Klebsiella sp. Bacterium capable of eliminating hydrogen production capacity and application of klebsiella sp. Bacterium

Abstract

The invention discloses Klebsiella bacteria capable of eliminating hydrogen production capacity and application of the Klebsiella bacteria. The invention relates to a Klebsiella engineering bacterium. The engineering bacterium is a Klebsiella bacterium in which hydrogenase-3 is inactivated. The engineering bacterium provided by the invention is obtained by inactivating hydrogenase-3 of Klebsiella bacteria, cannot produce hydrogen through aerobic fermentation or anaerobic fermentation, and can effectively promote a carbon source to be converted into polyhydric alcohols. When the engineering bacterium provided by the invention is used for preparing the polyol, the advantages of high product production rate, high substrate conversion rate and the like are achieved, and the engineering bacterium has good application value and economic benefit.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to Klebsiella bacteria with hydrogen production ability eliminated and their uses. Background Art

[0002] Klebsiella bacteria are a class of microorganisms widely distributed in nature, including Klebsiella pneumoniae, Klebsiella oxytoca, Klebsiella variicola, Klebsiella michiganensis, Klebsiella quasipneumoniae, Klebsiella aerogenes, Klebsiella quasivariicola, Klebsiella huaxiensis, Klebsiella africana, Klebsiella pasteurii, Klebsiella grimontii, etc. Bacteria of this genus are characterized by vigorous growth and the ability to grow using a variety of carbon sources. Currently, it has been reported that Klebsiella bacteria can be used as production strains for 1,3-propanediol, 2,3-butanediol, 2-ketogluconic acid, gluconic acid, xylonic acid, acetoin, isobutanol, 2,3-dihydroxyisovaleric acid, 2-hydroxyisovaleric acid, valine, etc.

[0003] Klebsiella is a Gram-negative bacterium and belongs to facultative anaerobic microorganisms. It is an important hydrogen-producing bacterium that decomposes organic matter to generate electrons and transfers the electrons to protons to form hydrogen. Hydrogen is a new type of energy. However, the ability of general microorganisms to synthesize hydrogen using raw materials such as glucose is relatively low. Generally, it is considered that at most 4 mol of hydrogen can be synthesized from 1 mol of glucose.

[0004] It is reported that the hydrogen production pathways of facultative anaerobic microorganisms include the formic acid cleavage hydrogen production pathway and the NADH hydrogen production pathway. In the formic acid cleavage hydrogen production pathway, the carbon source generates pyruvate through the glycolysis (EMP) pathway. Pyruvate generates formic acid and acetyl-CoA under the action of pyruvate formate-lyase. Formic acid is cleaved into CO2 and H2 under the catalysis of hydrogenase. The hydrogenases involved in hydrogen production by facultative anaerobic microorganisms include hydrogenase-1, hydrogenase-2, hydrogenase-3, and hydrogenase-4. Hydrogenase catalyzes the cleavage of formic acid to form hydrogen and carbon dioxide. It is reported that knocking out hycA in facultative anaerobic Escherichia coli IAM1183A will increase the hydrogen production rate. Knocking out hybO in Escherichia coli IAM11830 O will also increase the hydrogen production rate. Knocking out hybA and hybO in Escherichia coli IAM1183 AO will also increase the hydrogen production rate. Overexpression of HydA2220 in facultative anaerobic Klebsiella C. azorensis H53214 can increase the hydrogenase activity of the strain, thereby increasing the hydrogen production activity of the recombinant strain.

[0005] Hydrogenase-3 consists of 6 subunits, which are encoded by hycB, hycC, hycD, hycE, hycF, and hycG respectively. The expression of this gene cluster is regulated by hycA. Two genes, hycI and hycH, encode proteins for the processing and maturation of hydrogenase-3. The expression and maturation of hydrogenase-3 depend on the proteins encoded by five genes in the hyp gene cluster, hypA, hypB, hypC, hypD, and hycE.

[0006] 1,3-Propanediol is an important compound, mainly used for polymerizing with terephthalic acid to produce polytrimethylene terephthalate. This polyester is a textile material with excellent properties. Klebsiella can synthesize 1,3-propanediol using glycerol as a raw material. In this process, the strain also synthesizes by-products such as succinic acid, acetic acid, lactic acid, ethanol, and 2,3-butanediol.

[0007] 2,3-Butanediol can be used as a solvent for cosmetics and is also expected to be used as a biofuel. The main metabolite of Klebsiella cultured using glucose and other raw materials is 2,3-butanediol. At the same time, the strain synthesizes by-products such as acetic acid, lactic acid, and ethanol.

[0008] Currently, the process of using Klebsiella as a production strain to produce 1,3-propanediol and 2,3-butanediol faces technical problems such as low raw material conversion rate. Summary of the Invention

[0009] In view of the above-mentioned disadvantages of the prior art, the purpose of the present invention is to provide Klebsiella bacteria with hydrogen production ability eliminated and their uses, in order to solve the problems existing in the prior art.

[0010] To achieve the above purpose, the present invention specifically adopts the following technical solutions.

[0011] The first aspect of the present invention protects an engineered bacterium of the genus Klebsiella, wherein the engineered bacterium is a Klebsiella bacterium in which hydrogenase-3 is inactivated.

[0012] The second aspect of the present invention protects a method for constructing the engineered bacteria as described above, comprising the following steps: inactivating the gene encoding hydrogenase-3 in the wild-type Klebsiella bacteria.

[0013] The third aspect of the present invention protects the use of the engineered bacteria as described above in the preparation of organic acids and / or polyols.

[0014] The fourth aspect of the present invention provides a method for preparing 1,3-propylene glycol, comprising the following steps: fermentation using the engineered bacteria as described above, wherein the fermentation substrate comprises glycerol.

[0015] A fifth aspect of the present invention provides a method for preparing 2,3-butanediol, comprising the following steps: fermentation using the engineered bacteria as described above, wherein the fermentation substrate comprises glucose.

[0016] The sixth aspect of the present invention is the use of protected genes in inhibiting hydrogen production or increasing polyol synthesis by Klebsiella bacteria, wherein the genes include a gene encoding hydrogenase-3, and inactivating the gene encoding hydrogenase-3 inhibits hydrogen production or increases polyol production.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] 1) The engineered bacteria of the present invention are obtained by inactivating hydrogenase-3 of Klebsiella bacteria. Both aerobic and anaerobic fermentation of the engineered bacteria can inhibit hydrogen production by Klebsiella bacteria, and the hydrogen production is zero.

[0019] 2) The engineered bacteria with inactivated hydrogenase-3 of the present invention can increase the content of polyols in the fermentation product, such as 1,3-propylene glycol and 2,3-butanediol, and at the same time improve the efficiency of converting carbon sources into 1,3-propylene glycol and 2,3-butanediol.

[0020] 3) The engineered bacteria of the present invention further inactivate lactate dehydrogenase (ldhA) on the basis of inactivating hydrogenase-3, which can further increase the production of 1,3-propylene glycol and 2,3-butanediol, and at the same time improve the efficiency of converting carbon sources into 1,3-propylene glycol and 2,3-butanediol.

[0021] 4) The engineered bacteria of the present invention can further increase the yield of 2,3-butanediol by inactivating lactate dehydrogenase (ldhA) and alcohol dehydrogenase (adhE) on the basis of inactivating hydrogenase-3, while improving the efficiency of converting carbon sources into 2,3-butanediol. DETAILED DESCRIPTION

[0022] Klebsiella bacteria are facultative anaerobic bacteria that can produce hydrogen, 2,3-butanediol, and 1,3-propanediol, and are easy to culture in industrial applications. The applicant accidentally discovered during the research that after inactivating hydrogenase-3 in Klebsiella bacteria, the Klebsiella bacteria no longer produce hydrogen, and the Klebsiella bacteria after inactivating hydrogenase-3 can significantly increase the yield of 1,3-propanediol and the carbon source conversion rate under both anaerobic and aerobic conditions, and can significantly increase the yield of 2,3-butanediol and the carbon source conversion rate under both anaerobic and aerobic conditions. On this basis, the present invention was completed.

[0023] The first aspect of the present invention protects a Klebsiella engineered bacterium, and the engineered bacterium is a Klebsiella bacterium with inactivated hydrogenase-3.

[0024] In the present invention, the inactivation is to inhibit the expression or activity of a gene. Inhibiting gene activity means reducing the gene vitality and the biological function of the gene. Preferably, the gene vitality decreases by at least 10% compared to before inhibition, for example, at least 30%, 50%, 70%, 90%, or 100% reduction. Inhibiting gene expression can be inhibiting gene transcription or translation. Specifically, it can mean: making the gene not transcribe, or reducing the transcriptional activity of the gene, or making the gene not translate, or reducing the translation level of the gene. Those skilled in the art can use conventional methods to regulate gene expression, such as one or more of gene knockout, homologous recombination, or interfering RNA.

[0025] In some embodiments, the Klebsiella bacterium includes species of Klebsiella. According to the 9th edition of Bergey's Manual of Determinative Bacteriology, the species included in Klebsiella bacteria are defined.

[0026] In some specific embodiments, the Klebsiella bacterium is selected from the group consisting of Klebsiella pneumoniae, Klebsiella oxytoca, Klebsiella variicola, Klebsiella michiganensis, Klebsiella quasipneumoniae, Klebsiella aerogenes, Klebsiella quasivariicola, Klebsiella huaxiensis, Klebsiella africana, Klebsiella pasteurii, and Klebsiella grimontii, etc.

[0027] In certain specific embodiments, the Klebsiella bacteria are selected from Klebsiella pneumoniae, Klebsiella oxytoca, Klebsiella variicola, and Klebsiella michiganensis.

[0028] In certain embodiments, the gene encoding hydrogenase-3 comprises the hyc gene and the hyp gene.

[0029] In certain specific embodiments, the nucleotide sequence of the hyc gene in Klebsiella pneumoniae (Kp) CGMCC 1.6366 comprises the sequence shown in SEQ ID No.1. Preferably, the hyc gene comprises hycA, hycB, hycC, hycD, hycE, hycF, hycG, hycH, and hycI.

[0030] In certain specific embodiments, the nucleotide sequence of the hyp gene in Klebsiella pneumoniae (Kp) CGMCC 1.6366 comprises the sequence shown in SEQ ID No.2. Preferably, the hyc gene comprises hypA, hypB, hypC, hypD, and hycE.

[0031] This application discovers that the engineered Klebsiella bacteria with inactivated hydrogenase-3 no longer produce hydrogen. Under anaerobic conditions, it can promote the conversion of the carbon source glycerol into 1,3-propanediol. Compared with the wild-type Klebsiella bacteria, the average conversion rate of the raw material is increased by 13%; under anaerobic conditions, it promotes the conversion of the carbon source glucose into 2,3-butanediol. Compared with the wild-type Klebsiella bacteria, the average conversion rate of the raw material is increased by 14.5%.

[0032] Under aerobic conditions, the engineered Klebsiella bacteria of this application can promote the conversion of the carbon source glycerol into 1,3-propanediol. Compared with the wild-type Klebsiella pneumoniae, the average conversion rate of the raw material is increased by 13.9%; under aerobic conditions, it promotes the conversion of the carbon source glucose into 2,3-butanediol. Compared with the wild-type Klebsiella bacteria, the average conversion rate of the raw material is increased by 16.6%.

[0033] The conversion rate of the raw material in this application refers to the content of 1,3-propanediol or 2,3-butanediol in the fermentation product / the content of the carbon source consumed in the fermentation medium.

[0034] In certain embodiments, the engineered bacteria further comprise at least one of inactivated lactate dehydrogenase and ethanol dehydrogenase.

[0035] In some specific embodiments, the gene encoding lactate dehydrogenase comprises ldhA. The lactate dehydrogenase refers to the enzyme that catalyzes the reduction of pyruvate to lactate. The gene reading frame of ldhA can be queried through existing databases (such as NCBI) or obtained through sequencing. For example, the sequence of ldhA of Klebsiella variicola 342 is shown as SEQ ID No.3.

[0036] In some specific embodiments, the gene encoding alcohol dehydrogenase comprises adhE. The alcohol dehydrogenase refers to the enzyme that catalyzes the formation of ethanol from acetaldehyde. The gene reading frame of adhE can be queried through existing databases (such as NCBI) or obtained through sequencing. For example, the sequence of adhE of Klebsiella variicola 342 is shown as SEQ ID No.4.

[0037] In some specific embodiments, the engineered bacterium is a Klebsiella bacterium in which hydrogenase-3 and lactate dehydrogenase are both inactivated.

[0038] Under aerobic conditions, the engineered Klebsiella bacterium with inactivated hydrogenase-3 and lactate dehydrogenase of the present application can promote the conversion of the carbon source glycerol into 1,3-propanediol. Compared with the engineered Klebsiella bacterium with only inactivated hydrogenase-3, the average conversion rate of the raw material is increased by 4.4%.

[0039] Under aerobic conditions, the engineered Klebsiella bacterium with inactivated hydrogenase-3 and lactate dehydrogenase of the present application can promote the conversion of the carbon source glucose into 2,3-butanediol. Compared with the engineered Klebsiella bacterium with only inactivated hydrogenase-3, the average conversion rate of the raw material is increased by 6.9%; compared with the wild-type Klebsiella bacterium, the average conversion rate of the raw material is increased by 9.5%.

[0040] In some specific embodiments, the engineered bacterium is a Klebsiella bacterium in which hydrogenase-3, lactate dehydrogenase, and alcohol dehydrogenase are all inactivated.

[0041] Under aerobic conditions, when the engineered Klebsiella bacterium with inactivated hydrogenase-3, lactate dehydrogenase, and alcohol dehydrogenase of the present application utilizes the carbon source glycerol, although the synthesis amount of 1,3-propanediol is reduced by 7.7%, the synthesis amount of 2,3-butanediol is increased by 61.8%.

[0042] Under aerobic conditions, the engineered Klebsiella bacterium with inactivated hydrogenase-3, lactate dehydrogenase, and alcohol dehydrogenase of the present application can promote the conversion of the carbon source glucose into 2,3-butanediol. Compared with the engineered Klebsiella bacterium with only inactivated lactate dehydrogenase and alcohol dehydrogenase, the average conversion rate of the raw material is increased by 17.3%; compared with the wild-type Klebsiella bacterium, the average conversion rate of the raw material is increased by 39.1%.

[0043] The second aspect of the present invention protects a method for constructing the engineered bacterium as described above, comprising the following steps: inactivating the gene encoding hydrogenase-3 in wild-type Klebsiella bacteria.

[0044] In certain embodiments, it further comprises inactivating the gene encoding lactate dehydrogenase.

[0045] In certain embodiments, it further comprises inactivating the gene encoding alcohol dehydrogenase.

[0046] In certain specific embodiments, the gene encoding lactate dehydrogenase comprises ldhA.

[0047] In certain more specific embodiments, the nucleotide sequence of the ldhA comprises the sequence shown in SEQ ID No.3.

[0048] In certain specific embodiments, the gene encoding alcohol dehydrogenase comprises adhE.

[0049] In certain more specific embodiments, the nucleotide sequence of the adhE comprises the sequence shown in SEQ ID No.4.

[0050] In certain embodiments, the preparation method comprises the following steps:

[0051] 1) PCR amplify the upstream and downstream sequences of a partial sequence of the hydrogenase-3 gene;

[0052] 2) ligate the upstream and downstream sequences of the partial gene sequence obtained in step 1) with a resistance gene to form a resistance cassette with a resistance element in the middle and the upstream and downstream sequences of the partial gene sequence at both ends;

[0053] 3) introduce the resistance cassette obtained in step 3) into Klebsiella bacteria, and the strain obtained through resistance screening and PCR verification is the Klebsiella engineered bacterium as described above.

[0054] In some specific embodiments, the resistance element is selected from one or more of a gentamicin resistance expression element, a tetracycline resistance expression element, a kanamycin resistance expression element, a neomycin resistance expression element, a bleomycin resistance expression element, a chloramphenicol resistance expression element, an erythromycin resistance expression element, a streptomycin resistance expression element, an apramycin resistance expression element, and a polymyxin B resistance expression element.

[0055] The third aspect of the present invention protects the use of the engineered bacterium as described above in the preparation of organic acids and / or polyols.

[0056] In certain embodiments, the polyol is selected from one or both of 1,3-propanediol and 2,3-butanediol.

[0057] In some embodiments, the organic acid is selected from formic acid.

[0058] A fourth aspect of the present invention protects a method for preparing 1,3-propanediol, comprising the following steps: fermenting with the engineered bacterium as described above, and the fermentation substrate comprises glycerol.

[0059] In some embodiments, the fermentation method is aerobic fermentation or anaerobic fermentation. The fermentation temperature is 25 - 38 °C, preferably 30 - 37 °C, such as 37 °C; the fermentation time is 10 - 200 h, preferably 10 - 200 h, such as 16 h, 15 h.

[0060] In some embodiments, the engineered bacterium as described above is inoculated into a fermentation medium for fermentation.

[0061] In some more specific embodiments, the carbon source in the fermentation medium is selected from glycerol.

[0062] In a specific embodiment, the composition of the fermentation medium is: glycerol 30 g / L, yeast powder 1.5 g / L, ammonium sulfate 4 g / L, dipotassium hydrogen phosphate trihydrate 0.69 g / L, potassium dihydrogen phosphate 0.25 g / L, magnesium sulfate 0.2 g / L, ferrous sulfate 5 mg / L, trace elements 1 ml / L. Trace element ratio (CoCl2·6H2O 200 mg / L, MnSO4·4H2O 100 mg / L, ZnCl2 70 mg / L, H3BO3 60 mg / L, Na2MoO4·2H2O 35 mg / L, CuSO4·5H2O 29.28 mg / L, NiCl2·6H2O 25 mg / L, 37% HCl 0.9 mL), calcium carbonate 0.5 g / bottle.

[0063] A fifth aspect of the present invention protects a method for preparing 2,3-butanediol, comprising the following steps: fermenting with the engineered bacterium as described above, and the fermentation substrate comprises glucose.

[0064] In some embodiments, the fermentation method is aerobic fermentation or anaerobic fermentation. The fermentation temperature is 25 - 38 °C, preferably 30 - 37 °C, such as 37 °C.

[0065] In some embodiments, the engineered bacterium as described above is inoculated into a fermentation medium for fermentation.

[0066] In some more specific embodiments, the carbon source in the fermentation medium is selected from glucose.

[0067] In a specific embodiment, the composition of the fermentation medium is as follows: glucose 25 g / L, yeast powder 1.5 g / L, ammonium sulfate 4 g / L, dipotassium hydrogen phosphate trihydrate 0.69 g / L, potassium dihydrogen phosphate 0.25 g / L, magnesium sulfate 0.2 g / L, ferrous sulfate 5 mg / L, trace elements 1 ml / L. The ratio of trace elements is (200 mg / L CoCl2·6H2O, 100 mg / L MnSO4·4H2O, 70 mg / L ZnCl2, 60 mg / L H3BO3, 35 mg / L Na2MoO4·2H2O, 29.28 mg / L CuSO4·5H2O, 25 mg / L NiCl2·6H2O, 0.9 mL 37% HCl), and calcium carbonate 0.5 g / bottle.

[0068] In certain embodiments, the preparation method comprises one or more of the following steps:

[0069] 1) Inoculate the engineered bacteria described above into a seed medium for cultivation to obtain a seed culture solution;

[0070] 2) Inoculate the seed solution from step 1) into a fermentation medium for cultivation to obtain the 2,3-butanediol.

[0071] The sixth aspect of the present invention protects the use of a gene in inhibiting hydrogen production by Klebsiella bacteria or promoting the synthesis of polyols by Klebsiella bacteria. The gene comprises a gene encoding hydrogenase-3, and inactivating the gene encoding hydrogenase-3 inhibits hydrogen production or increases the yield of polyols.

[0072] The present invention discovers that when hydrogenase-3 is inactivated, Klebsiella bacteria no longer produce hydrogen, and it can promote Klebsiella bacteria to convert carbon sources into polyols.

[0073] In certain embodiments, the gene further comprises a gene encoding lactate dehydrogenase and / or a gene encoding alcohol dehydrogenase. Inactivating the gene encoding lactate dehydrogenase and / or the gene encoding alcohol dehydrogenase increases the yield of polyols.

[0074] The following specific examples illustrate the embodiments of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification.

[0075] Before further describing the specific embodiments of the present invention, it should be understood that the protection scope of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are for describing specific embodiments, rather than limiting the protection scope of the present invention. The test methods without specific conditions noted in the following examples are generally carried out under conventional conditions or according to the conditions recommended by each manufacturer.

[0076] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any value therebetween can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by one of ordinary skill in the art to which this technology belongs. In addition to the specific methods, devices, and materials used in the embodiments, any methods, devices, and materials of the prior art similar to or equivalent to those described in the embodiments of the present invention can also be used to implement the present invention according to the knowledge of the prior art by one of ordinary skill in the art to which this technology belongs and the description of the present invention.

[0077] The Klebsiella pneumoniae (Kp) strain used in the following examples is CGMCC 1.6366 (this strain is also known as TUAC01, AC01), which was isolated from soil. The isolation process and character description can be found in (Isolation and characterization of microorganisms able to produce 1,3-propanediol under aerobic conditions. World Journal of Microbiology Biotechnology 2008, 24: 1731-1740).

[0078] Klebsiella oxytoca (Ko) uses the M5a1 strain, which was also previously known as Klebsiella pneumoniae M5a1. The specific description can be found in (Dixon RA, Postgate JR. Transfer of nitrogen-fixation genes by conjugation in Klebsiella pneumoniae. Nature 1971; 234(5323): 47–8).

[0079] Klebsiella variicola (Kv) can use the Klebsiella variicola strain isolated according to conventional operations, or Klebsiella variicola 342. The specific description can be found in (Fouts, D.E. et al, Complete genome sequence of the N2-fixing broad host range endophyte Klebsiella pneumoniae 342 and virulence predictions verified in mice. PLoS Genet 4, e1000141.), which was initially identified as Klebsiella pneumoniae and later re-identified as Klebsiella variicola.

[0080] Klebsiella michiganensis (Km) can use Klebsiella michiganensis strains isolated according to conventional operations, or Klebsiella michiganensis 342 ATCC BAA-2403. For specific descriptions, see (Saha R, Farrance C E, Verghese B, et al. Klebsiella michiganensis sp. nov., a new bacterium isolated from a tooth brush holder. Curr Microbiol, 2013, 66:72–78).

[0081] Example 1: Engineered Klebsiella pneumoniae with inactivated hydrogenase-3

[0082] 1.1 Construction of upstream and downstream fragments of the gene encoding hydrogenase-3 (hyc)

[0083] Klebsiella variicola 342 is a Klebsiella variicola strain used for nitrogen fixation research. According to the genomic information of Klebsiella variicola 342 (Genbank: NC_011283), upstream and downstream primers for PCR were designed for hycA-hycE in the hyc gene of hydrogenase-3, that is, positions 3916-7844 in SEQ ID No. 1. The specific sequences are as follows:

[0084] Upstream primer hyc-up-f: TCATGGTGGGCGTGATGCTGA (SEQ ID NO.7), upstream primer hyc-up-r:

[0085] GGTCGACGGATCCCCGGAATGCTCAAACTCTCTTAATCACGCCACC (SEQ ID NO.8)

[0086] Downstream primer hyc-down-f:

[0087] CGAAGCAGCTCCAGCCTACAGCGAGACGGTGGTGTTCAGTC (SEQ ID NO.9), downstream primer hyc-down-r: GTTGAGCGGCATGTTATGGGT (SEQ ID NO.10).

[0088] Using the above primers and Klebsiella pneumoniae Kp genomic DNA as a template, upstream and downstream fragments of the hydrogenase-3 (hyc) gene were obtained by PCR amplification.

[0089] 1.2 PCR amplification of the apramycin resistance gene sequence

[0090] Using the pIJ773 plasmid as a template, the apramycin resistance gene fragment was obtained by PCR amplification with primers.

[0091] apr-F primer: ATTCCGGGGATCCGTCGAC (SEQ ID NO.11)

[0092] apr-R primer: TGTAGGCTGGAGCTGCTTCG (SEQ ID NO.12).

[0093] 1.3. Ligation

[0094] The fragments obtained in steps 1.1 and 1.2 were ligated into a linear DNA fragment using a ligation kit. The linear DNA fragment has homologous arms of the hydrogenase-3 gene sequence at both ends and the apramycin resistance gene (SEQ ID NO.5) in the middle. The upstream homologous arm of hydrogenase-3 is from positions 1-732 in the SEQ ID NO.5 sequence, the downstream homologous arm of hydrogenase-3 is from positions 2102-2786 in the SEQ ID NO.5 sequence; the apramycin resistance gene is from positions 1226-2026 in the SEQ ID NO.5 sequence.

[0095] 1.4. Electroporation

[0096] The linear DNA fragment obtained in step 1.3 was transferred into Klebsiella pneumoniae Kp. The transformation voltage was 2000V. The linear DNA fragment underwent homologous recombination with the hydrogenase-3 gene sequence on the chromosome, and a strain with inactivated hydrogenase-3 gene was screened. The specific steps are as follows:

[0097] 1) The pDK6-red plasmid was transformed into Klebsiella pneumoniae Kp, and the Klebsiella pneumoniae Kp transformed with the pDK6-red plasmid was named Kp-pDK6-red strain.

[0098] 2) The linear DNA fragment from step 1.3 was electrotransformed into Kp-pDK6-red competent cells. The resistant strains were screened using apramycin, and the screened resistant strain was named Kp-Δhyc. The hydrogenase-3 gene of this strain was inactivated by homologous recombination.

[0099] Preparation of Klebsiella oxytoca Ko with inactivated hydrogenase-3 (hyc): The linear DNA fragment obtained in step 1.3 was transferred into Klebsiella oxytoca Ko using the same method as in step 1.4, and Klebsiella oxytoca Ko with inactivated hydrogenase-3 was obtained, named Ko-Δhyc.

[0100] Preparation of Klebsiella variicola Kv with inactivated hydrogenase-3 (hyc): The linear DNA fragment obtained in step 1.3 was transferred into Klebsiella variicola Kv by the same method as in step 1.4 to obtain Klebsiella variicola Kv with inactivated hydrogenase-3, named Kv-Δhyc.

[0101] Preparation of Klebsiella michiganensis Km with inactivated hydrogenase-3 (hyc): The linear DNA fragment obtained in step 1.3 was transferred into Klebsiella michiganensis Km by the same method as in step 1.4 to obtain Klebsiella michiganensis Km with inactivated hydrogenase-3, named Km-Δhyc.

[0102] Example 2 Engineered Klebsiella strains with simultaneously inactivated hydrogenase-3 and lactate dehydrogenase

[0103] In this example, based on the engineered Klebsiella strains with inactivated hydrogenase-3 (hyc) in Example 1, lactate dehydrogenase (ldhA) was further inactivated to obtain engineered Klebsiella strains with simultaneously inactivated hydrogenase-3 (hyc) and lactate dehydrogenase (ldhA), including Klebsiella pneumoniae Kp-ΔhycΔldhA, Klebsiella oxytoca Ko-ΔhycΔldhA, Klebsiella variicola Kv-ΔhycΔldhA, and Klebsiella michiganensis Km-ΔhycΔldhA. The steps are as follows:

[0104] The linear DNA fragment obtained in step 1.3 of Example 1 was electrotransformed into Klebsiella pneumoniae Kp-ΔldhA, Klebsiella oxytoca Ko-ΔldhA, Klebsiella variicola Kv-ΔldhA, and Klebsiella michiganensis Km-ΔldhA by the same method as in step 1.4 of Example 1 to obtain engineered Klebsiella strains with simultaneously inactivated hydrogenase-3 (hyc) gene and lactate dehydrogenase gene (ldhA), including Klebsiella pneumoniae Kp-ΔhycΔldhA, Klebsiella oxytoca Ko-ΔhycΔldhA, Klebsiella variicola Kv-ΔhycΔldhA, and Klebsiella michiganensis Km-ΔhycΔldhA.

[0105] Meanwhile, engineered strains with only inactivated lactate dehydrogenase (ldhA) were constructed. The construction process of Klebsiella pneumoniae Kp-ΔldhA can be found in Metabolic Engineering 43 (2017) 71–84. The construction processes of Klebsiella oxytoca Ko-ΔldhA, Klebsiella variicola Kv-ΔldhA, and Klebsiella michiganensis Km-ΔldhA are the same as that of Kp-ΔldhA, using Klebsiella oxytoca Ko, Klebsiella variicola Kv, and Klebsiella michiganensis Km as the starting strains.

[0106] Example 3 Engineered Klebsiella strains with simultaneously inactivated hydrogenase-3, lactate dehydrogenase, and alcohol dehydrogenase

[0107] In this example, on the basis of hydrogenase-3 (hyc) and lactate dehydrogenase (ldhA) in Example 2, lactate dehydrogenase (adhE) was further inactivated to obtain a Klebsiella engineering bacterium in which hydrogenase-3 (hyc), lactate dehydrogenase (ldhA), and alcohol dehydrogenase (adhE) were simultaneously inactivated, including Klebsiella pneumoniae Kp-phycΔldhAΔadhE, Klebsiella oxytoca Ko-ohycΔldhAΔadhE, Klebsiella variicola Kv-vhycΔldhAΔadhE, and Klebsiella michiganensis Km-root hycΔldhAΔadhE. The steps are as follows:

[0108] 3.1. PCR amplification of the upstream and downstream fragments of the alcohol dehydrogenase (adhE) gene

[0109] Upstream primer adhE-up-F: CTTATTGCGCACTGCTGCCG (SEQ ID NO.13)

[0110] Upstream primer adhE-up-R: GGTCGACGGATCCCCGGAATCAAGCGCGTTCAGTTCAGCG (SEQ ID NO.14)

[0111] Downstream primer adhE-down-F:

[0112] CGAAGCAGCTCCAGCCTACATCGACAAGCATAAACGTTCTGCCAG (SEQ ID NO.15)

[0113] Downstream primer adhE-down-R: GGGATGCGTACCGTCGTT (SEQ ID NO.16).

[0114] Using the above primers and taking the genomic DNA of Klebsiella pneumoniae Kp as a template, the upstream and downstream fragments of the alcohol dehydrogenase (adhE) gene were obtained by PCR amplification.

[0115] 3.2. PCR amplification of the streptomycin resistance gene sequence

[0116] Taking the pIJ778 plasmid as a template, a streptomycin resistance gene fragment was obtained by PCR amplification using primers.

[0117] apr-F: ATTCCGGGGATCCGTCGAC (SEQ ID NO.17)

[0118] apr-R: TGTAGGCTGGAGCTGCTTCG (SEQ ID NO.18).

[0119] 3.3. Ligation

[0120] The DNA fragments obtained in Steps 3.1 and 3.2 are ligated into a single DNA fragment using a ligation kit. The two ends of the DNA fragment have homologous arms of the upstream and downstream sequences of the alcohol dehydrogenase (adhE) gene, and the middle has a streptomycin resistance gene (SEQ ID NO.6). The upstream homologous arm of adhE is at positions 1 - 648 in the SEQ ID NO.6 sequence, the downstream homologous arm of adhE is at positions 2061 - 2738 in the SEQ ID NO.6 sequence; the streptomycin resistance gene is at positions 1169 - 1960 in the SEQ ID NO.6 sequence.

[0121] 3.4. Electroporation

[0122] The DNA fragments obtained in Step 3.3 are separately transferred into the engineered bacteria Kp-ΔhycΔldhA, Ko-ΔhycΔldhA, Kv-ΔhycΔldhA, and Km-ΔhycΔldhA in which hydrogenase-3 (hyc) and lactate dehydrogenase (ldhA) are simultaneously inactivated obtained in Example 2 to obtain engineered bacteria in which hydrogenase-3 (hyc), lactate dehydrogenase gene (ldhA), and alcohol dehydrogenase (adhE) are simultaneously inactivated, including Klebsiella pneumoniae Kp-ΔhycΔldhAΔadhE, Klebsiella oxytoca Ko-ΔhycΔldhAΔadhE, Klebsiella variicola Kv-ΔhycΔldhAΔadhE, and Klebsiella michiganensis Km-ΔhycΔldhAΔadhE.

[0123] Meanwhile, engineered bacteria in which only lactate dehydrogenase (ldhA) and alcohol dehydrogenase (adhE) are simultaneously inactivated are constructed. The construction steps are as follows:

[0124] The DNA fragments obtained in Step 3.3 of this example are transferred into the engineered bacteria Kp-ΔldhA, Ko-ΔldhA, Kv-ΔldhA, and Km-ΔldhA that only have lactate dehydrogenase (ldhA) obtained in Example 2 to obtain engineered bacteria in which lactate dehydrogenase gene (ldhA) and alcohol dehydrogenase (adhE) are simultaneously inactivated, including Klebsiella pneumoniae Kp-ΔldhAΔadhE, Klebsiella oxytoca Ko-ΔldhAΔadhE, Klebsiella variicola Kv-ΔldhAΔadhE, and Klebsiella michiganensis Km-ΔldhAΔadhE.

[0125] Example 4 Preparation of 1,3-propanediol and 2,3-butanediol by Anaerobic Fermentation of Engineered Bacteria

[0126] In this example, the Klebsiella engineered bacteria with inactivated hydrogenase-3 obtained in Example 1 are used for anaerobic fermentation to prepare 1,3-propanediol and 2,3-butanediol respectively. The details are as follows:

[0127] 4.1 Anaerobic fermentation of engineered bacteria to prepare 1,3 - propanediol

[0128] The Klebsiella engineered bacteria obtained in Example 1 were subjected to anaerobic fermentation to prepare 1,3 - propanediol. The steps are as follows:

[0129] One loop of each of the slant cultures of Kp - Δhyc, Ko - Δhyc, Kv - Δhyc, and Km - Δhyc from Example 1 was inoculated into a 250 mL conical flask containing 50 mL of fermentation medium. The air in the flask was removed with nitrogen, and the conical flask was sealed to maintain an anaerobic state and connected to a gas collection bag. The rotation speed was 100 revolutions per minute, and anaerobic fermentation culture was carried out at a constant temperature of 37 °C.

[0130] The components of the fermentation medium were: 30 g / L glycerol, 1.5 g / L yeast powder, 4 g / L ammonium sulfate, 0.69 g / L dipotassium hydrogen phosphate trihydrate, 0.25 g / L potassium dihydrogen phosphate, 0.2 g / L magnesium sulfate, 5 mg / L ferrous sulfate, 1 mL / L trace elements. The ratio of trace elements was (200 mg / L CoCl2·6H2O, 100 mg / L MnSO4·4H2O, 70 mg / L ZnCl2, 60 mg / L H3BO3, 35 mg / L Na2MoO4·2H2O, 29.28 mg / L CuSO4·5H2O, 25 mg / L NiCl2·6H2O, 0.9 mL 37% HCl), and 0.5 g / bottle of calcium carbonate.

[0131] After culturing for 24 hours, the components in the fermentation broth were measured.

[0132] Meanwhile, the original strains Klebsiella pneumoniae Kp, Klebsiella oxytoca Ko, Klebsiella variicola Kv, and Klebsiella michiganensis Km were used as control groups.

[0133] Determination by liquid chromatography was carried out using an HPX - 87H chromatographic column, and detection was performed using a refractive index and ultraviolet detector. The mobile phase was 0.05 mol / L sulfuric acid aqueous solution, the flow rate was 0.8 mL / min, the column oven temperature was 60 °C, and the injection volume was 20 μL. Organic acids and organic acid salts were not distinguished in the present invention and were all counted as organic acids.

[0134] A gas collection bag was connected to the exhaust port of the conical flask, and the generated hydrogen was collected by the gas bag. The volume of the collected gas was measured, and the concentrations of hydrogen, carbon dioxide, and nitrogen in it were measured using gas chromatography, and the hydrogen production was calculated. The gas chromatography used a TDX - 01 (2 m × 2 mm) chromatographic column and a TCD detector. The fermentation results of each strain are shown in Table 1.

[0135] The conversion rate of the raw material was calculated, and the calculation formula was: the content of 1,3 - propanediol / the content of glycerol consumed in the fermentation medium.

[0136] Table 1

[0137] Strain Glycerol consumption (g / L) 1,3 - propanediol (g / L) Formic acid (g / L) Hydrogen (mL) Conversion rate Klebsiella pneumoniae Kp 28.3 13.9 0 52 0.49 Klebsiella oxytoca Ko 28.2 11.2 0 48 0.40 Klebsiella variicola Kv 28.1 13.6 0 51 0.48 Klebsiella michiganensis Km 28.3 12.9 0 49 0.45 Engineered strain Kp - Δhyc 25.8 14.2 1.9 0 0.55 Engineered strain Ko - Δhyc 25.5 11.8 1.7 0 0.46 Engineered strain Kv - Δhyc 26.0 13.9 1.9 0 0.53 Engineered strain Km - Δhyc 25.9 13.4 1.8 0 0.52

[0138] As can be seen from Table 1, the wild-type Klebsiella bacteria Kp, Ko, Kv, and Km can synthesize 1,3-propanediol using glycerol under anaerobic conditions, while producing hydrogen gas, but formic acid does not accumulate in the fermentation broth.

[0139] The engineered bacteria Kp-Δhyc, Ko-Δhyc, Kv-Δhyc, and Km-Δhyc with inactivated hydrogenase-3 do not produce hydrogen gas and formic acid accumulates in the fermentation broth.

[0140] Overall, it can be seen that both wild-type Klebsiella bacteria and engineered bacteria with inactivated hydrogenase-3 can synthesize 1,3-propanediol using glycerol under anaerobic conditions. However, the average synthesis amount of 1,3-propanediol by the engineered bacteria Kp-Δhyc, Ko-Δhyc, Kv-Δhyc, and Km-Δhyc with inactivated hydrogenase-3 is 3.3% higher than that of wild-type Klebsiella bacteria, and the average conversion rate of raw materials is increased by 13%.

[0141] 4.2 Preparation of 2,3-butanediol by Anaerobic Fermentation of Engineered Bacteria

[0142] The difference from step 4.1 is as follows: the fermentation medium is different and the fermentation time is different, and the rest are the same as step 4.1. The specific fermentation time is 16 h, and the components of the fermentation medium are: 25 g / L glucose, 1.5 g / L yeast extract, 4 g / L ammonium sulfate, 0.69 g / L dipotassium hydrogen phosphate trihydrate, 0.25 g / L potassium dihydrogen phosphate, 0.2 g / L magnesium sulfate, 5 mg / L ferrous sulfate, 1 mL / L trace elements. The ratio of trace elements (200 mg / L CoCl2·6H2O, 100 mg / L MnSO4·4H2O, 70 mg / L ZnCl2, 60 mg / L H3BO3, 35 mg / L Na2MoO4·2H2O, 29.28 mg / L CuSO4·5H2O, 25 mg / L NiCl2·6H2O, 0.9 mL 37% HCl), and calcium carbonate 0.5 g / bottle.

[0143] The components of the fermentation broth were detected using the detection method of step 4.1, and the hydrogen production was also detected. The results are shown in Table 2.

[0144] The conversion rate of the raw material was calculated, and the calculation formula was: the content of 2,3-butanediol / the content of glucose consumed in the fermentation medium.

[0145] Table 2

[0146] Strain Glucose consumption (g / L) 2,3 - butanediol (g / L) Formic acid (g / L) Hydrogen (ml) Conversion rate Klebsiella pneumoniae Kp 25 5.7 0.4 77 0.23 Klebsiella oxytoca Ko 25 5.8 0.3 78 0.23 Klebsiella variicola Kv 25 5.6 0.5 75 0.22 Klebsiella michiganensis Km 25 5.7 0.5 74 0.23 Engineered strain Kp - Δhyc 25 6.5 3.1 0 0.26 Engineered strain Ko - Δhyc 25 6.6 3.2 0 0.26 Engineered strain Kv - Δhyc 25 6.4 3 0 0.26 Engineered strain Km - Δhyc 25 6.6 2.9 0 0.26

[0147] As can be seen from Table 2, the wild-type Klebsiella bacteria Kp, Ko, Kv, and Km can utilize glucose to synthesize 2,3-butanediol under anaerobic conditions, while producing hydrogen gas and accumulating formic acid in the fermentation broth.

[0148] The engineered bacteria Kp-Δhyc, Ko-Δhyc, Kv-Δhyc, and Km-Δhyc with inactivated hydrogenase-3 do not produce hydrogen gas, and the concentration of formic acid accumulated by the engineered bacteria in the fermentation broth is significantly higher than that of the wild-type strains.

[0149] Overall, both the wild-type Klebsiella bacteria and the engineered bacteria with inactivated hydrogenase-3 can utilize glucose to synthesize 2,3-butanediol under anaerobic conditions. However, the average synthesis amount of 2,3-butanediol by the engineered bacteria Kp-Δhyc, Ko-Δhyc, Kv-Δhyc, and Km-Δhyc with inactivated hydrogenase-3 is 14.5% higher than that of the wild-type Klebsiella bacteria, and the average conversion rate of raw materials is increased by 14.5%.

[0150] Example 5 Preparation of 1,3-propanediol by aerobic fermentation of glycerol using engineered bacteria

[0151] In this example, the engineered bacteria constructed by inactivating hydrogenase-3 (Δhyc) obtained in Example 1, the engineered bacteria constructed by simultaneously inactivating hydrogenase-3 (Δhyc) and lactate dehydrogenase (ldhA) obtained in Example 2, and the engineered bacteria constructed by simultaneously inactivating hydrogenase-3 (Δhyc), lactate dehydrogenase (ldhA), and alcohol dehydrogenase (adhE) obtained in Example 3 were respectively used to prepare 1,3-propanediol by aerobic fermentation. The specific steps are as follows:

[0152] 5.1 Fermentation of the Klebsiella engineered bacteria obtained in Example 1 to prepare 1,3-propanediol

[0153] The Klebsiella engineered bacteria obtained in Example 1 were subjected to aerobic fermentation to prepare 1,3-propanediol. The specific steps are as follows:

[0154] One loop of the slant cultures of Kp-Δhyc, Ko-Δhyc, Kv-Δhyc, and Km-Δhyc from Example 1 was respectively inoculated into 250 mL conical flasks containing 50 mL of LB medium, and the shaker cabinet was rotated at 100 revolutions per minute and incubated at a constant temperature of 37 °C for seed culture.

[0155] After 12 hours of seed culture, 50 mL of the seed culture broth was transferred into a 5 L fermenter containing 3 L of the fermentation medium. The composition of the fermentation medium was the same as that in Step 4.1 of Example 4. The rotation speed during the fermentation process was 150 rpm, and the aeration rate was 2 L / min.

[0156] After 12 hours of cultivation, the components in the fermentation broth were measured.

[0157] Meanwhile, the starting strains Klebsiella pneumoniae Kp, Klebsiella oxytoca Ko, Klebsiella variicola Kv, and Klebsiella michiganensis Km were used as the control group.

[0158] The method of Example 4 was used to detect the components of the fermentation broth. The results are shown in Table 3.

[0159] Table 3

[0160]

[0161] As can be seen from Table 3, the wild-type Klebsiella bacteria Kp, Ko, Kv, and Km can synthesize 1,3-propanediol using glycerol under aerobic conditions, and at the same time produce formic acid, lactic acid, ethanol, 2,3-butanediol, and acetic acid.

[0162] The engineered bacteria Kp-Δhyc, Ko-Δhyc, Kv-Δhyc, and Km-Δhyc with inactivated hydrogenase-3 synthesize the same types of metabolites. Among them, the synthesis amounts of lactic acid, 2,3-butanediol, and ethanol are lower than those of the wild-type strains. The synthesis amount of 2,3-butanediol is reduced by 19.0%; however, the synthesis amounts of 1,3-propanediol, acetic acid, and formic acid are significantly higher than those of the wild-type strains. The synthesis amount of 1,3-propanediol is increased by 13.9%.

[0163] 5.2 Fermentation of the Klebsiella engineered bacteria obtained in Example 2 to prepare 1,3-propanediol

[0164] The Klebsiella engineered bacteria obtained in Example 2 were subjected to aerobic fermentation to prepare 1,3-propanediol. The steps are as follows:

[0165] One loop of each of the slant cultures of Kp-ΔhycΔldhA, Ko-ΔhycΔldhA, Kv-ΔhycΔldhA, and Km-ΔhycΔldhA obtained in Example 2 was inoculated into a 250 mL conical flask containing 50 mL of LB medium. The shaking flask was rotated at 100 revolutions per minute, and seed culture was carried out at a constant temperature of 37 °C.

[0166] After 12 hours of seed culture, 50 mL of the seed culture broth was transferred to a 5 L fermenter containing 3 L of the fermentation medium. The composition of the fermentation medium was the same as that in Example 4.1. The rotation speed during fermentation was 150 rpm, and the aeration rate was 2 L / min.

[0167] After 11 hours of cultivation, the components in the fermentation broth were measured.

[0168] Meanwhile, the engineered bacteria Kp-ΔldhA, Ko-ΔldhA, Kv-ΔldhA, and Km-ΔldhA with only inactivated lactate dehydrogenase were used as the control group respectively.

[0169] The method of Example 4 was used to detect the components in the fermentation broth. The results are shown in Table 4.

[0170] Table 4

[0171]

[0172] As can be seen from Table 4, the engineered bacteria Kp-ΔldhA, Ko-ΔldhA, Kv-ΔldhA, and Km-ΔldhA with only lactate dehydrogenase inactivated can synthesize 1,3-propanediol using glycerol under aerobic conditions, and simultaneously produce formic acid, lactic acid, ethanol, 2,3-butanediol, and acetic acid. Compared with the wild-type strains in Table 3, the synthesis amount of lactic acid is significantly reduced.

[0173] The engineered bacteria Kp-ΔhycΔldhA, Ko-ΔhycΔldhA, Kv-ΔhycΔldhA, and Km-ΔhycΔldhA with both lactate dehydrogenase and hydrogenase-3 inactivated synthesize the same types of metabolites as the engineered bacteria with only lactate dehydrogenase inactivated. The synthesis amount of 1,3-propanediol is significantly increased compared with the engineered bacteria with only lactate dehydrogenase inactivated, with an average increase of 4.4%, and the synthesis amount of formic acid is increased by 4.1% on average; while the synthesis amounts of lactic acid, ethanol, and acetic acid all decrease.

[0174] 5.3 Fermentation of the Klebsiella engineered bacteria obtained in Example 3 to prepare 1,3-propanediol

[0175] The Klebsiella engineered bacteria obtained in Example 3 were subjected to aerobic fermentation to prepare 1,3-propanediol. The steps are as follows:

[0176] One loop of the slant strains of Kp-ΔhycΔldhAΔadhE, Ko-ΔhycΔldhAΔadhE, Kv-ΔhycΔldhAΔadhE, and Km-ΔhycΔldhAΔadhE obtained in Example 3 was respectively inoculated into 250 mL conical flasks containing 50 mL of LB medium. The shaking flask rotation speed was 100 revolutions per minute, and seed culture was carried out at a constant temperature of 37 °C.

[0177] After 12 hours of seed culture, 50 mL of the seed culture solution was inoculated into a 5 L fermenter, and the fermenter was filled with 3 L of the fermentation medium, and the components of the fermentation medium were the same as those in Example 4. The rotation speed during fermentation was 150 rpm, and the aeration rate was 2 L / min.

[0178] After culturing for 10.5 hours, the components in the fermentation broth were measured.

[0179] At the same time, the starting strains Klebsiella pneumoniae Kp, Klebsiella oxytoca Ko, Klebsiella variicola Kv, and Klebsiella michiganensis Km were used as the control group.

[0180] The method of Example 4 was used to detect the components in the fermentation broth. The results are shown in Table 5.

[0181] Table 5

[0182]

[0183] As can be seen from Table 5, the engineered bacteria Kp-ΔldhAΔadhE, Ko-ΔldhAΔadhE, Kv-ΔldhAΔadhE, and Km-ΔldhAΔadhE that inactivate lactate dehydrogenase and alcohol dehydrogenase simultaneously can synthesize 1,3-propanediol using glycerol under aerobic conditions, and simultaneously produce products such as formic acid, 2,3-butanediol, and acetic acid. Compared with the wild-type strain, the synthesis amounts of lactic acid and ethanol are significantly reduced; the synthesis amounts of 1,3-propanediol and 2,3-butanediol are significantly increased, with the average synthesis amounts increased by 6.6% and 31.0% respectively; the total amount of 1,3-propanediol and 2,3-butanediol is increased by 8.4% on average.

[0184] The engineered bacteria Kp-ΔhycΔldhAΔadhE, Ko-ΔhycΔldhAΔadhE, Kv-ΔhycΔldhAΔadhE, and Km-ΔhycΔldhAΔadhE that inactivate hydrogenase-3, lactate dehydrogenase, and alcohol dehydrogenase simultaneously synthesize the same types of metabolic products as the engineered bacteria that inactivate lactate dehydrogenase and alcohol dehydrogenase simultaneously. Among them, the synthesis amount of 1,3-propanediol is reduced by 7.7% compared with the engineered bacteria that inactivate lactate dehydrogenase and alcohol dehydrogenase simultaneously, while the synthesis amount of 2,3-butanediol is increased by 61.8%, and the synthesis amount of formic acid is increased by 41.7%.

[0185] Example 6 Preparation of 2,3-butanediol by aerobic fermentation of glucose by engineered bacteria

[0186] Using the engineered bacteria obtained in Examples 1-3 with glucose as the carbon source, 2,3-butanediol was prepared by aerobic fermentation respectively. The steps are as follows:

[0187] One loop of the slant cultures of the starting strains Klebsiella pneumoniae Kp, Klebsiella oxytoca Ko, Klebsiella variicola Kv, Klebsiella michiganensis Km and the engineered bacteria obtained in Examples 1-3 was inoculated into a 250 mL conical flask containing 50 mL of glucose fermentation medium. The shaking flask was rotated at 100 revolutions per minute and aerobically fermented at a constant temperature of 37 °C.

[0188] The components of the glucose fermentation medium were the same as in Step 4.2 of Example 4.

[0189] After culturing for 15 hours, the components in the fermentation broth were determined by liquid chromatography as in Example 4.

[0190] The fermentation results of each strain are shown in Table 6.

[0191] Table 6

[0192]

[0193]

[0194] As can be seen from Table 6, under aerobic fermentation conditions, wild-type Klebsiella bacteria can utilize glucose to synthesize 2,3-butanediol; under aerobic fermentation conditions, engineered bacteria Kp-ΔldhA, Ko-ΔldhA, Kv-ΔldhA, and Km-ΔldhA with only inactivated lactate dehydrogenase can also utilize glucose to synthesize 2,3-butanediol; under aerobic fermentation conditions, engineered bacteria Kp-ΔldhAΔadhE, Ko-ΔldhAΔadhE, Kv-ΔldhAΔadhE, and Km-ΔldhAΔadhE with both inactivated lactate dehydrogenase and alcohol dehydrogenase can also utilize glucose to synthesize 2,3-butanediol.

[0195] The engineered bacteria Kp-Δhyc, Ko-Δhyc, Kv-Δhyc, and Km-Δhyc with inactivated hydrogenase-3 constructed in Example 1 had significantly higher 2,3-butanediol synthesis amounts under aerobic conditions than the wild-type strain, with an average increase of 16.6%.

[0196] The engineered bacteria Kp-ΔhycΔldhA, Ko-ΔhycΔldhA, Kv-ΔhycΔldhA, and Km-ΔhycΔldhA with both inactivated lactate dehydrogenase and hydrogenase-3 constructed in Example 2 had significantly higher 2,3-butanediol synthesis amounts than the engineered bacteria with only inactivated lactate dehydrogenase, with an average increase of 6.9%; and had an average increase of 9.5% compared to wild-type Klebsiella bacteria.

[0197] The engineered bacteria Kp-ΔhycΔldhAΔadhE, Ko-ΔhycΔldhAΔadhE, Kv-ΔhycΔldhAΔadhE, and Km-ΔhycΔldhAΔadhE with both inactivated hydrogenase-3, lactate dehydrogenase, and alcohol dehydrogenase constructed in Example 3 had significantly higher 2,3-butanediol synthesis amounts than the Klebsiella bacteria with both inactivated lactate dehydrogenase and alcohol dehydrogenase, with an average increase of 17.3%; had an average increase of 27.1% compared to the engineered bacteria with both inactivated lactate dehydrogenase and hydrogenase-3 in Example 2; and had an average increase of 39.1% compared to wild-type Klebsiella bacteria.

[0198] The above examples only illustratively explain the principles and effects of the present invention, rather than being used to limit the present invention. Any person familiar with this technology can modify or change the above examples without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or changes completed by those with ordinary knowledge in the technical field without departing from the spirit and technical ideas disclosed by the present invention should still be covered by the claims of the present invention.

Claims

1. An engineered Klebsiella bacterium, characterized in that, The engineered bacterium is a Klebsiella bacterium with inactivated hydrogenase-3.

2. The engineered bacterium according to claim 1, wherein The Klebsiella bacterium is selected from species of the genus Klebsiella; preferably, it is selected from at least one of Klebsiella pneumoniae, Klebsiella oxytoca, Klebsiella variicola, Klebsiella michiganensis, Klebsiella quasipneumoniae, Klebsiella aerogenes, Klebsiella pseudovariicola, Klebsiella huaxiensis, Klebsiella africana, Klebsiella pasteurii, and Klebsiella grimontii; and / or, the gene encoding hydrogenase-3 comprises the hyc gene and the hyp gene.

3. The engineered bacteria according to claim 1 or 2, characterized in that, The nucleotide sequence of the hyc gene comprises the sequence shown in SEQ ID No.1; and / or, the nucleotide sequence of the hyp gene comprises the sequence shown in SEQ ID No.2; and / or, it further comprises inactivating at least one of lactate dehydrogenase and alcohol dehydrogenase.

4. The engineered bacterium according to claim 3, wherein, The gene encoding lactate dehydrogenase comprises ldhA; and / or, the gene encoding alcohol dehydrogenase comprises adhE.

5. The method for constructing the engineered bacteria according to any one of claims 1-4, characterized in that, It includes the following steps: inactivating the gene encoding hydrogenase-3 in the wild-type Klebsiella bacterium; Preferably, it further comprises inactivating the gene encoding lactate dehydrogenase; Preferably, it further comprises inactivating the gene encoding alcohol dehydrogenase.

6. Use of the engineered bacterium according to any one of claims 1-4 in the preparation of organic acids and / or polyols.

7. The use according to claim 6, characterized in that, The polyol is selected from one or both of 1,3-propanediol and 2,3-butanediol.

8. A method for preparing 1,3-propanediol, characterized in that, It includes the following steps: fermenting with the engineered bacterium according to any one of claims 1-4, and the fermentation substrate comprises glycerol.

9. A method for preparing 2,3-butanediol, characterized in that, It includes the following steps: fermenting with the engineered bacterium according to any one of claims 1-4, and the fermentation substrate comprises glucose.

10. Use of a gene in inhibiting hydrogen production by Klebsiella bacteria or promoting polyol synthesis by Klebsiella bacteria, characterized in that, The gene comprises the gene encoding hydrogenase-3, and inactivating the gene encoding hydrogenase-3 inhibits hydrogen production or increases the yield of polyols.

Images