolve 50-70 mg of chloroauric acid in 5-20 mL of a mixed solution composed of 1-octadecene, oleic acid and oleylamine in a volume ratio of 10-15:1:1, stir, and heat the mixture to 120-150 °C for 30-60 min; after cooling, centrifuge and purify the product, and wash it with ethanol and n-hexane (V / V = 2:1) to obtain the precursor gold spheres; (2) Prepare the gold-iron heterojunction in the oil phase: Add the precursor gold spheres obtained in step (1) to a mixture of iron acetylacetonate, 1,2-dodecanediol, oleic acid, oleylamine and 1-octadecene, ultrasonically disperse, and heat to 300-330 °C in an argon atmosphere for 2-4 h; after cooling to room temperature, centrifuge and collect the product, wash it 3 times with a mixture of isopropanol and methanol (V / V = 1:1), and disperse it in n-hexane to obtain the gold-iron heterojunction in the oil phase; Among them, the molar ratio of the precursor gold spheres to iron acetylacetonate, 1,2-dodecanediol, oleic acid and oleylamine is: (0.05-0.2):(0.2-0.4):(2-4):(2-4):(2-4), preferably 0.1:0.25:1:1:1; the volume of 1-octadecene is 5-50 mL; (3) Preparation of hydrophilic gold-iron heterojunction: Mix the oil-phase gold-iron heterojunction obtained in step (2) with mPEG 5000 -SH, H2N-PEG 5000 -COOH and toluene, ultrasonicate for 2 - 3 h, magnetically separate overnight to remove excess toluene and PEG 5000 , and then wash 3 times with ultrapure water to obtain a hydrophilic gold-iron heterojunction with amino groups on the magnetic beads; Among them, the gold-iron heterojunction of the oil phase and mPEG 5000 -SH and H2N-PEG 5000 The mass ratio of -COOH is: 1:(1~20):(1~20), preferably 1:10:10; the volume of toluene is 1~30 mL; (4) Prepare the DBCO-modified gold-iron heterojunction: Mix the hydrophilic gold-iron heterojunction obtained in step (3) with EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide), NHS (N-hydroxysuccinimide), DBCO-COOH and PBS, ultrasonically for 2-3 h, with a power of 130-260 W, centrifuge and collect the product, and wash it 3 times with ultrapure water to obtain the DBCO-modified gold-iron heterojunction; Among them, the mass ratio of the hydrophilic gold-iron heterojunction, EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide), NHS (N-hydroxysuccinimide), and DBCO-COOH is: 1:(50~200):(10~100):(1~10), preferably 1:100:66:1; the volume of the PBS is: 1~30 mL.
8. A method for regulating the transport of substances inside and outside cells for non-diagnostic or therapeutic purposes in vitro, characterized in that, It includes the following steps: After inserting the externally field thermally controlled nanochannel as described in claim 1 into the cell, under the action of an external field, mediate the opening or closing of the externally field thermally controlled DNA nanochannel, so as to regulate the transport of substances inside and outside the cell.
9. Use of the externally heated nanopore as claimed in claim 1, characterized in that, For: (1) Regulating the transport of substances inside and outside the cell; (2) Enhancing the excitability of nerve cells; (3) Activating immune cells; (4) Promoting the differentiation of stem cells.
10. The application of the externally field thermally controlled nanochannel as described in claim 1 in the preparation of a transmembrane material, an anti-tumor drug delivery material, a photodynamic reagent delivery material, an anti-inflammatory agent delivery material, or an antibacterial agent delivery material.